Open Access

Association between host TNF‑α, TGF‑β1, p53 polymorphisms, HBV X gene mutation, HBV viral load and the progression of HBV‑associated chronic liver disease in Indonesian patients

  • Authors:
    • Citrawati Dyah Kencono Wungu
    • Mochamad Amin
    • S. Eriaty N. Ruslan
    • Priyo Budi Purwono
    • Ulfa Kholili
    • Ummi Maimunah
    • Poernomo Boedi Setiawan
    • Maria Inge Lusida
    • Soetjipto Soetjipto
    • Retno Handajani
  • View Affiliations

  • Published online on: September 9, 2019     https://doi.org/10.3892/br.2019.1239
  • Pages: 145-153
  • Copyright: © Kencono Wungu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

In developing countries, including Indonesia, there is a high mortality rate associated with the progression of hepatitis B virus (HBV)‑associated chronic liver disease (CLD). The pathogenesis of HBV infection is influenced by viral and host factors. To determine potential associations between these factors, host single nucleotide polymorphisms (SNPs) on TNF‑α, TGF‑β1 and p53, HBV X gene mutation and HBV viral load were investigated in patients with HBV‑associated CLD in Surabaya, Indonesia. Sera were collected from 87 CLD patients with HBV infection. TNF‑α, TGF‑β1 and p53 SNPs were genotyped by PCR restriction fragment length polymorphism. The HBV X gene was sequenced and compared with reference strains to determine mutations and the viral load was measured using reverse transcription‑quantitative PCR. In Indonesian patients, no association between TNF‑α, TGF‑β1 and p53 SNPs and CLD or X gene mutation were identified. A total of 23% (20/87) of samples had HBV X gene mutations, including ten substitution types, one deletion and one insertion. Multinomial regression analysis revealed that the K130M/V131I mutations were correlated with CLD progression (OR, 7.629; 95% CI, 1.578‑36.884). Significant differences in viral load were found in HBV‑infected patients who had X gene mutations, such as R87W/G, I127L/T/N/S and K130M/V131I mutations (P<0.05). The presence of K130M and V131I mutations may be predictive for the progression of HBV‑associated CLD in Indonesia.

Introduction

Hepatitis B virus (HBV) infection is a major health problem worldwide, especially in developing countries (1,2). The WHO stated that in 2015, ~257 million people were living with an HBV infection and 887,000 people died from this condition, mostly from chronic liver disease (CLD) complications, such as liver cirrhosis (LC) and hepatocellular carcinoma (HCC) (3). The progression of HBV infection can be influenced by several factors, including viral, host and environmental ones. Variations in host genes are associated with the integration of mutated HBV genes that alter host genes and cause CLD (4,5).

TNF-α is a multifunctional cytokine that regulates inflammatory reactions and plays an important role in the pathogenesis of liver disease, infectious diseases and inflammation (5). The single-nucleotide polymorphism (SNP)-238 G/A and -308 G/A are SNPs of TNF-α gene promoters that have been a focus of several previous works, and were reported to affect TNF-α production at the transcriptional level (6,7). Another cytokine that contributes to the progression of HBV infection is TGF-β1. The SNP-509 C/T in the TGF-β1 promoter is reported to be associated with changes in the plasma TGF-β1 concentration (8-10). Genes that play a role in controlling the cell cycle, such as p53, also play an important role in the pathogenesis of CLD (11,12). The SNP Arg72Pro on the p53 gene disrupts the stability and function of p53 by inhibiting the cell cycle and apoptosis (12-14).

Interactions between host and viral factors are known to play an important role in the pathogenesis of HBV infection (15,16). Mutated HBV X protein (HBx) increases the progression and metastasis of cancer cells (17,18). When the HBx mutant is formed, there is a transformation increase that continuously affects the host genome (19). Specifically, the integration of HBx into the host genome leads to the upregulation of certain important genes, including NF-κB, TNF-α and TGF-β1, and the downregulation of p53(20).

There is still an incomplete understanding of the interactions of SNPs on the TNF-α, TGF-β1 and p53 genes in CLD patients with chronic HBV infection. In the present study, to obtain a deeper understanding of the pathogenesis of CLD, we investigated the associations between these principal SNPs, HBV X gene mutation and viral load in patients with chronic HBV infection.

Materials and methods

Sampling

This work involved a cross-sectional study using 87 blood samples collected from patients with chronic HBV at the inpatient/outpatient clinics of the Department of Internal Medicine, Dr. Soetomo General Hospital (Surabaya, Indonesia) between September 2016-May 2017 with a mean age of 47.0±12.5 years (64 male and 23 female). Inclusion criteria were as follows: CLD with chronic HBV infection; >16 years; willing to participate as research subjects; conscious; not in an emergency state; never been vaccinated for HBV; and HBV infection <10 years. Exclusion criteria were as follows: Co-infection with hepatitis C virus or HIV; and undergoing immunosuppressant therapy. This study received approval from the Ethics Committee of Dr. Soetomo General Hospital (approval no. 0949/KEPK/II/2019). Written informed consent was provided by the participants, in accordance with the Declaration of Helsinki. Patients were classified by CLD stage: (i) Chronic hepatitis (CH); (ii) LC; and (iii) HCC. The classification was determined by a hepatologist. CH was diagnosed based on positive HBsAg for >6 months without any LC/HCC specific clinical features, laboratory and radiology manifestation. LC was diagnosed based on clinical features of portal hypertension, liver stiffness by fibroscan and abnormal liver morphology by ultrasound. HCC was diagnosed based on clinical manifestation, α-fetoprotein ≥200 ng/ml and HCC-typical ultrasound findings. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), platelet and HBeAg were obtained from medical records.

Genomic DNA extraction

Host DNA was extracted from peripheral blood mononuclear cell isolated from blood samples and viral DNA was extracted from 100 µl serum using QIAamp DNA Extraction kit (cat. no. 51104; Qiagen, Inc.) in accordance with the manufacturer's instructions.

HBV load measurement

Viral load was assessed in the extracted viral DNA from all 87 blood samples using a Taqman quantitative (q)PCR method for absolute quantification by the CFX96™ Real-Time PCR Detection system (Bio-Rad Laboratories, Inc.) with the Master Mix Real-Time PCR iTaq Universal Probes Supermix (cat. no. 1725130; Bio-Rad Laboratories, Inc.) in accordance with the manufacturer's instructions. The probes used was HBSP1 (FAM-5'-CAGAGTCTAGACTCGTGGTGGACTTC-3'-TAMRA). Primers included: SF1 forward, 5'-CACATCAGGATTCCTAGGACC-3' and SR1 reverse, 5'-GGTGAGTGATTGGAGGGTTG-3'. qPCR was performed with thermocycling condition as follows: 50˚C for 2 min, 95˚C for 10 min, followed by 53 cycles of 95˚C for 20 sec and 60˚C for 1 min (21). Data reading was performed by Biorad CFX Maestro software version number 4.1.2433.1219 (Bio-Rad Laboratories, Inc.).

PCR restriction fragment length polymorphism (RFLP) of TNF-α, TGF-β1 and p53 on host genome

PCR was carried out on host genome using PCR Master Mix Solution (cat. no. 25027; iNtRON® Biotechnology, Inc.). The primers, thermocycling conditions and restriction enzymes used are listed in Table I. All PCR products were assessed by 2% agarose gel electrophoresis under UV light. All restriction enzyme incubation steps were carried out overnight at 37˚C, except for BstUI for which 60˚C were applied.

Table I

Primers and restriction enzymes used for host SNP and hepatitis B virus X gene detection.

Table I

Primers and restriction enzymes used for host SNP and hepatitis B virus X gene detection.

SNPDirectionSequence (5'-3')Amplicon (bp)Thermocycling conditionsRestriction enzyme
TNF-α-238Forward AGGCAATAGGTTTTGAGGG10794˚C for 5 min; 40x 94˚C for 30 sec,MspI
  CCAT 60˚C for 30 sec and 72˚C for 40 sec; 72˚C for 7 min 
 Reverse TCCTCCCTGCTCCGATTCCG   
TNF-α-308Forward AGAAGACCCCCCTCGGAACC15294˚C for 5 min; 40x 94˚C for 30 sec;NcoI
    58.5˚C for 30 sec and 72˚C for 40 sec; 72˚C for 7 min 
 Reverse ATCTGGAGGAAGCGGTAGTG   
TGF-β1-509Forward GGAGAGCAATTCTTACAGGTG12094˚C for 3 min; 30x 94˚C for 30 sec, 60˚CDdeI
    for 30 sec and 72˚C for 60 sec; 72˚C for 10 min 
 Reverse TAGGAGAAGGAGGGTCTGTC   
p53 ArgForward TCCCCCTTGCCGTCCCAA39694˚C for 5 min; 30x 94˚C for 30 sec,BstUI
72 Pro   55˚C for 30 sec and 72˚C for 30 sec; 72˚C for 7 min 
 Reverse CGTGCAAGTCACAGACTT   
X geneForward CATGCGTGGAACCTTTGTG84094˚C for 5 min; 35x 94˚C for 50 sec,-
round 1   50˚C for 50 sec and 72˚C for 60 sec; 72˚C for 7 min 
 Reverse CTTGCCTKAGTGCTGTATGG   
X geneForwardTCCTCTGCCGAT CCATACTG68494˚C for 5 min; 35x 94˚C for 30 sec,-
round 2   55˚C for 30 sec and 72˚C for 45 sec; 72˚C for 7 min 
 Reverse CAGAAGCTCCAAATTCTTTATA   

[i] SNP, single nucleotide polymorphism.

Analysis of TNF-α, TGF-β1 and p53 SNPs

SNPs were identified via agarose gel (3.5% for TNF-α SNP, 3% for TGF-β1 SNP and 2% for p53 SNP) electrophoresis analysis based on the following criteria: (i) In the presence of an SNP at position -238 on the TNF-α promoter, a 152-bp band (A allele) is visible, while 133 and 19 bp fragments are identified for the corresponding wild type (G allele). (ii) With an SNP at position -308 on the TNF-α promoter, a 107-bp band (A allele) is visible, while for the corresponding wild type (G allele) 87 and 20 bp fragments are identified (22). (iii) For an SNP at position -509 on the TGF-β1 gene, a 120-bp band (T allele) is visible, while the corresponding wild type (C allele) shows 74 and 46 bp fragments (23). (iv) The Arg72Pro SNP on the p53 gene shows a 396-bp band (C allele), while the corresponding wild type (G allele) displays 231 and 165 bp fragments (24).

Analysis of HBV X gene

Nested PCR on the HBV X gene was performed on the previously extracted viral genome following the work of Lee et al (25), as shown in Table I. It was performed using PCR Master Mix Solution (cat. no. 25027; iNtRON® Biotechnology, Inc.), following the procedure in the manufacturer's instructions. PCR products were visualized on 2% agarose gels. DNA sequencing was performed using an ABI Prism 310 Genetic Analyzer (PerkinElmer, Inc.). The sequenced nucleotides were compared with a reference strain nucleotide sequence that had previously been published in GenBank [accession no., EF473977(26), AB219430(27) and D23678(28)] using Clone Manager 9 (Scientific & Educational Software).

Statistical analysis

Statistical analyses were performed using SPSS 23 (SPSS, Inc.). Data are presented as the mean ± SD. Analysis was repeated at least twice for each subject. χ2, Mann-Whitney U, Kruskal Wallis with Dunn's post hoc test, or one-way ANOVA with LSD post hoc tests were performed to assess significance, depending on variable. Multinomial regression analysis was performed to assess correlations. P<0.05 following a two-tailed analysis was considered to indicate statistical significance.

Results

Patient characteristics

For the 87 CLD patients included in this study, the age range was 16-72 years, with mean ages of 45.0±14.0, 50.7±11.6 and 46.7±8.3 years for patients with CH, LC and HCC, respectively. Male patients (73.6%) outnumbered females (26.4%), as shown in Table II. In this study, CLD patients were most often classed as CH (45/87; 51.7%), followed by LC (27/87; 31.0%) and HCC (15/87; 17.3%). Each CLD stage was dominated with male subjects (66.7, 74.7 and 93.0% for CH, LC and HCC, respectively). AST levels in patients with HCC (211±204.1 U/l) were significantly increased compared with those in patients with LC (91.8±175.5 U/l) and CH (64.7±95.2 U/l).

Table II

Characteristics of patients with chronic liver disease.

Table II

Characteristics of patients with chronic liver disease.

CharacteristicsCH (n=45)LC (n=27)HCC (n=15)Total (n=87)P-value
Sex (male)30 (66.7)20 (74.7)14 (93.0)64 (73.6)0.128
Age (years)45.0±14.050.7±11.646.7±8.347.0±12.50.167
AST (U/l)64.7±95.291.8±175.5211.0±204.198.3±153.5<0.001
ALT (U/l)95.4±107.7125.5±323.9100.0±71.9105.5±218.30.056
Platelet count/µl 196,711.1±120,382.5 162,629.6±82,014.1 238,333.3±106,306.7 193,310.3±10,929.10.098
HBeAg, positive14 (31.1)9 (33.3)2 (13.3)25 (28.7)0.351

[i] Data are presented as n (%) or the mean ± standard deviation. Diagnosis of LC was based on clinical features of portal hypertension, liver stiffness by fibroscan and abnormal liver morphology by ultrasound. Diagnosis of HCC was based on clinical manifestation, α-fetoprotein ≥200 ng/ml and typical ultrasound findings. Statistical analysis was performed using two-way χ2 for categorical variables and Kruskal Wallis followed by Dunn's or one-way ANOVA followed by LSD test for continuous variables. CH, chronic hepatitis; LC, liver cirrhosis; HCC, hepatocellular hepatoma.

Genotype distributions of TNF-α, TGF-β1 and p53 SNPs

The genotype distributions of TNF-α, TGF-β1 and p53 SNPs were determined by PCR-RFLP and are shown in Table III. No cases with the AA genotypes (homozygous minor-mutant type) on the TNF-α promoter (-238/-308) were identified. There was no difference in the distribution of genotypes or SNP alleles of TNF-α, TGF-β1 and p53 in different CLD groups (P>0.05).

Table III

Distribution of host SNPs in patients with CLD.

Table III

Distribution of host SNPs in patients with CLD.

 CLD stage 
SNP genotypeCHLCHCCTotal
TNF-α-238
     GG44 (98.0)24 (88.5)15(100)83 (95.4)
     GA1 (2.0)3 (11.5)04 (4.6)
     AA0000
     Total45(100)27(100)15(100)87(100)
TGF-β1-509
     CC10 (22.2)5 (18.5)3 (20.0)18 (20.7)
     TC23 (51.1)14 (51.9)4 (26.7)41 (47.1)
     TT12 (26.7)8 (29.6)8 (53.3)28 (32.2)
     Total45(100)27(100)15(100)87(100)
Arg72Pro
     CC13 (28.9)6 (22.2)2 (13.3)21 (24.2)
     CG23 (51.1)16 (59.3)10 (66.7)49 (56.3)
     GG9 (20.0)5 (18.5)3 (20.0)17 (19.5)
     Total45(100)27(100)15(100)87(100)

[i] Data are presented as n (%). CLD, chronic liver disease; SNP, single nucleotide polymorphism; CH, chronic hepatitis; LC, liver cirrhosis; HCC, hepatocellular hepatoma.

Analysis of HBV X gene mutations

Based on the multiple alignments, the main type of HBV X gene mutation identified was amino acid substitutions, as shown in Table IV. A total of 23% (20/87) of samples had HBV X gene mutations with ten types of previously reported substitution (29-32). There was one sample that showed both the 32-nucleotide insertion and the 20-nucleotide deletion. These types of mutation caused a shift in the nucleotide reading frame, resulting in the formation of a truncated HBx protein. X gene mutations were found in 17.8% (8/45) of patients with CH, 25.9% (7/27) patients with LC and 33.3% (5/15) patients with HCC. In addition to previously reported mutations, we also found five variants of the X gene located in the HBV functional region, including L37I, S43P, H86P/R, L98I and T105A, which have not been reported in previous studies and may be specific for Indonesian HBV.

Table IV

Hepatitis B virus X gene mutation profiles and its association to chronic liver disease progression.

Table IV

Hepatitis B virus X gene mutation profiles and its association to chronic liver disease progression.

 Samples with mutation (%)  
MutationCH (n=45)LC (n=27)HCC (n=15)Total (n=87)Functional region affectedP-value
T36P03.701.2B-cell epitope0.483
L37I03.701.2B-cell epitope0.483
P38S2.2001.2B-cell epitope1.000
S43P6.7013.35.8B-cell epitope0.147
A44V/T2.23.76.73.4B-cell epitope0.748
P46S2.23.702.3B-cell epitope1.000
H86P/R2.27.403.4Core promoter, EnhII0.576
R87W/G6.77.46.76.9Core promoter, EnhII1.000
H94Y2.2001.2Box α, C/EBP, CCAAT/enhancing binding protein, core promoter, EnhII1.000
L98I2.23.76.73.4Box α, C/EBP, CCAAT/enhancing binding protein, core promoter, EnhII0.748
T105A4.4002.3Core promoter, EnhII, BH3-like motif, T-cell epitope1.000
L123S/V2.206.72.3BH3-like motif, core promoter, NRE0.411
I127L/T/N/S8.97.42010.3BH3-like motif, core promoter, NRE0.461
Insertion (32 nt)2.2001.2Box α, C/EBP, CCAAT/enhancing binding protein, core promoter, EnhII, BH3-like motif, T-cell epitope1.000
Deletion (20 nt)2.2001.2T-cell epitope, BH3-like motif, core promoter1.000
K130M4.425.926.714.9BH3-like motif, core promoter0.006
V131I4.425.926.714.9BH3-like motif, core promoter0.006

[i] Statistical analysis was performed using two-way χ2 or Fisher's exact test. C/EBP, CCAAT/enhancer-binding protein; BH-3, Bcl-2 homology-3; NRE, negative regulatory element.

The dominant mutations in the basal core promoter (BCP) were K130M/V131I, as found in 12.6% (11/87) of CLD patients. These two mutations were observed as double mutation in one sample. There was an association between the K130M/V131I mutations and the progression of CLD (P<0.05), but not for other X gene mutations (P>0.05; Table IV). Multinomial regression analysis confirmed that K130M/V131I mutations were correlated with CLD progression (OR, 7.629; 95% CI, 1.578-36.884; Table V). No association of HBV X gene mutations with TNF-α (-238, -308), TGF-β1 or p53 gene SNPs were found in CLD patients with HBV infection (Fig. 1).

Table V

Multinomial regression analysis of the K130M/V131I mutation in chronic liver disease progression.

Table V

Multinomial regression analysis of the K130M/V131I mutation in chronic liver disease progression.

 Chi-square valueP-valueOR95% CI
K130M/V131I8.710.0117.6291.578-36.884
HBV viral load measurement

The mean viral load was the highest in LC patients (4.98±4.37 log copies/ml), followed by patients with HCC (3.49±2.63 log copies/ml) and patients with LC (2.95±3.59 log copies/ml). Analysis showed no significant differences in viral load depending on CLD stage (P>0.05; Table VI). There were significant differences in viral load levels in HBV-infected patients who had X gene mutations, as well as the R87W/G, I127L/T/N/S and K130M/V131I mutation (P<0.05).

Table VI

Hepatitis B virus viral load in patients with X gene mutations.

Table VI

Hepatitis B virus viral load in patients with X gene mutations.

 Viral load (log copies/ml) 
MutationMedianIQRP-value
S43P  0.137
     Mutation5.741.90 
     No mutation2.506.95 
A44  0.063
     Mutation7.100.00 
     No mutation14.226.68 
R87W/G  0.029
     Mutation6.781.36 
     No mutation2.146.78 
I127L/T/N/S  0.035
     Mutation6.864.00 
     No mutation2.006.65 
K130M/V131I  0.004
     Mutation6.862.53 
     No mutation1.045.90 
X gene mutation  <0.001
     Mutation6.902.94 
     No mutation0.004.86 

[i] Data are presented as the median with IQR. Statistical analysis was performed using Mann-Whitney U tests. IQR, interquartile range.

Discussion

In the present study, 87 patients from Surabaya, Indonesia, with HBV-associated CLD were enrolled. We found no significant differences in the distribution of genotypes or alleles of TNF-α-238 or -308 SNPs among the three CLD stages. Additionally, we found no cases with the AA genotype for these SNPs. This result was in line with reports from Banday et al (33) that showed that the frequency of A alleles in Asia is decreased compared with other regions. A similar study that was performed in China by Xu et al (6) also failed to identify patients with AA genotypes. The SNPs in TNF-α at positions -238 and -308 are often associated with various diseases, including severe inflammation, infection and malignancy (34). Research on SNPs of the TNF-α promoter in patients with HBV infection has shown conflicting results regarding population- and ethnic-specificity (35) and some but not all studies showed a correlation between SNPs of TNF-α promoters and HBV infection (36-38).

In this study, we found no differences in the distribution of genotypes or alleles of TGF-β1 and p53 SNPs between patients in the CLD groups. The frequency of SNPs in patients with CLD was greater than occurrence of the wild type in this study. Previous studies reported different results regarding the TGF-β1-509 and Arg72Pro p53 SNPs among diverse populations. A meta-analysis conducted by Guo et al (39) showed that in an Asian population, the TGF-β1-509 SNP T allele was correlated with the incidence of HCC, but this was not observed in Caucasian and African participants. However, in a study conducted in China by Qi et al (40), the risk of HCC in patients with the TT genotype was decreased compared with the CC genotype. Research conducted in Turkey by Sümbül et al (41) showed a correlation between the Arg72Pro SNP GG genotype and the incidence of HCC that was not observed for the normal population without HBV infection. This was not confirmed by research conducted in China by Cai et al (42) that found no significant differences between the Arg72Pro SNP in patients with HBV infection and healthy controls. In addition to studies focusing on CLD, studies on the association between the Arg72Pro p53 SNP and various cancers types have also shown controversial results (43-45). This is thought to be associated with the ethnic background of the patients (41).

The present study found 12 types of X gene mutation, among which the K130M/V131I mutations were significantly correlated with CLD progression. These two mutations are located in the BCP, which overlaps with the X gene. The presence of these double mutations is thought to exacerbate the host's immune response, increase viral replication and modify the coding region of the X protein causing the progression of CLD (46). H94Y and I127L/T/N/S mutations have been associated to K130M/V131I in previous studies (47,48). The H94Y mutation causes changes in the α box, an element strongly activating the EnhII/core promoter, and increase the binding affinity of the α box and EnhII/core promoter (29,49). The rate of the P38S mutation was reported to be significantly higher in HCC than in asymptomatic carriers, but not significantly different from the rates in CH and LC patients (49). The rate of the T36P mutation was reported to be higher in HCC patients, presumably due to its location at the B epitope, which affects the immune response (50).

No associations of HBV X gene mutations with TNF-α (-238 and -308), TGF-β1 and p53 SNPs were found in CLD patients. In previous studies, several SNPs associated with HBV X gene mutations were identified, particularly SNPs associated with HLA-DQ/DR (rs9272105 and rs9277535) (51,52). Research has also focused on the association between the SNP of the STAT3 gene (rs1053004) and EnhII/BCP/PC mutations that overlap with the X gene (53). However, to date, no studies have linked SNPs to other genes with HBV mutations, including TNF-α (-238 and -308), TGF-β1 and p53 gene SNPs, as it was shown in this study.

In this study, the mean viral load was highest in LC patients, followed by HCC and CH patients. Our results showed no significant differences in viral load between the CLD stages. Several studies have shown an association between HBV viral load and liver damage, and high viral load is often associated with severe liver damage (54,55). Although HBV viral load is often associated with the risk of HCC, a study conducted by Harkisoen et al (56) showed lower viral load in LC patients. Similarly, a study conducted by Tseng et al (57) showed no association between viral load and HCC risk. This may be caused by the presence of HBV DNA, which is integrated into hepatocytes more efficiently compared with serum (58,59). In addition, there are other influential factors for CLD progression to HCC, such as alcoholism, cigarette smoking and HBV genotypes (56,57).

There were significant differences in viral load levels between patients with X gene mutations, including R87W/G, I127L/T/N/S and K130M/V131I mutations. X gene mutations affect HBV viral load, as indicated by observations of a higher HBV replication rate when featuring multiple mutations. This high rate of HBV replication causes increased inflammation and viral invasion (29,49). However, to date, conflicting findings on the association between X gene mutations and HBV viral load have been obtained (60). A study conducted by Ghabeshi et al (61) showed no association between BCP mutations and viral load. This may be due to BCP mutations reducing viral secretion in the blood, but increasing viral load in the liver, which directly causes liver damage. These differences in results are influenced by differences in populations, such as HBV genotypes, HBeAg status and clinical conditions (60).

In this study, the presence of K130M/V131I mutations constituted an independent risk factor for CLD progression. X gene mutations, including R87W/G, I127L/T/N/S and K130M/V131I mutations, were correlated with HBV viral load. Additionally, we found no association between SNPs of the TNF-α, TGF-β1 and p53 genes with X gene mutation. While further studies are required to examine the clinical value of these results, the presence of K130M/V131I mutations may serve as a predictive marker for the progression of CLD in Indonesia and may also be applicable for other countries where chronic HBV infections are prevalent.

Acknowledgments

Not applicable.

Funding

The present study was supported by University of Airlangga and the Indonesian Ministry of Research, Technology and Higher Education (grant no. 122/SP2H/PTNBH/DRPM/2018) and in part by a Grant-in-Aid from Dato' Sri Prof. Dr. Tahir for supporting this research through the Tahir Professorship Program, Indonesia.

Availability of data and materials

All data generated in the present study are included in this article.

Authors' contributions

This study was conducted and designed by MIL, SS and RH. CDKW, PBP, UK, UM and PBS performed sample collection. MA and SENR performed the laboratory experiments. CDKW analyzed the data and wrote the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

This study received approval from the Ethics Committee of Dr. Soetomo General Hospital (Surabaya, Indonesia) (approval no. 0949/KEPK/II/2019). Written informed consent for participation was obtained from each individual.

Patient consent for publication

Not applicable.

Competing interest

The authors declare that they have no competing interests.

References

1 

Xu HZ, Liu YP, Guleng B and Ren JL: Hepatitis B virus-related hepatocellular carcinoma: Pathogenic mechanisms and novel therapeutic interventions. Gastrointest Tumors. 1:135–145. 2014.PubMed/NCBI View Article : Google Scholar

2 

Zampino R, Boemio A, Sagnelli C, Alessio L, Adinolfi LE, Sagnelli E and Coppola N: Hepatitis B virus burden in developing countries. World J Gastroenterol. 21:11941–11953. 2015.PubMed/NCBI View Article : Google Scholar

3 

World Health Organization: Hepatitis B. 2018.

4 

Zeng Z: Human genes involved in hepatitis B virus infection. World J Gastroenterol. 20:7696–7706. 2014.PubMed/NCBI View Article : Google Scholar

5 

Mathew S, Abdel-Hafiz H, Raza A, Fatima K and Qadri I: Host nucleotide polymorphism in hepatitis B virus associated hepatocellular carcinoma. World J Hepatol. 8:485–498. 2016.PubMed/NCBI View Article : Google Scholar

6 

Xu XW, Lu MH and Tan DM: Association between tumour necrosis factor gene polymorphisms and the clinical types of patients with chronic hepatitis B virus infection. Clin Microbiol Infect. 11:52–56. 2005.PubMed/NCBI View Article : Google Scholar

7 

Cheong JY, Cho SW, Hwang IL, Yoon SK, Lee JH, Park CS, Lee JE, Hahm KB and Kim JH: Association between chronic hepatitis B virus infection and interleukin-10, tumor necrosis factor-α gene promoter polymorphisms. J Gastroenterol Hepatol. 21:1163–1169. 2006.PubMed/NCBI View Article : Google Scholar

8 

Hanafy SM and Abdo A: Impact of single nucleotide polymorphism of TGF-β1 gene (SNP-Codon10) on hepatocellular carcinoma risk in Egyptian patients following HCV infection. Aust J Basic Appl Sci. 5:1814–1821. 2011.

9 

Falleti E, Fabris C, Toniutto P, Fontanini E, Cussigh A, Bitetto D, Fornasiere E, Avellini C, Minisini R and Pirisi M: TGF-β1 genotypes in cirrhosis: Relationship with the occurrence of liver cancer. Cytokine. 44:256–261. 2008.PubMed/NCBI View Article : Google Scholar

10 

Schon H and Weiskirchen R: Immunomodulatory effects of transforming growth factor-β in the liver. Hepatobiliary Surg Nutr. 3:386–406. 2014.PubMed/NCBI View Article : Google Scholar

11 

Hussain SP, Schwank J, Staib F, Wang XW and Harris CC: TP53 mutations and hepatocellular carcinoma: Insights into the etiology and pathogenesis of liver cancer. Oncogene. 26:2166–2176. 2007.PubMed/NCBI View Article : Google Scholar

12 

Wang Z, Gou W, Liu M, Sang W, Chu H and Zhang W: Expression of P53 and HSP70 in chronic hepatitis, liver cirrhosis, and early and advanced hepatocellular carcinoma tissues and their diagnostic value in hepatocellular carcinoma: An immunohistochemical study. Med Sci Monit. 21:3209–3215. 2015.PubMed/NCBI View Article : Google Scholar

13 

Gouas DA, Villar S, Ortiz-Cuaran S, Legros P, Ferro G, Kirk GD, Lesi OA, Mendy M, Bah E, Friesen MD, et al: TP53 R249S mutation, genetic variations in HBX and risk of hepatocellular carcinoma in The Gambia. Carcinogenesis. 33:1219–1224. 2012.PubMed/NCBI View Article : Google Scholar

14 

Hu S, Zhao L, Yang J and Hu M: The association between polymorphism of P53 Codon72 Arg/Pro and hepatocellular carcinoma susceptibility: Evidence from a meta-analysis of 15 studies with 3,704 cases. Tumor Biol. 35:3647–3656. 2014.PubMed/NCBI View Article : Google Scholar

15 

Baumert TF, Thimme R and von Weizsäcker F: Pathogenesis of hepatitis B virus infection. World J Gastroenterol. 13:82–90. 2007.PubMed/NCBI View Article : Google Scholar

16 

You CR, Lee SW, Jang JW and Yoon SK: Update on hepatitis B virus infection. World J Gastroenterol. 20:13293–13305. 2014.PubMed/NCBI View Article : Google Scholar

17 

Geng M, Xin X, Bi LQ, Zhou LT and Liu XH: Molecular mechanism of hepatitis B virus X protein function in hepatocarcinogenesis. World J Gastroenterol. 21:10732–10738. 2015.PubMed/NCBI View Article : Google Scholar

18 

Zhang ZH, Wu CC, Chen XW, Li X, Li J and Lu MJ: Genetic variation of hepatitis B virus and its significance for pathogenesis. World J Gastroenterol. 22:126–144. 2016.PubMed/NCBI View Article : Google Scholar

19 

Guerrieri F, Belloni L, Pediconi N and Levrero M: Molecular mechanisms of HBV-associated hepatocarcinogenesis. Semin Liver Dis. 33:147–156. 2013.PubMed/NCBI View Article : Google Scholar

20 

Ayub A, Ashfaq UA and Haque A: HBV induced HCC: Major risk factors from genetic to molecular level. Biomed Res Int. 2013(810461)2013.PubMed/NCBI View Article : Google Scholar

21 

Abe A, Kazuaki I, Take AT, Kato J, Kajiyama N, Kawaguchi R, Tanaka S, Yoshiba M and Kohara M: Quantification of hepatitis B virus genomic DNA by real-time detection. J Clin Microbiol. 37:2899–2903. 1999.PubMed/NCBI

22 

Jamil K, Jayaraman A, Ahmad J, Joshi S and Yerra SK: TNF-alpha -308G/A and -238G/A polymorphisms and its protein network associated with type 2 diabetes mellitus. Saudi J Biol Sci. 24:1195–1203. 2016.PubMed/NCBI View Article : Google Scholar

23 

Chou HT, Chen CH, Tsai CH and Tsai FJ: Association between transforming growth factor-β1 gene C-509T and T869C polymorphisms and rheumatic heart disease. Am Heart J. 148:181–186. 2004.PubMed/NCBI View Article : Google Scholar

24 

Wu X, Zhao H, Amos CI, Shete S, Makan N, Hong WK, Kadlubar FF and Spitz MR: p53 genotypes and haplotypes associated with lung cancer susceptibility and ethnicity. J Natl Cancer Inst. 94:681–690. 2002.PubMed/NCBI View Article : Google Scholar

25 

Lee JH, Han KH, Lee JM, Park JH and Kim HS: Impact of hepatitis B virus (HBV) X gene mutations on hepatocellular carcinoma development in chronic HBV infection. Clin Vaccine Immunol. 18:914–921. 2011.PubMed/NCBI View Article : Google Scholar

26 

Nurainy N, Muljono DH, Sudoyo H and Marzuki S: Genetic study of hepatitis B virus in Indonesia reveals a new subgenotype of genotype B in east Nusa Tenggara. Arch Virol. 153:1057–1065. 2008.PubMed/NCBI View Article : Google Scholar

27 

Nagasaki F, Niitsuma H, Cervantes JG, Chiba M, Hong S, Ojima T, Ueno Y, Bondoc E, Kobayashi K, Ishii M and Shimosegawa T: Analysis of the entire nucleotide sequence of hepatitis B virus genotype B in the Philippines reveals a new subgenotype of genotype B. J Gen Virol. 87:1175–1180. 2006.PubMed/NCBI View Article : Google Scholar

28 

Horikita M, Itoh S, Yamamoto K, Shibayama T and Tsuda F: Differences in the entire nucleotide sequence between hepatitis B virus genomes from carriers positive for antibody to hepatitis B e antigen with and without active disease. J Med Virol. 44:96–103. 1994.PubMed/NCBI View Article : Google Scholar

29 

Kim H, Lee SA and Kim BJ: X region mutations of hepatitis B virus related to clinical severity. World J Gastroenterol. 22:5467–5478. 2016.PubMed/NCBI View Article : Google Scholar

30 

Fan W, Shi B, Wei H, Du G and Song S: Comparison of hepatitis B X gene mutation between patients with hepatocellular carcinoma and patients with chronic hepatitis B. Virus Genes. 42:162–170. 2011.PubMed/NCBI View Article : Google Scholar

31 

Lin X, Xu X, Huang QL, Liu YQ, Zheng DL, Chen WN and Lin JY: Biological impacts of ‘hot-spot’ mutations of hepatitis B virus X proteins are genotype B and C differentiated. World J Gastroenterol. 11:4703–4708. 2005.PubMed/NCBI View Article : Google Scholar

32 

Fatimawali   and Kepel B: Analisis mutasi gen protein X virus HBV pada penderita hepatitis B akut di manado. J LPPM Bid Sains Dan Teknol. 1:47–55. 2014.

33 

Banday MZ, Balkhi HM, Hamid Z, Sameer AS, Chowdri NA and Haq E: Tumor necrosis factor-α (TNF-α)-308G/A promoter polymorphism in colorectal cancer in ethnic Kashmiri population-A case control study in a detailed perspective. Meta Gene. 9:128–136. 2016.PubMed/NCBI View Article : Google Scholar

34 

Li X, Liang C, Parkman V and Lv Z: The association between TNF-α 238A/G and 308A/G polymorphisms and juvenile idiopathic arthritis. Medicine (Baltimore). 97(e12883)2018.PubMed/NCBI View Article : Google Scholar

35 

Heidari Z, Moudi B, Mahmoudzadeh Sagheb H and Moudi M: Association of TNF-α gene polymorphisms with production of protein and susceptibility to chronic hepatitis B infection in the South East Iranian population. Hepat Mon. 16(e41984)2016.PubMed/NCBI View Article : Google Scholar

36 

Jeng JE, Tsai JF, Chuang LY, Ho MS, Lin ZY, Hsieh MY, Chen SC, Chuang WL, Wang LY, Yu ML, et al: Tumor necrosis factor-α 308.2 polymorphism is associated with advanced hepatic fibrosis and higher risk for hepatocellular carcinoma. Neoplasia. 9:987–992. 2007.PubMed/NCBI View Article : Google Scholar

37 

Tavakolpour S and Sali S: Tumor necrosis factor-α-308 G/A polymorphisms and risk of hepatocellular carcinoma: A meta-analysis. Hepat Mon. 16(e33537)2016.PubMed/NCBI View Article : Google Scholar

38 

Xiao Q, Fu B, Chen P, Liu ZZ, Wang W and Ye Q: Three polymorphisms of tumor necrosis factor-alpha and hepatitis B virus related hepatocellular carcinoma: A meta-analysis. Medicine (Baltimore). 95(e5609)2016.PubMed/NCBI View Article : Google Scholar

39 

Guo Y, Zang C, Li Y, Yuan L, Liu Q, Zhang L and Li S: Association between TGF-β1 polymorphisms and hepatocellular carcinoma risk: A meta-analysis. Genet Test Mol Biomarkers. 17:814–820. 2013.PubMed/NCBI View Article : Google Scholar

40 

Qi P, Chen Y, Wang H, Fang M, Ji Q, Zhao YP, Sun XJ, Liu Y and Gao CF: -509C>T polymorphism in the TGF-β1 gene promoter, impact on the hepatocellular carcinoma risk in Chinese patients with chronic hepatitis B virus infection. Cancer Immunol Immunother. 58:1433–1440. 2009.PubMed/NCBI View Article : Google Scholar

41 

Sümbül AT, Akkız H, Bayram S, Bekar A, Akgöllü E and Sandıkçı M: p53 codon 72 polymorphism is associated with susceptibility to hepatocellular carcinoma in the Turkish population: A case-control study. Mol Biol Rep. 39:1639–1647. 2012.PubMed/NCBI View Article : Google Scholar

42 

Cai J, Cai Y, Ma Q, Chang F, Xu L, Zhang G and Guo X: Association of p53 codon 72 polymorphism with susceptibility to hepatocellular carcinoma in a Chinese population from northeast Sichuan. Biomed Rep. 6:217–222. 2017.PubMed/NCBI View Article : Google Scholar

43 

Tian X, Dai S, Sun J, Jiang S and Jiang Y: Association between TP53 Arg72Pro polymorphism and leukemia risk: A meta-analysis of 14 case-control studies. Sci Rep. 6(24097)2016.PubMed/NCBI View Article : Google Scholar

44 

He T, Wu J, Chen Y and Zhang J: TP 53 polymorphisms and melanoma: A meta-analysis. J Cancer Res Ther. 11:409–414. 2015.PubMed/NCBI View Article : Google Scholar

45 

Lin YM, Shao J, Yin XH, Huang C, Jia XW, Yuan YD, Wu CJ, Zhen EM, Yao ZX, Zeng XT and Liu RH: Meta-analysis results on the association between TP53 codon 72 polymorphism with the susceptibility to oral cancer. Front Physiol. 9(1014)2018.PubMed/NCBI View Article : Google Scholar

46 

Chachá SGF, Gomes-Gouvêa MS, Malta FM, Ferreira SDC, Villanova MG, Souza FF, Teixeira AC2 Passos ADDC, Pinho JRR and Martinelli ALC: Basal core promoter and precore mutations among hepatitis B virus circulating in Brazil and its association with severe forms of hepatic diseases. Mem Inst Oswaldo Cruz. 112:626–631. 2017.PubMed/NCBI View Article : Google Scholar

47 

Al-qahtani AA, Al-anazi MR, Nazir N, Ghai R, Abdo AA, Sanai FM, Al-Hamoudi WK, Alswat KA, Al-Ashgar HI, Khan MQ, et al: Hepatitis B virus (HBV) X gene mutations and their association with liver disease progression in HBV-infected patients. Oncotarget. 8:105115–105125. 2017.PubMed/NCBI View Article : Google Scholar

48 

Datta S, Ghosh A, Dasgupta D, Ghosh A, Roychoudhury S, Roy G, Das S, Das K, Gupta S, Basu K, et al: Novel point and combo-mutations in the genome of hepatitis B virus-genotype D: Characterization and impact on liver disease progression to hepatocellular carcinoma. PLoS One. 9(e110012)2014.PubMed/NCBI View Article : Google Scholar

49 

Kim HJ, Park JH, Jee Y, Lee SA, Kim H, Song BC, Yang S, Lee M, Yoon JH, Kim YJ, et al: Hepatitis B virus X mutations occurring naturally associated with clinical severity of liver disease among Korean patients with chronic genotype C infection. J Med Virol. 80:1337–1343. 2008.PubMed/NCBI View Article : Google Scholar

50 

Li W, Goto K, Matsubara Y, Ito S, Muroyama R, Li Q and Kato N: The characteristic changes in hepatitis B virus X region for hepatocellular carcinoma: A comprehensive analysis based on global data. PLoS One. 10(e0125555)2015.PubMed/NCBI View Article : Google Scholar

51 

Wen J, Song C, Jiang D, Jin T, Dai J, Zhu L, An J, Liu Y, Ma S, Qin N, et al: Hepatitis B virus genotype, mutations, human leukocyte antigen polymorphisms and their interactions in hepatocellular carcinoma: A multi-centre case-control study. Nature. 5(16489)2015.PubMed/NCBI View Article : Google Scholar

52 

Zhang Q, Yin J, Zhang Y, Deng Y, Ji X, Du Y, Pu R, Han Y, Zhao J, Han X, et al: HLA-DP polymorphisms affect the outcomes of chronic hepatitis B virus infections, possibly through interacting with viral mutations. J Virol. 87:12176–12186. 2013.PubMed/NCBI View Article : Google Scholar

53 

Xie J, Zhang Y, Zhang Q, Han Y, Yin J, Pu R, Shen Q, Lu W, Du Y, Zhao J, et al: Interaction of signal transducer and activator of transcription 3 polymorphisms with hepatitis B virus mutations in hepatocellular carcinoma. Hepatology. 57:2369–2377. 2013.PubMed/NCBI View Article : Google Scholar

54 

Ledesma MM, Galdame O, Bouzas B, Tadey L, Livellara B, Giuliano S, Viaut M, Paz S, Fainboim H, Gadano A, et al: Characterization of the basal core promoter and precore regions in anti-HBe-positive inactive carriers of hepatitis B virus. Int J Infect Dis. 15:e314–e320. 2011.PubMed/NCBI View Article : Google Scholar

55 

Chu CJ, Hussain M and Lok AS: Quantitative serum HBV DNA levels during different stages of chronic hepatitis B infection. Hepatology. 36:1408–1415. 2002.PubMed/NCBI View Article : Google Scholar

56 

Harkisoen S, Arends JE, van den Hoek JA, Whelan J, van Erpecum KJ, Boland GJ and Hoepelman AI: Historic and current hepatitis B viral DNA and quantitative HBsAg level are not associated with cirrhosis in non-Asian women with chronic hepatitis B. Int J Infect Dis. 29:133–138. 2014.PubMed/NCBI View Article : Google Scholar

57 

Tseng TC, Liu CJ, Yang HC, Su TH, Wang CC, Chen CL, Kuo SF, Liu CH, Chen PJ, Chen DS and Kao JH: High levels of hepatitis B surface antigen increase risk of hepatocellular carcinoma in patients with low HBV load. Gastroenterology. 142:1140–1149.e3. 2012.PubMed/NCBI View Article : Google Scholar

58 

Tu T, Budzinska MA, Shackel NA and Urban S: HBV DNA integration: Molecular mechanisms and clinical implications. Viruses. 9(E75)2017.PubMed/NCBI View Article : Google Scholar

59 

Leung NW, Tam JS, Lau GT, Leung TW, Lau WY and Li AK: Hepatitis B virus DNA in peripheral blood leukocytes a comparison between hepatocellular carcinoma and Other hepatitis B virus-related chronic liver diseases. Cancer. 73:1143–1148. 1994.PubMed/NCBI View Article : Google Scholar

60 

Barbini L, Tadey L, Fernandez S, Bouzas B and Campos R: Molecular characterization of hepatitis B virus X gene in chronic hepatitis B patients. Virol J. 9(131)2012.PubMed/NCBI View Article : Google Scholar

61 

Ghabeshi S, Sharifi Z, Hosseini SM and Mahmoodian Shooshtari M: Correlation between viral load of HBV in chronic hepatitis B patients and precore and basal core promoter mutations. Hepat Mon. 13(e7415)2013.PubMed/NCBI View Article : Google Scholar

Related Articles

Journal Cover

October-2019
Volume 11 Issue 4

Print ISSN: 2049-9434
Online ISSN:2049-9442

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Kencono Wungu C, Amin M, N. Ruslan S, Purwono PB, Kholili U, Maimunah U, Setiawan PB, Lusida MI, Soetjipto S, Handajani R, Handajani R, et al: Association between host TNF‑α, TGF‑β1, p53 polymorphisms, HBV X gene mutation, HBV viral load and the progression of HBV‑associated chronic liver disease in Indonesian patients. Biomed Rep 11: 145-153, 2019
APA
Kencono Wungu, C., Amin, M., N. Ruslan, S., Purwono, P.B., Kholili, U., Maimunah, U. ... Handajani, R. (2019). Association between host TNF‑α, TGF‑β1, p53 polymorphisms, HBV X gene mutation, HBV viral load and the progression of HBV‑associated chronic liver disease in Indonesian patients. Biomedical Reports, 11, 145-153. https://doi.org/10.3892/br.2019.1239
MLA
Kencono Wungu, C., Amin, M., N. Ruslan, S., Purwono, P. B., Kholili, U., Maimunah, U., Setiawan, P. B., Lusida, M. I., Soetjipto, S., Handajani, R."Association between host TNF‑α, TGF‑β1, p53 polymorphisms, HBV X gene mutation, HBV viral load and the progression of HBV‑associated chronic liver disease in Indonesian patients". Biomedical Reports 11.4 (2019): 145-153.
Chicago
Kencono Wungu, C., Amin, M., N. Ruslan, S., Purwono, P. B., Kholili, U., Maimunah, U., Setiawan, P. B., Lusida, M. I., Soetjipto, S., Handajani, R."Association between host TNF‑α, TGF‑β1, p53 polymorphisms, HBV X gene mutation, HBV viral load and the progression of HBV‑associated chronic liver disease in Indonesian patients". Biomedical Reports 11, no. 4 (2019): 145-153. https://doi.org/10.3892/br.2019.1239