Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
January-February 2015 Volume 3 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-February 2015 Volume 3 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effects of ionizing radiation on retinoic acid-inducible gene-I-like receptors

  • Authors:
    • Hironori Yoshino
    • Takahiro Saitoh
    • Masataka Kozakai
    • Ikuo Kashiwakura
  • View Affiliations / Copyright

    Affiliations: Department of Radiological Life Sciences, Division of Medical Life Sciences, Hirosaki University Graduate School of Health Sciences, Hirosaki, Aomori 036‑8564, Japan
  • Pages: 59-62
    |
    Published online on: November 7, 2014
       https://doi.org/10.3892/br.2014.377
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Retinoic acid‑inducible gene‑I (RIG‑I)‑like receptors [RLRs; RIG‑I and melanoma differentiation‑associated gene 5 (MDA5)] sense virus‑derived RNA or a synthetic analog of double‑stranded RNA polyinosinic‑polycytidylic acid [poly(I:C)] and are responsible for host defense against viruses. However, it remains unclear whether radiation affects RLRs. Therefore, the present study investigated the effects of ionizing radiation on RIG‑I and MDA5 expression and the response to poly(I:C) using THP1 (human monocytic cell line)‑derived macrophages. Non‑ and X‑irradiated (1‑10 Gy) macrophages expressed RIG‑I and MDA5 at mRNA and protein levels and there was no significant difference in the expression levels. Non‑ and X‑irradiated macrophages expressed antiviral cytokine interferon (IFN)‑β mRNA following poly(I:C)‑low molecular weight/LyoVec™ and poly(I:C)‑high molecular weight/LyoVec™ stimulation, the agonist of RIG‑I and MDA5, respectively. In line with the results of the expression of RIG‑I and MDA5, no significant difference in the expression of IFN‑β mRNA was observed between non‑ and X‑irradiation. These results indicate that ionizing radiation hardly affects RLR expression and the response to their agonist poly(I:C) in THP1‑derived macrophages.

Introduction

The innate immune system recognizes pathogen-associated molecular patterns through pattern-recognition receptors (PRRs). Thus far, numerous PRRs have been identified, including Toll-like receptors (TLRs), retinoic acid-inducible gene-I (RIG-I)-like receptors (RLRs) and nucleotide-binding oligomerization domain-like receptors (1–4). Among these receptors, RLRs are cytosolic virus sensors and are indispensable for antiviral immunity.

RLRs are DExD/H box-containing RNA helicases and play a key role in sensing RNA virus invasion (5). They consist of RIG-I, melanoma differentiation-associated gene 5 (MDA5) and laboratory of genetics and physiology 2 (LGP2). RIG-I and MDA5 contain N-terminal domains, consisting of the tandem caspase activation and recruitment domains (CARDs), the central DExD/H box RNA helicase domain and the C-terminal regulatory domain, whereas LGP2 lacks CARDs. RIG-I and MDA5 share structural and functional similarities, but they recognize distinct types of RNA viruses (6). RIG-I recognizes relatively short double-stranded RNA (dsRNA) and 5′ triphosphate-single-stranded RNA and are important in sensing influenza virus and hepatitis C virus. By contrast, MDA5 recognizes long dsRNA (7) and they sense picornaviruses. Subsequent to RIG-I and MDA5 sensing RNA virus invasion, they interact with a CARD-containing adaptor protein and interferon (IFN)-β promoter stimulator-1 through their CARDs, which results in the induction of antiviral cytokine type I IFN, such as IFN-β.

Our recent study investigated the effects of ionizing radiation on TLR2 and TLR4 using the human monocytic cell line THP1 and THP1-derived macrophage-like cells and showed that ionizing radiation affects these expression levels and the response to their agonist depending on the cell differentiation state (8). In THP1-derived macrophages, the expression of TLR4 was decreased following X-irradiation and the expression of its agonist lipopolysaccharide (LPS)-inducible IFN-β was attenuated by X-irradiation. These results indicate that the antiviral immune system of TLR4 in X-irradiated macrophages cannot properly respond to viral infections subsequent to LPS-containing gram-negative bacteria infections. Therefore, the antiviral immune system by RLRs is important in this situation. However, the effects of ionizing radiation on RLRs remain unknown. Therefore, the present study investigated the effects of ionizing radiation on the expression of RIG-I and MDA5 in THP1-derived macrophages and the response to their agonist, a dsRNA analogue polyinosinic-polycytidylic acid [poly(I:C)]/LyoVec™.

Materials and methods

Reagents

Phorbol 12-myristate 13-acetate (PMA) was purchased from Sigma-Aldrich (St. Louis, MO, USA). The poly(I:C)-low molecular weight (LMW)/LyoVec™ and poly(I:C)-high molecular weight (HMW)/LyoVec™ were purchased from InvivoGen (San Diego, CA, USA). Rabbit anti-human RIG-I (cat no. 4520), MDA5 (cat no. 5321) monoclonal antibodies and anti-rabbit immunoglobulin G (IgG) horseradish peroxidase (HRP)-linked (cat no. 7074) antibody were purchased from Cell Signaling Technology Japan, K.K. (Tokyo, Japan). Goat anti-human actin polyclonal antibody (sc-1615) and HRP-conjugated donkey anti-goat IgG (sc-2056) were purchased from Santa Cruz Biotechnology, Inc., (Santa Cruz, CA, USA).

Cell culture

THP1 human acute monocytic leukemia cells were obtained from RIKEN BioResource Center (Tsukuba, Japan). Cells were cultured in RPMI-1640 supplemented with 1% penicillin and streptomycin (Gibco, Grand Island, NY, USA) and 10% heat-inactivated fetal bovine serum (Japan Bioserum Co., Ltd., Fukuyama, Japan) at 37°C in a humidified atmosphere containing 5% CO2. THP1-derived macrophages (macrophage-like cells) were prepared as previously described (8). THP1 cells (2.0×105 cells/ml) were plated in 60-mm dishes (Iwaki, Tokyo, Japan) with 4 ml of medium containing 100 ng/ml PMA and cultured for 48 h. After the 48-h culture, the medium containing PMA was replaced with fresh medium not containing PMA and macrophage-like cells were used in experiments.

In vitro X-irradiation

X-irradiation (150 kVp, 20 mA, 0.5 mm Al and 0.3 mm Cu filters) was performed using an X-ray generator (MBR-1520R-3; Hitachi Medical Corporation, Tokyo, Japan) at a distance of 45 cm from the focus and a dose rate of 1.00 Gy/min.

Stimulation with poly(I:C)/LyoVec™

To stimulate RLRs, two types of poly(I:C)/LyoVec™ (InvivoGen), which is a complex of poly(I:C) and the transfection reagent LyoVec™, were used. In brief, macrophage-like cells were exposed to X-rays and 500 ng/ml poly(I:C)-LMW/LyoVec™ or poly(I:C)-HMW/LyoVec™ was added to the culture 24 h after X-irradiation. After an additional 24 h, cells were harvested for reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis.

RT-PCR

Total RNA was extracted using the RNeasy Mini kit (Qiagen, Valencia, CA, USA) and quantified using a NanoDrop (Thermo, Wilmington, DE, USA). cDNA templates were synthesized from 1 µg RNA using the iScript cDNA Synthesis kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA), according to the manufacturer's instructions. PCR was performed using the AccuPrime™ Taq DNA Polymerase system (Invitrogen Life Technologies, Carlsbad, CA, USA). The primer sequences used are shown in Table I. The reaction conditions for RIG-I were 94°C for 1 min followed by 30 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 1 min, and subsequently 72°C for 10 min. The reaction conditions for MDA5 were 94°C for 1 min followed by 30 cycles of 94°C for 1 min, 64°C for 1 min and 72°C for 1 min, and subsequently 72°C for 10 min. The reaction conditions for IFN-β and β-actin were as reported elsewhere (8). The PCR products were confirmed using electrophoresis on ethidium bromide-stained 1.5% agarose gels.

Table I

Primer sequences for reverse transcription-polymerase chain reaction.

Table I

Primer sequences for reverse transcription-polymerase chain reaction.

PrimerSequence (5′→3′)PCR products (bp)
RIG-IF: GCATATTGACTGGACGTGGCA644
R: CAGTCATGGCTGCAGTTCTGTC
MDA5F: GCAAGAGCATCCCCGGAGCC601
R: TCGTGGCCCCTCCAACACCA
IFN−βF: CCTGTGGCAATTGAATGGGAGGC370
R: CCAGGCACAGTGACTGTACTCCTT
β-actinF: GGCACCCAGCACATTGAAGA632
R: GGCACGAAGGCTCATCATTC

[i] RIG-I, retinoic acid-inducible gene-I; MDA5, melanoma differentiation-associated gene 5; IFN-β, interferon-β; bp, basepair.

SDS-PAGE and western blotting

Cells were harvested and suspended in CelLytic™ M Cell Lysis reagent (Sigma-Aldrich) containing 1% Protease Inhibitor cocktail (Sigma-Aldrich) on ice for 30 min. After centrifugation at 20,600 x g for 20 min at 4°C, supernatants were collected. The protein concentration was determined using the Bio-Rad Protein Assay kit and a SmartSpec™ plus spectrophotometer (Bio-Rad Laboratories, Inc.). Each lysate was mixed with 2X sample buffer (Bio-Rad Laboratories, Inc.) containing 5% 2-mercaptoethanol. After boiling for 5 min, proteins were separated using 4–20% Mini-PROTEAN® TGX™ Precast gels (Bio-Rad Laboratories, Inc.) and transferred onto polyvinylidene difluoride membranes of Trans-Blot® Turbo™ Mini PVDF Transfer pack (Bio-Rad Laboratories, Inc.) using the Trans-Blot® Turbo™ Transfer system (Bio-Rad Laboratories, Inc.). The membranes were blocked in TBST buffer [10 mmol/l HCl (pH 7.5), 100 mmol/l NaCl and 0.1% Tween-20] containing 4% ECL Prime Blocking agent (GE Healthcare UK Ltd., Little Chalfont, England). The membranes were probed with each primary antibody in Can Get Signal® Immunoreaction Enhancer solution 1 (Toyobo, Co., Ltd, Osaka, Japan) overnight at 4°C. Following the reaction with the primary antibodies, the membranes were labeled with HRP-conjugated secondary antibodies in Can Get Signal® Immunoreaction Enhancer solution 2 (Toyobo, Co., Ltd) for 1 h. The antigens were visualized by the ECL Prime western blotting detection system (GE Healthcare UK Ltd.).

Results and Discussion

In the present study, the effects of ionizing radiation on RIG-I and MDA5 in THP1-derived macrophage-like cells were investigated.

As shown in Fig. 1, macrophage-like cells expressed RIG-I and MDA5 at the mRNA level. Furthermore, they also expressed these receptors at protein level (Fig. 2). In addition, X-irradiated macrophage-like cells expressed RIG-I and MDA5 at mRNA and protein levels and these expression levels were identical to those of non-irradiated cells (Figs. 1 and 2). These results indicate that ionizing radiation neither affects transcriptional nor post-transcriptional regulation of RIG-I and MDA5 expression. Our recent study reported that ionizing radiation decreased the expression of TLR2 and TLR4 on macrophage-like cells; thus, showing that the effect of ionizing radiation on PRRs depends on the types of PRRs, particularly affecting the expression of TLR2 and TLR4. Certain stimuli, such as IFN-γ and LPS, have been reported to upregulate the expression of RIG-I, as well as TLR2 and TLR4 (9–11). Therefore, it is likely that ionizing radiation does not affect the signaling pathway required for the induction of TLRs expression by IFN-γ or LPS.

Figure 1

Effects of X-irradiation on retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5) mRNA expression in macrophage-like cells. Non- or X-irradiated macrophage-like cells were cultured for 24 h and RNA was extracted from cells. The expression of RIG-I and MDA5 was determined using reverse transcription-polymerase chain reaction analysis. β-actin was used as a loading control. Representative data are shown.

Figure 2

Effects of X-irradiation on retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5) protein expression in macrophage-like cells. Non- or X-irradiated macrophage-like cells were cultured for 24 h and protein was extracted from cells. Western blot analyses of RIG-I and MDA5 were performed. β-actin was used as a loading control. Representative data are shown.

As the recognition of dsRNA, such as poly(I:C) through RIG-I or MDA5 leads to the induction of the antiviral cytokine IFN-β, IFN-β mRNA expression of macrophage-like cells following poly(I:C)-LMW/LyoVec™ or poly(I:C)-HMW/LyoVec™ stimulation was investigated. According to the manufacture's data sheet, the average size of poly(I:C)-LMW and poly(I:C)-HMW is 0.2–1 and 1.5–8 kb, respectively. Poly(I:C)-LMW and poly(I:C)-HMW/LyoVec™ are believed to be recognized by RIG-I and MDA5, respectively, as RIG-I and MDA5 recognize short (<0.3 kb) and long (>4 kb) poly(I:C), respectively (7). Although non-stimulated macrophage-like cells did not express detectable IFN-β mRNA (data not shown), the expression of IFN-β mRNA was observed after treatment with poly(I:C)-LMW or poly(I:C)-HMW/LyoVec™ for 24 h (Fig. 3). The X-irradiated macrophage-like cells also expressed IFN-β mRNA following each poly(I:C)/LyoVec™ stimulation and their expression levels were identical to those of non-irradiated cells (Fig. 3); thus, indicating that X-irradiated macrophage-like cells retain the ability to induce IFN-β following poly(I:C) stimulation. Our recent study showed that the induction of IFN-β mRNA subsequent to LPS stimulation was lower in X-irradiated macrophage-like cells compared to non-irradiated cells (8), indicating that the antiviral immune system of TLR4 in X-irradiated macrophages cannot properly respond to viral infections following the gram-negative bacteria infections. However, this theory could be rejected by the present study as antiviral immune systems of RLRs normally function following exposure to ionizing radiation. By contrast, Besch et al (12) reported that RIG-I/MDA5 agonists induce proapoptotic signaling in human melanoma cells; thus, showing that the stimulation of RIG-I/MDA5 is a potentially useful therapeutic application in cancer treatment. Therefore, the present results also indicate a possibility that RLRs are an effective target for the induction of antitumor immunity during the radiation therapy. To confirm this possibility, further investigations regarding the antitumor effects of cotreatment with poly(I:C)/LyoVec™ and ionizing radiation are required.

Figure 3

Effects of X-irradiation on polyinosinic-polycytidylic acid [poly(I:C)]/LyoVec™-inducible interferon (IFN)-β expression in macrophage-like cells. Non- or X-irradiated macrophage-like cells were cultured for 24 h and poly(I:C)-low molecular weight (LMW) or poly(I:C)-high molecular weight (HMW)/LyoVec was added to culture supernatants. After an additional 24 h of culture, RNA was extracted from cells, and the expression of IFN-β mRNA was determined using reverse transcription-polymerase chain reaction analysis. β-actin was used as a loading control. Representative data are shown.

Acknowledgements

The authors would like to thank Enago (www.enago.jp) for the English language review. The present study was supported by a JSPS KAKENHI Grant-in-Aid for Young Scientists (B; nos. 23791383 and 25861053). The study was also partially supported by a Hirosaki University Grant for Exploratory Research by Young Scientists and a Priority Research Grant for Young Scientists Designated by the President of Hirosaki University.

References

1 

Creagh EM and O'Neill LA: TLRs, NLRs and RLRs: a trinity of pathogen sensors that co-operate in innate immunity. Trends Immunol. 27:352–357. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Yan H, Ohno N and Tsuji NM: The role of C-type lectin receptors in immune homeostasis. Int Immunopharmacol. 16:353–357. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Vabret N and Blander JM: Sensing microbial RNA in the cytosol. Front Immunol. 4:4682013. View Article : Google Scholar : PubMed/NCBI

4 

Liu D, Rhebergen AM and Eisenbarth SC: Licensing adaptive immunity by NOD-like receptors. Front Immunol. 4:4862013.PubMed/NCBI

5 

Matsumiya T and Stafforini DM: Function and regulation of retinoic acid-inducible gene-I. Crit Rev Immunol. 30:489–513. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Kato H, Takeuchi O, Mikamo-Satoh E, Hirai R, Kawai T, Matsushita K, Hiiragi A, Dermody TS, Fujita T and Akira S: Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5. J Exp Med. 205:1601–1610. 2008. View Article : Google Scholar

7 

Kato H, Takeuchi O, Sato S, et al: Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature. 441:101–105. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Yoshino H, Chiba K, Saitoh T and Kashiwakura I: Ionizing radiation affects the expression of Toll-like receptors 2 and 4 in human monocytic cells through c-Jun N-terminal kinase activation. J Radiat Res. 55:876–884. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Faure E, Thomas L, Xu H, Medvedev A, Equils O and Arditi M: Bacterial lipopolysaccharide and IFN-gamma induce Toll-like receptor 2 and Toll-like receptor 4 expression in human endothelial cells: role of NF-kappa B activation. J Immunol. 166:2018–2024. 2001. View Article : Google Scholar : PubMed/NCBI

10 

Imaizumi T, Aratani S, Nakajima T, et al: Retinoic acid-inducible gene-I is induced in endothelial cells by LPS and regulates expression of COX-2. Biochem Biophys Res Commun. 292:274–279. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Imaizumi T, Yagihashi N, Kubota K, Yoshida H, Sakaki H, Yagihashi S, Kimura H and Satoh K: Expression of retinoic acid-inducible gene-I (RIG-I) in macrophages: possible involvement of RIG-I in atherosclerosis. J Atheroscler Thromb. 14:51–55. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Besch R, Poeck H, Hohenauer T, et al: Proapoptotic signaling induced by RIG-I and MDA-5 results in type I interferon-independent apoptosis in human melanoma cells. J Clin Invest. 119:2399–2411. 2009.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yoshino H, Saitoh T, Kozakai M and Kashiwakura I: Effects of ionizing radiation on retinoic acid-inducible gene-I-like receptors. Biomed Rep 3: 59-62, 2015.
APA
Yoshino, H., Saitoh, T., Kozakai, M., & Kashiwakura, I. (2015). Effects of ionizing radiation on retinoic acid-inducible gene-I-like receptors. Biomedical Reports, 3, 59-62. https://doi.org/10.3892/br.2014.377
MLA
Yoshino, H., Saitoh, T., Kozakai, M., Kashiwakura, I."Effects of ionizing radiation on retinoic acid-inducible gene-I-like receptors". Biomedical Reports 3.1 (2015): 59-62.
Chicago
Yoshino, H., Saitoh, T., Kozakai, M., Kashiwakura, I."Effects of ionizing radiation on retinoic acid-inducible gene-I-like receptors". Biomedical Reports 3, no. 1 (2015): 59-62. https://doi.org/10.3892/br.2014.377
Copy and paste a formatted citation
x
Spandidos Publications style
Yoshino H, Saitoh T, Kozakai M and Kashiwakura I: Effects of ionizing radiation on retinoic acid-inducible gene-I-like receptors. Biomed Rep 3: 59-62, 2015.
APA
Yoshino, H., Saitoh, T., Kozakai, M., & Kashiwakura, I. (2015). Effects of ionizing radiation on retinoic acid-inducible gene-I-like receptors. Biomedical Reports, 3, 59-62. https://doi.org/10.3892/br.2014.377
MLA
Yoshino, H., Saitoh, T., Kozakai, M., Kashiwakura, I."Effects of ionizing radiation on retinoic acid-inducible gene-I-like receptors". Biomedical Reports 3.1 (2015): 59-62.
Chicago
Yoshino, H., Saitoh, T., Kozakai, M., Kashiwakura, I."Effects of ionizing radiation on retinoic acid-inducible gene-I-like receptors". Biomedical Reports 3, no. 1 (2015): 59-62. https://doi.org/10.3892/br.2014.377
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team