International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Cervical cancer (CC) is the fourth most common type of cancer among women, with an estimated 661,021 new cases and 348,189 cancer-related deaths worldwide in 2022; moreover, its incidence in China has exhibited an increase in recent years as well (1,2). Although numerous patients with early-stage and locally advanced CC respond well to conventional treatments, such as surgery, radiotherapy and chemotherapy, the lack of effective treatment strategies remains an obstacle for patients with advanced-stage or recurrent disease (3,4). Some studies have yielded promising results regarding targeted therapies for advanced-stage CC, such as inhibitors of vascular endothelial growth factor and epidermal growth factor receptor (EGFR) (5–7). This emphasizes the importance of exploring molecular mechanisms in CC to seek for other therapeutic targets.
Eukaryotic translation initiation factor 3B (EIF3B), a subunit of the EIF3 complex, is a scaffold protein that regulates translation initiation and the cell cycle; it has been shown to participate in the pathogenesis of several types of cancer, including cholangiocarcinoma, pancreatic cancer, head and neck squamous cell carcinoma (HNSCC), hepatocellular carcinoma (HCC) (8–11). For instance, a previous study revealed that the depletion of EIF3B suppressed cell proliferation and migration, whereas it enhanced cell apoptosis in cholangiocarcinoma (9). Another study disclosed that EIF3B promoted the cell number, and invasion and migration in HNSCC by regulating CCAAT/enhancer binding protein-beta translation (11).
Methyltransferase-like (METTL) is a seven-chain methyltransferase family with an S-adenosylmethionine binding domain for nucleic acids, proteins and other small molecules (12). METTLs regulate gene transcription and translation via methylation modification and further participate in malignant progression across a wider range of cancer types (13). As a translation initiation factor, EIF3B has been identified to directly interact with METTL family members, and promotes cell proliferation and migration, as well as invasion in HCC (14); this suggests the involvement of EIF3B in METTL-mediated mRNA methylation and oncogenesis.
In a previous study, the authors reported that EIF3B was not only overexpressed, but was also associated with an elevated clinical stage, lymph node metastasis and unfavorable survival profiles in patients with CC (15), indicating the underlying oncogenic role of EIF3B in CC. However, whether EIF3B would interact with METTL3 to show its carcinogenesis role have not yet been reported, and their regulatory downstream pathways in CC is not clear. Hence, the present study aimed to explore the detailed mechanism through which EIF3B-METTL3 complex promotes CC progression by enhancing EGFR/AKT signaling through m6A-mediated mRNA translation.
Human cervical epithelial cells (HCerEpic; cat. no. 7060, ScienCell Research Laboratories, Inc.), as well as C-33 A (cat. no. HTB-31), HeLa (cat. no. CCL-2), SiHa (cat. no. HTB-35) and CaSki [cat. no. CRL-1550; all from American Type Culture Collection (ATCC)] cells were cultured in cervical epithelial cell medium, which contains basal medium and Cervical Epithelial Cell Growth Supplement (cat. no. 7061; ScienCell Research Laboratories, Inc.) or Eagle's minimum essential medium with Earle's salts, L-glutamine, and non-essential amino acids, without sodium bicarbonate (cat. no. M0643; MilliporeSigma). The medium was supplemented with 10% fetal bovine serum (FBS; cat. no. ABS972; Absin Bioscience Inc.). Cells at passages 3–10 were adopted for subsequent experiments.
Cells were plated to 6-well plates, and cultured to 60% confluence. Overexpression plasmid (5 µg) or small interference RNA (siRNA, 75 pmol) of EIF3B (5 µg oeEIF3B or 75 pmol siEIF3B, GenScript Biotech Corporation) and negative controls (5 µg oeNC and 75 pmol siNC, GenScript Biotech Corporation) were transfected into HeLa or SiHa cells with the utilization of ExFect transfection reagent (cat. no. T101-01; Vazyme Biotech Co., Ltd.) for 6 h at 37°C. Untransfected cells were set as the normal controls. In total, three siRNA target sites of EIF3B were designed and validated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) to select the most efficient siRNA site (Fig. S1A) 48 h after transfection. The siRNA sequences were as follows: siEIF3B (sense: CGGUGAUUGUAGUGGACAATT; antisense: UUGUCCACUACAAUCACCGTT) and siNC (sense: UUCUCCGAACGUGUCACGUTT; antisense: ACGUGACACGUUCGGAGAATT).
METTL3 siRNA (siMETTL3, 75 pmol) or siNC (75 pmol) were co-transfected with oeEIF3B (5 µg) or oeNC (5 µg) into HeLa and SiHa cells. The ExFect transfection reagent (Vazyme Biotech Co., Ltd.) was applied to complete transfection for 6 h at 37°C. The most efficient siRNA of METTL3 was selected from three siRNA target sites using RT-qPCR (Fig. S1B) at 48 h after transfection. The sequences of siMETTL3 were as follows: siMETTL3 (sense: CAGUGGAUCUGUUGUGAUATT; antisense: UAUCACAACAGAUCCACUGTT).
RNA in cells was isolated using VeZol Reagent (cat. no. R411-01; Vazyme Biotech Co., Ltd.). For the completion of reverse transcription and qPCR, the RT SuperMix for qPCR (cat. no. R222-01; Vazyme Biotech Co., Ltd.) and Universal SYBR qPCR Master Mix (cat. no. Q711-02; Vazyme Biotech Co., Ltd.) were used according to the manufacturer's instructions. The qPCR thermocycling conditions were as follows: 95°C for 30 sec, 1 cycle; 95°C for 5 sec, 61°C for 30 sec, 40 cycles. The primers (5′-3′) used were as follows: EIF3B forward, CGTATGTGCGTTGGTCTCCTAA and reverse, CCTTGGTGGCTGAATCTCTGAAT; EGFR forward, GGACAGCATAGACGACACCTTC and reverse, CCTGGCTTGGACACTGGAGA; METTL3 forward, TTGTAACCTATGCTGACCATTCCA and reverse, ACCTTCTTGCTCTGTTGTTCCTT; GAPDH forward, GAGTCCACTGGCGTCTTCAC and reverse, ATCTTGAGGCTGTTGTCATACTTCT. The results were analyzed with the 2−ΔΔCq method (16).
Protein was extracted from the cells and lysed using RIPA buffer (cat. no. P0013B; Beyotime Institute of Biotechnology) and quantified using the BCA kit (cat. no. G2026; Wuhan Servicebio Technology Co., Ltd.). Precast gel (4–20%) (cat. no. P0822; Beyotime Institute of Biotechnology) and nitrocellulose membrane (cat. no. 66485; Pall Life Sciences) were used to separate and blot the 10 µg protein. The primary antibodies including EIF3B (1:5,000; cat. no. 10319-1-AP), METTL3 (1:10,000; cat. no. 15073-1-AP), N-cadherin (1:5,000; cat. no. 22018-1-AP), E-cadherin (1:5,000; cat. no. 20874-1-AP), Vimentin (1:20,000; cat. no. 10366-1-AP), EGFR (1:10,000; cat. no. 18986-1-AP), protein kinase B (AKT; 1:10,000; cat. no. 10176-2-AP), phosphorylated (p)-AKT (1:10,000; cat. no. 28731-1-AP) and GAPDH (1:10,000; cat. no. 10494-1-AP; all from Proteintech Group, Inc.) were incubated with the membrane overnight at 4°C. The HRP-conjugated secondary antibody (1:20,000; cat. no. GB23303; Wuhan Servicebio Technology Co., Ltd.) was incubated with the membrane at 37°C for 1 h. The protein bands were exposed using an ECL kit (G2020, Wuhan Servicebio Technology Co., Ltd.). Densitometric analysis was conducted by ImageJ v1.8 (National Institutes of Health).
The Cell Counting Kit-8 (CCK-8; cat. no. G4103; Wuhan Servicebio Technology Co., Ltd.) was adopted to measure cell proliferation at 0, 24, 48 and 72 h post-transfection. The procedures were accomplished according to the manufacturer's instructions. In brief, 3×103 cells were plated in 96-well plates a night before analysis. The mixture of 10 µl CCK-8 and 100 µl culture medium was cultured with cells for another 2 h at 37°C. Afterward, the optical density value at 450 nm was measured.
Cell apoptosis was assessed at 48 h using the terminal deoxynucleotidyl transferase (TdT) dUTP nick-end labeling (TUNEL) assay kit (cat. no. C1089; Beyotime Institute of Biotechnology). According to the protocols, the cells were fixed in 4% paraformaldehyde at room temperature for 30 min and incubated with TUNEL working solution for 1 h in the dark at 37°C. The nuclei were stained with DAPI (Beyotime Institute of Biotechnology) for 5 min at 37°C in the dark. The cells were sealed with mounting medium (Beyotime Institute of Biotechnology) after being rinsed with PBS. The images of 3 fields were captured using an inverted fluorescence microscope (Motic Incorporation, Ltd.).
A Matrigel matrix basement membrane-precoated Transwell insert (cat. no. 3422; Corning, Inc.) was applied to complete the evaluation at 48 h. The resuspended single cells in FBS-free medium were cultivated in inserts for 24 h at 37°C. Images of the invasive cells were captured after being stained with 0.1% crystal violet (cat. no. GC307002-25g; Wuhan Servicebio Technology Co., Ltd.) at 37°C for 5 min under an inverted microscope (Motic Incorporation, Ltd.).
The HeLa and SiHa cells were lysed using RIPA lysis buffer. Protein A+G Magnetic Beads (20 µl; cat. no. P2108; Beyotime Institute of Biotechnology) were incubated with METTL3 antibody (1:100) or IgG antibody (1:200; cat. no. 30000-0-AP; Proteintech Group, Inc.) for 1 h at room temperature. Subsequently, the lysate was incubated with protein A+G agarose beads overnight at 4°C. Finally, the eluate was analyzed using western blot analysis.
The analyses of CC data sourced from TCGA database were performed using The University of Alabama at Birmingham Cancer data analysis Portal (UALCAN) (https://ualcan.path.uab.edu/index.html), including the expression of METTL3 expression and its correlation with the survival in patients with cervical squamous cell carcinoma (CESC) (17).
Data are presented as the mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism 9.0 (Dotmatics). Differences between groups were analyzed using the Wilcoxon's rank sum test or one-way ANOVA followed by Dunnett's or Tukey's multiple comparisons tests as appropriate. The correlation of METTL3 with survival was conducted by the log-rank test. P<0.05 was considered to indicate a statistically significant difference.
The EIF3B mRNA and protein expression levels were elevated in several CC cell lines, including C-33A, HeLa, SiHa and CaSki, compared with the HCerEpiC cells (Fig. 1). Since the EIF3B mRNA and protein expression levels were highest in the HeLa cells and lowest in the SiHa cells among all tested CC cells, the two cell lines were selected for use in subsequent experiments.
oeEIF3B increased, while siEIF3B decreased EIF3B mRNA and protein expression levels in the HeLa and SiHa cell lines, indicating the successful transfection of oeEIF3B and siEIF3B (Fig. 2A-C).
CCK-8, TUNEL and Transwell assays were used to measure cell proliferation, apoptosis and invasion, respectively. It was disclosed that oeEIF3B promoted the cell proliferative capacity and invasive cell count but decreased the cell apoptotic rate in the HeLa and SiHa cell lines (Fig. 2D-H). On the contrary, siEIF3B exerted an opposite effect on these cellular functions.
In the HeLa cell line, the N-cadherin and vimentin were elevated in oeEIF3B group compared with the oeNC group, while E-cadherin was decreased in the oeEIF3B group compared with the oeNC. The opposite trend was observed in the siEIF3B group compared with the siNC group. Similarly, the SiHa cell line also showed the similar results (Fig. S2A and B). These findings indicated that the oeEIF3B might aggravate the EMT and invasion processes.
Considering that EIF3B has been previously reported to specifically bind to the METTL to promote tumor progression (14), the present study further selected METTL3 as a protein partner of EIF3B in CC. The co-IP assay revealed that EIF3B directly bound to METTL3 (Fig. 3A). The empty bands for the IgG indicated that there was no non-specific adsorption occurred in the experimental system. Subsequently, the potential downstream EGFR/AKT signaling pathway was explored. oeEIF3B elevated EGFR and p-AKT expression levels in the HeLa and SiHa cell lines; by contrast, siEIF3B reduced EGFR and p-AKT expression levels (Fig. 3B-D). These findings suggested that EIF3B specifically binds to METTL3, and activates the EGFR/AKT signaling pathway in CC.
The METTL3 mRNA and protein expression levels were suppressed by transfection with siMETTL3 in HeLa and SiHa cell lines, which indicated that the transfection was successful (Fig. 4A-C). In both the HeLa and SiHa cell lines, oeEIF3B did not affect the expression of METTL3 mRNA and protein; moreover, siMETTL3 did not alter the mRNA and protein expression of EIF3B. Together with the findings of the co-IP assay, it was suggested that EIF3B and METTL3 formed a complex to exert their functions in CC.
siMETTL3 suppressed cell proliferative capacity and the invasive cell count but facilitated the apoptosis of the HeLa and SiHa cell lines, regardless of the presence or absence of oeEIF3B (Fig. 5A-E). Moreover, following transfection with siMETTL3, oeEIF3B lost its regulatory effect on cell proliferative capacity, apoptotic rate and invasive ability of the HeLa and SiHa cell lines. These findings indicated that EIF3B exerted its cancer-promoting effects through forming a complex with METTL3 in CC.
siMETTL3 reduced the EGFR and p-AKT expression levels in HeLa and SiHa cell lines, and its regulatory effect was not affected by oeEIF3B. Nevertheless, the promoting effect of oeEIF3B on EFGR and p-AKT expression was attenuated by transfection with siMETTL3 (Fig. 6A-C). These findings suggested that EIF3B activated EGFR/AKT signaling via forming a complex with METTL3 in CC.
Combining the aforementioned data, it was hypothesized that EIF3B and METTL3 form a complex to activate the EGFR/AKT signaling pathway, and subsequently regulate cell proliferation, apoptosis and invasion in CC. The details of this interaction are illustrated in Fig. 7.
The expression of METTL3 was highly expressed in the tumor tissue compared with the non-tumor tissue in patients with CESC (Fig. S3A). However, METTL3 did not associate with the survival in patients with CESC (Fig. S3B).
EIF3, serving as a scaffold, encircles the 40S ribosome and coordinates the actions of other EIFs during translation (18). The capability of EIF3 family members in facilitating gynecological cancer progression has been well elucidated (18–21). As demonstrated in a previous study, EIF3D promoted cervical carcinoma growth via the Warburg effect both in vitro and in vivo (19). Another study reported that EIF3D overexpression induced stem cell properties and the metastasis of CC cells (20). Of note, another study found that the inhibition of EIF3B compromised cell proliferation, but increased the apoptosis of ovarian cancer cells, indicating that EIF3B may be a possible target for ovarian cancer treatment (21).
The present study observed that EIF3B expression was elevated in several CC cell lines compared with normal cervical epithelial cells; moreover, EIF3B facilitated cell proliferation and invasion, whereas it inhibited the apoptosis of CC cells. The possible explanations for these effects are as follows: i) EIF3B interfered with cell cycle arrest to enhance the malignant anti-apoptotic properties (22); ii) EIF3B, as a translational factor, induced EMT by the preferential translation of Snail, and activated the EMT process, promoting the migration and invasion of tumor cells (23–25). In summary, EIF3B promoted the proliferation and invasion, and suppressed the apoptosis of CC cells.
METTL3 is a catalytically active N6-methyladenosine (m6A) writer that comprises a zinc finger domain and a methyltransferase domain, whose modulatory role in the progression of various cancers is indispensable (12,26–29). For example, a recent study demonstrated that the knockdown of METTL3 inhibited cell proliferation, invasion, migration and angiogenesis, whereas it promoted the apoptosis of esophageal cancer (27). Another study reported that METTL3 accelerated the cell viability, invasion, migration and EMT of laryngeal squamous cell carcinoma cells by upregulating WISP1 expression (28). Similarly, the present study demonstrated that siMETTL3 suppressed the proliferation and invasion, whereas it promoted the apoptosis of CC. The possible reasons for these effects may be the following: i) METTL3 stimulated m6A modification, and the latter was required for the tumor malignancy process (30); ii) METTL3 also exerted a catalytic activity to trigger several oncogenes, thereby engaging in tumor progression (31). As a result, the suppression of METTL3 inhibited cell proliferation and invasion, whereas it promoted apoptosis in CC.
Apart from its cancer-promoting function, METTL3 facilitates the translation due to its regulatory role of m6A modification as well (32,33). A recent study demonstrated that the METTL3-EIF3H interaction participated in colorectal tumorigenesis (33). Notably, the present study found that EIF3B mediated the malignant processes by specifically binding to METTL3 in CC, which could be explained as follows: i) On the one hand, METTL3 needed the interaction with translating-initiation factors to stimulate its m6A RNA methyltransferase activity and catalytic activity (32); on the other hand, METTL enhanced the translation efficacy of EIF3B by stimulating the interplay of EIF3 complex and the 40S ribosomal subunit (14). Consequently, EIF3B and METTL3 formed a complex in CC. ii) EIF3B was characterized by translating-initiating feature, whose biological function required the cooperation of METTL protein (14). Thus, EIF3B may play a CC-promoting role by forming a complex with METTL3.
EGFR, a member of the receptor tyrosine kinase family, relates to multiple tumor malignant phenotypes and has become a target for the treatment of certain types of cancer, including breast cancer, HNSCC and CC (34,35). Furthermore, AKT is a target of phosphoinositide 3-kinase that plays a regulatory role in epithelial cell motility and invasion by phosphorylating a large number of substrates (36). In the present study, it was demonstrated that EIF3B overexpression increased the levels EGFR and p-AKT, while the silencing of METTL3 suppressed these levels in CC, suggesting that EGFR/AKT signaling may serve as the downstream pathway of EIF3B and METTL3. Furthermore, the present study also revealed that EIF3B could not activate EGFR/AKT without METTL3. The probable explanation for this is as follows: METTL3 has been reported to promote the translation of EGFR in human cancer cells, and the initiation of this translation process is mediated by EIF3B (37). Apart from that, METTL3 could promote the translation of EGFR in various cancers, such as the lung cancer cells and HCC, and it could be deduce that EGFR might also be the downstream of METTL3 in CC (37,38). Thus, the EIF3B-METTL3 complex facilitated EGFR/AKT signaling in CC, and EIF3B alone could not exert the regulatory effect.
Besides, the present study has certain limitations. First, the apoptosis data should be verified by flow cytometry assay and TUNEL assay. However, this parameter was only detected by the TUNEL assay. Further study could consider verifying this issue by both methods. Second, METTL3 is a methyltransferase and its interaction with EIF3B might be through multi-mechanism including its effect on the methyltransferase of EIF3B. Third, according to the analysis of METTL3 expression in the GEPIA database, there are only 13 non-tumor tissues, which would largely decrease the reliability of the results. Therefore, further larger sample size study is needed to verify this finding (4). The m6A RIP-qPCR should be conducted to confirm METTL3-dependent methylation of EGFR mRNA, which would be a further study direction.
In conclusion, EIF3B binds to METTL3 to form a complex, thereby promoting cell proliferation and invasion, and activating EGFR/AKT signaling in CC. The findings suggest that EIF3B may serve as a therapeutic target in CC; however, further studies are warranted to validate these findings.
Not applicable.
The present study was supported by Top Talent of Changzhou ‘The 14th Five-Year Plan’ High-Level Health Talents Training Project (No.2022CZBJ085), The third level of the sixth ‘333 High level Talent Training Project’ in Jiangsu Province (No.2022 3-4-162), The Application Foundation Project of Changzhou Science and Technology Bureau (No. CJ20245041), The Science and Technology Development Foundation Project of Nanjing Medical University (No.NMUB20240054), Science and Technology Development Fund of Nanjing Medical University (No.NMUB20230054) and Research project of Changzhou Maternal and Child Health Hospital (No. YJ202408).
The data generated in the present study may be requested from the corresponding author.
PZ contributed to the study conception and design. CZ and XF performed data collection and analysis. JY was responsible for the interpretation of data. PZ and CZ confirm the authenticity of all the raw data. All authors contributed to drafting of article and revising it critically for important intellectual content. All authors read and approved the final version of the manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
|
Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I and Jemal A: Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 74:229–263. 2024. View Article : Google Scholar : PubMed/NCBI | |
|
Han B, Zheng R, Zeng H, Wang S, Sun K, Chen R, Li L, Wei W and He J: Cancer incidence and mortality in China, 2022. J Natl Cancer Cent. 4:47–53. 2024. View Article : Google Scholar : PubMed/NCBI | |
|
Francoeur AA, Monk BJ and Tewari KS: Treatment advances across the cervical cancer spectrum. Nat Rev Clin Oncol. 22:182–199. 2025. View Article : Google Scholar : PubMed/NCBI | |
|
Xu M, Cao C, Wu P, Huang X and Ma D: Advances in cervical cancer: Current insights and future directions. Cancer Commun (Lond). 45:77–109. 2025. View Article : Google Scholar : PubMed/NCBI | |
|
Tanigawa T, Takeshima N, Ishikawa H, Nishio S, Usami T, Yamawaki T, Oishi T, Ihira K, Kato H, Goto M, et al: Paclitaxel-carboplatin and bevacizumab combination with maintenance bevacizumab therapy for metastatic, recurrent, and persistent uterine cervical cancer: An open-label multicenter phase II trial (JGOG1079). Gynecol Oncol. 165:413–419. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Muthusami S, Sabanayagam R, Periyasamy L, Muruganantham B and Park WY: A review on the role of epidermal growth factor signaling in the development, progression and treatment of cervical cancer. Int J Biol Macromol. 194:179–187. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Fontenot VE, Francoeur A and Tewari KS: Review of emerging biological therapies for recurrent and advanced metastatic cervical cancer. Expert Opin Biol Ther. 24:709–713. 2024. View Article : Google Scholar : PubMed/NCBI | |
|
Feng X, Li J and Liu P: The Biological roles of translation initiation factor 3b. Int J Biol Sci. 14:1630–1635. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Huang R, Nie W, Mi L, Yao C and Zhu H: EIF3B stabilizes PCNA by counteracting SYVN1-mediated ubiquitination to serve as a promotor in cholangiocarcinoma. Aging. 16:7311–7330. 2024.PubMed/NCBI | |
|
Zhu H, Shan Y, Ge K, Lu J, Kong W and Jia C: EIF3B promotes cancer progression in pancreatic cancer. Scand J Gastroenterol. 56:281–288. 2021. View Article : Google Scholar : PubMed/NCBI | |
|
Xu C, Shen Y, Shi Y, Zhang M and Zhou L: Eukaryotic translation initiation factor 3 subunit B promotes head and neck cancer via CEBPB translation. Cancer Cell Int. 22:1612022. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang H, Sun F, Jiang S, Yang F, Dong X, Liu G, Wang M, Li Y, Su M, Wen Z, et al: METTL protein family: Focusing on the occurrence, progression and treatment of cancer. Biomark Res. 12:1052024. View Article : Google Scholar : PubMed/NCBI | |
|
Qi YN, Liu Z, Hong LL, Li P and Ling ZQ: Methyltransferase-like proteins in cancer biology and potential therapeutic targeting. J Hematol Oncol. 16:892023. View Article : Google Scholar : PubMed/NCBI | |
|
Su R, Dong L, Li Y, Gao M, He PC, Liu W, Wei J, Zhao Z, Gao L, Han L, et al: METTL16 exerts an m6A-independent function to facilitate translation and tumorigenesis. Nat Cell Biol. 24:205–216. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Zhu P, Tan Q, Jiang W, Ou Y, Xu P and Yuan L: Eukaryotic translation initiation factor 3B is overexpressed and correlates with deteriorated tumor features and unfavorable survival profiles in cervical cancer patients. Cancer Biomark. 26:123–130. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Chandrashekar DS, Karthikeyan SK, Korla PK, Patel H, Shovon AR, Athar M, Netto GJ, Qin ZS, Kumar S, Manne U, et al: UALCAN: An update to the integrated cancer data analysis platform. Neoplasia. 25:18–27. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Zeman J, Itoh Y, Kukacka Z, Rosůlek M, Kavan D, Kouba T, Jansen ME, Mohammad MP, Novák P and Valášek LS: Binding of eIF3 in complex with eIF5 and eIF1 to the 40S ribosomal subunit is accompanied by dramatic structural changes. Nucleic Acids Res. 47:8282–8300. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Liu Q, Liu J, Zheng D, Zhang R, Xiang Y, Xu F, Zhou X and Qin J: EIF3D promoted cervical carcinoma through Warburg effect by interacting with GRP78. J Obstet Gynaecol. 43:21302002023. View Article : Google Scholar : PubMed/NCBI | |
|
Zhong Y and Lan J: Overexpression of Eukaryotic translation initiation factor 3D induces stem cell-like properties and metastasis in cervix cancer by activating FAK through inhibiting degradation of GRP78. Bioengineered. 13:1952–1961. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Wang L and Ouyang L: Effects of EIF3B gene downregulation on apoptosis and proliferation of human ovarian cancer SKOV3 and HO-8910 cells. Biomed Pharmacother. 109:831–837. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Ren H, Mai G, Liu Y, Xiang R, Yang C and Su W: Eukaryotic Translation initiation factor 3 Subunit B is a promoter in the development and progression of pancreatic cancer. Front Oncol. 11:6441562021. View Article : Google Scholar : PubMed/NCBI | |
|
Sobocan M, Smolle MA, Schatz C and Haybaeck J: The interplay of tumor stroma and translational factors in endometrial cancer. Cancers (Basel). 12:20742020. View Article : Google Scholar : PubMed/NCBI | |
|
Liaghat M, Ferdousmakan S, Mortazavi SH, Yahyazadeh S, Irani A, Banihashemi S, Seyedi Asl FS, Akbari A, Farzam F, Aziziyan F, et al: The impact of epithelial-mesenchymal transition (EMT) induced by metabolic processes and intracellular signaling pathways on chemo-resistance, metastasis, and recurrence in solid tumors. Cell Commun Signal. 22:5752024. View Article : Google Scholar : PubMed/NCBI | |
|
Huang Y, Hong W and Wei X: The molecular mechanisms and therapeutic strategies of EMT in tumor progression and metastasis. J Hematol Oncol. 15:1292022. View Article : Google Scholar : PubMed/NCBI | |
|
Li N, Wei X, Dai J, Yang J and Xiong S: METTL3: A multifunctional regulator in diseases. Mol Cell Biochem. 480:3429–3454. 2025. View Article : Google Scholar : PubMed/NCBI | |
|
Guo X, Huang A, Qi Y, Chen J, Yang M and Jin M: METTL3/IGF2BP2 promotes the malignant progression of esophageal cancer by activating the PIK3CA/AKT pathway. Thorac Cancer. 16:e700222025. View Article : Google Scholar : PubMed/NCBI | |
|
Liang W, Peng Z, Mingchu Z and Deshui Y: METTL3 mediated WISP1 m6A modification promotes epithelial-mesenchymal transition and tumorigenesis in laryngeal squamous cell carcinoma via m6A reader IGF2BP1. Gene. 941:1492222025. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang H, Sun F, Cao H, Yang L, Yang F, Chen R, Jiang S, Wang R, Yu X, Li B and Chu X: UBA protein family: An emerging set of E1 ubiquitin ligases in cancer-A review. Int J Biol Macromol. 308:1422772025. View Article : Google Scholar : PubMed/NCBI | |
|
Singh S, Gupta S, Abhishek R and Sachan M: Regulation of m6A (N6-Methyladenosine) methylation modifiers in solid cancers. Funct Integr Genomics. 24:1932024. View Article : Google Scholar : PubMed/NCBI | |
|
Zeng C, Huang W, Li Y and Weng H: Roles of METTL3 in cancer: Mechanisms and therapeutic targeting. J Hematol Oncol. 13:1172020. View Article : Google Scholar : PubMed/NCBI | |
|
Choe J, Lin S, Zhang W, Liu Q, Wang L, Ramirez-Moya J, Du P, Kim W, Tang S, Sliz P, et al: mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis. Nature. 561:556–560. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Zheng R, Zhang K, Tan S, Gao F, Zhang Y, Xu W, Wang H, Gu D, Zhu L, Li S, et al: Exosomal circLPAR1 functions in colorectal cancer diagnosis and tumorigenesis through suppressing BRD4 via METTL3-eIF3h interaction. Mol Cancer. 21:492022. View Article : Google Scholar : PubMed/NCBI | |
|
Dickerson H, Diab A and Al Musaimi O: Epidermal growth factor receptor tyrosine kinase inhibitors in cancer: Current use and future prospects. Int J Mol Sci. 25:100082024. View Article : Google Scholar : PubMed/NCBI | |
|
Hamid MB, Serafin AM and Akudugu JM: Selective therapeutic benefit of X-rays and inhibitors of EGFR, PI3K/mTOR, and Bcl-2 in breast, lung, and cervical cancer cells. Eur J Pharmacol. 912:1746122021. View Article : Google Scholar : PubMed/NCBI | |
|
Hua H, Zhang H, Chen J, Wang J, Liu J and Jiang Y: Targeting Akt in cancer for precision therapy. J Hematol Oncol. 14:1282021. View Article : Google Scholar : PubMed/NCBI | |
|
Lin S, Choe J, Du P, Triboulet R and Gregory RI: The m(6)A methyltransferase METTL3 promotes translation in human cancer cells. Mol Cell. 62:335–345. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Wang L, Yang Q, Zhou Q, Fang F, Lei K, Liu Z, Zheng G, Zhu L, Huo J, Li X, et al: METTL3-m6A-EGFR-axis drives lenvatinib resistance in hepatocellular carcinoma. Cancer Lett. 559:2161222023. View Article : Google Scholar : PubMed/NCBI |