Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
February-2016 Volume 4 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2016 Volume 4 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Associations of platelet-activating factor acetylhydrolase gene polymorphisms with risk of ischemic stroke

  • Authors:
    • Yongsheng Ma
  • View Affiliations / Copyright

    Affiliations: Department of Geriatrics, Weifang People's Hospital, Weifang, Shandong 261041, P.R. China
  • Pages: 246-250
    |
    Published online on: December 21, 2015
       https://doi.org/10.3892/br.2015.560
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Platelet-activating factor acetylhydrolase (PAF-AH) has an important function in the pathogenesis of ischemic stroke. The aim of the present study was to investigate the correlation between the variation of polymorphisms (R92H and V279F) in PAF‑AH and ischemic stroke. A total of 375 patients with ischemic stroke and 370 healthy controls were recruited into the study. Polymorphisms of V279F and R92H in PAF‑AH were detected by polymerase chain reaction and DNA direct sequencing method. No significant association was observed between V279F and ischemic stroke. However, the RH+HH genotype, RH genotype and H allele of R92H were significantly associated with an increased risk of ischemic stroke (P=0.02, P=0.03 and P=0.02, respectively), In addition, these correlations remained following adjustment for confounding risk factors of stroke. Furthermore, subgroup analysis showed that a significant association with R92H was identified in the large‑artery atherosclerotic stroke subgroup. These findings indicated that variation of R92H in the PAF‑AH gene may contribute to ischemic stroke susceptibility in the population studied.

Introduction

Stroke is the second cause of fatality and the leading cause of disability worldwide. Currently, in developing countries its prevalence is also increasing rapidly. In China, stroke is a major cause of fatality (1). Presently, ischemic stroke is the most common type of stroke in China (2). Numerous independent and major risk factors, such as hypertension, diabetes mellitus, hypercholesterolemia, smoking, alcohol consumption, family history, lack of exercise, diet and lifestyle, are known causes of ischemic stroke (3).

Previous studies have proved that the heritable elements can influence the pathogenesis of ischemic stroke. A significant number of genomic alleles and variants have been discovered to increase the risk of ischemic stroke (4); however, these only explain a minor part of the assumed heritability. Exploring the genetic polymorphisms contributing to the susceptibility of ischemic stroke is important. Recent studies have shown that inflammation is one of the key risk factors and has an important role in the development of ischemic stroke (5). Therefore, genes involved in inflammatory responses are under investigation to identify the variants predisposing to ischemic stroke.

Platelet-activating factor acetylhydrolase (PAF-AH), also known as lipoprotein-associated phospholipase A2 (Lp-PLA2), is a newly identified inflammatory enzyme involved in lipoprotein metabolism and inflammatory pathways (6). PAF-AH may have an important role in the pathophysiology of inflammation. Clinical and epidemiological studies have indicated that elevated PAF-AH concentrations are associated with incident and recurrent stroke events, as this enzyme exhibits proinflammatory and oxidative activities (7). Several other studies have examined the association of PAF-AH gene polymorphisms with coronary artery disease. V279F in exon 9 of the PAF-AH gene is associated with coronary artery disease and carotid atherosclerosis in the Japanese population. R92H in exon 4 is associated with coronary artery disease in the USA (8). According to this information, we hypothesized that the genetic variants in PAF-AH may have a critical role in the susceptibility to ischemic stroke. To confirm this hypothesis, a case-control study was conducted to investigate the association between two PAF-AH polymorphisms (V279F and R92H) with ischemic stroke in an eastern Chinese population.

Materials and methods

Study population

The present study was a hospital-based, case-control study. A total of 375 patients with ischemic stroke and 370 healthy controls were diagnosed at Weifang People's Hospital (Weifang, Shandong, China) were recruited between January 2011 and February 2015. The ischemic stroke diagnoses were carried out according to the World Health Organization guidelines (9) and the reported procedures. According to the TOAST classification, ischemic stroke can be divided into five subtypes: i) Large-artery atherosclerosis (LAA), ii) small-vessel occlusion (SVO), iii) cardioembolism (CE), iv) stroke of other determined etiology, and v) stroke of undetermined etiology (10). Patients with LAA and SVO, two of the most common subtypes of ischemic stroke, were included, while the other subtypes were excluded. All the subjects in the control group were free of clinical or radiological evidence of stroke and other neurological diseases. Those having mental or significant physical diseases, as well as familial or self-psychiatric history, were excluded.

The completion of questionnaires for each subject was performed by trained interviewers, and their clinical assay markers were measured using standard laboratory procedures. The study was approved by the Ethics Committee of the Weifang People's Hospital and written informed consent was obtained from every recruited subject. This study was conducted in accordance with the Declaration of Helsinki.

DNA extraction and genotyping

Genomic DNA extraction was executed using commercial kits designed for extracting blood DNA (Qiagen, Valencia, CA, USA) and following the manufacturer's protocol. TE buffer was used to dissolve the extracted DNA. The resulted DNA solution was stored at −20°C until further use, and was also used as a template for the following polymerase chain reaction (PCR). The sequences of the primers for PCR are shown in Table I. PCR amplification was performed in a total volume of 10 µl that contained 1X GC buffer I (Takara, Otsu, Japan), 3.0 mM Mg2+ (Takara), 0.3 mM deoxyribonucleotide triphosphate (dNTP) (Generay Biotech, Shanghai, China), 1 unit HotStarTaq polymerase (Qiagen, Hilden, Germany), 1 µl each primer (Sangon, Shanghai, China) and 1 µl genomic DNA. The PCR cycling program was set at 95°C for 2 min, followed by 11 cycles of 94°C for 20 sec, 65°C (decreased 0.5°C per cycle) for 40 sec, 72°C for 1.5 min, and subsequently 24 cycles of 94°C for 20 sec, 59°C for 30 sec, and 72°C for 1.5 min, and a final extension at 72°C for 2 min. Multiplex PCR products were checked for quality and yield by running 5 µl in 2% agarose-TBE gels. PCR products (15 µl) were treated with 5 units of shrimp alkaline phosphatase and 2 units of exonuclease I to remove excess dNTPs and primers, respectively. The results of electrophoresis are shown in Figs. 1 and 2.

Figure 1.

Electrophoresis of R92H.

Figure 2.

Electrophoresis of V279F.

Table I.

Primer sequences of V279F and R92H.

Table I.

Primer sequences of V279F and R92H.

SNPsPrimer sequences
R92HForward: 5′ CAATCACCACAGCAGCCTAA3′
Reverse: 5′ TCCCATCCAACTCAGAATGG3′
V279FForward: 5′ TTTATGGGGGCAAAAGAATAGCC3′
Reverse: 5′ AACCATCCCCATGAAATSAACAAT3′

[i] SNP, single nucleotide polymorphism.

Statistical analysis

Continuous variables are presented as mean ± standard deviation and categorical variables as percentages. Continuous variables were compared using student's t-test. Categorical variables were compared by χ2 test. Differences of the distributions of alleles and genotypes between cases and controls were analyzed using χ2 test. All the genotype frequencies were checked for Hardy-Weinberg analysis in two groups with the χ2 test.

The association of the PAF-AH gene polymorphisms with ischemic stroke was evaluated by computing the odds ratios (OR) and 95% confidence intervals (CI) from logistic regression analyses following adjustment for confounding risk factors. P<0.05 was considered to indicate a statistically significant difference for all statistical analyses. All the statistical analyses were carried out with Stata 12.0 software (StataCorp, College Station, TX, USA).

Results

Characteristics

The clinical characteristics of the control subjects and ischemic stroke patients are shown in Table II. There were no significant differences in age, gender or body mass index. The genotype and allele frequencies of the two PAF-AH polymorphisms in patients and control subjects are shown in Tables III and IV. All the genotype distributions in the patients and controls were in the Hardy-Weinberg equilibrium. As shown in Tables III and IV, there was no significant difference in the distributions of genotypes and alleles of V279F between ischemic stroke patients and controls. By contrast, the significant association was observed for R92H in a dominant model. A higher frequency of the HH+RH genotype for R92H was observed in all the participants with ischemic stroke (OR=1.44; 95% CI, 1.06–2.01; P=0.02). The RH genotype (28.8%) of R92H was represented at an increased frequency in the group of patients (OR=1.42; 95% CI, 1.02–1.97; P=0.03). The frequency of R92H H allele was significantly higher in patients with ischemic stroke compared to the control group (OR=1.41; 95% CI, 1.06–1.73; P=0.02).

Table II.

Clinical characteristics of the study subjects.

Table II.

Clinical characteristics of the study subjects.

CharacteristicsCasesControlP-value
Agea, years63.4±4.7360.1±8.090.81
Males, n (%)254 (67.7)243 (65.7)0.74
BMIa, kg/m227.2±2.9126.8±2.030.23
Hypertension, n (%)263 (70.1)218 (58.9)<0.01
Diabetes, n (%)131 (34.9)  69 (18.6)<0.01
Hyperlipidemia, n (%)167 (44.5)129 (34.9)<0.01
Smoking, n (%)131 (34.9)  67 (18.1)<0.01

a Data are mean ± standard deviation. BMI, body mass index.

Table III.

Genotype and allele distributions of R92H in patients with ischemic stroke and the controls.

Table III.

Genotype and allele distributions of R92H in patients with ischemic stroke and the controls.

R92HCases, n (%)Control, n (%)OR (95% CI)P-valueAdjusted OR (95% CI)P-value
Genotype
  RR259 (69.1)287 (77.6)ReferenceReference
  RH104 (27.7)  79 (21.4)1.42 (1.02–1.97)0.031.41 (1.01–2.08)0.04
  HH12 (3.2)  4 (1.1)2.12 (0.62–7.41)0.191.72 (0.48–6.15)0.40
  (HH+RH)/RR116/25983/2871.44 (1.06–2.01)0.021.42 (1.02–2.00)0.04
  HH/(RH+RR)12/3634/3862.11 (0.54–6.39)0.251.55 (0.44–5.59)0.48
Allele
  R622 (82.9)653 (87.8)Reference
  H128 (17.1)  87 (12.2)1.41 (1.06–1.73)0.02

[i] OR, odds ratio; CI, confidence interval.

Table IV.

Genotype and allele distributions of V279F in patients with ischemic stroke and the controls.

Table IV.

Genotype and allele distributions of V279F in patients with ischemic stroke and the controls.

V279FCases, n (%)Control, n (%)OR (95% CI)P-valueAdjusted OR (95% CI)P-value
Genotype
  VV338 (90.1)334 (90.2)ReferenceReference
  VF35 (9.3)33 (8.9)0.93 (0.57–1.46)0.771.02 (0.63–1.62)0.88
  FF  2 (0.5)  3 (0.8)0.23 (0.02–2.12)0.350.21 (0.02–2.01)0.17
  (FF+VF)/VV37/33836/3340.86 (0.54–1.27)0.540.92 (0.61–1.51)0.83
  FF/(VF+VV)2/3733/3670.24 (0.02–2.22)0.360.21 (0.02–2.10)0.18
Allele
  V711 (94.8)701 (94.7)Reference
  F39 (5.2)39 (5.3)0.82 (0.44–1.24)0.35

[i] OR, odds ratio; CI, confidence interval.

Association between polymorphisms and ischemic stroke

The association between the polymorphisms and the disease was assessed using univariate or multivariate logistic regression analyses. Logistic regression analyses revealed that following adjustment for the confounding factors (hypertension, diabetes mellitus, hyperlipidemia and smoking), the presence of the RH+HH genotype and the RH genotype of single nucleotide polymorphism R92H was associated with a higher risk of ischemic stroke (OR=1.42; 95% CI, 1.02–2.00; P=0.04; and OR=1.41; 95% CI, 1.01–2.08; P=0.04, respectively).

The statistical differences between the PAF-AH gene and different subtypes of ischemic stroke were analyzed. The HH+RH genotype and the RH genotype of the R92H gene were significantly associated with large-artery atherosclerotic stroke, even after adjusting for the confounding factors (OR=1.73; 95% CI, 1.18–2.55; P<0.01; and OR=1.67; 95% CI, 1.13–2.48; P=0.01, respectively). However, the same differences were not observed between the remaining small vessel occlusive stroke subgroup and all genetic models (P>0.05), as shown in Table V.

Table V.

Genotype and allele distributions of R92H and its associations with the stroke subtypes.

Table V.

Genotype and allele distributions of R92H and its associations with the stroke subtypes.

R92HCases, n (%)Control, n (%)OR (95% CI)P-valueAdjusted OR (95% CI)P-value
LAA subgroup
  RR133 (64.4)151 (73.7)Reference
  RH70 (32.4)42 (20.5)1.73 (1.19–2.52)<0.011.67 (1.13–2.48)   0.01
  HH6 (3.2)12 (5.9)  3.67 (1.06–12.76)   0.063.02 (0.81–11.27)   0.10
Dominant model
  RR133 (64.4)151 (73.7)Reference
  HH+RH76 (36.4)54 (26.3)1.82 (1.27–2.62)<0.011.73 (1.18–2.55)<0.01
Recessive model
  RR+RH203 (97.1)193 (94.1)Reference
  HH6 (2.9)12 (11.4)0.75 (0.21–1.90)   0.110.63 (0.14–1.72)   0.15
Allele
  R336 (80.4)344 (83.9)Reference
  H82 (19.6)66 (16.1)1.74 (1.26–2.39)   0.23
SVO subgroup
  RR126 (75.9)106 (64.2)Reference
  RH39 (23.5)56 (33.9)1.09 (0.71–1.68)   0.691.11 (0.71–1.73)   0.65
  HH1 (0.6)3 (1.8)0.59 (0.07–5.31)   1.000.33 (0.03–3.36)   0.35
Dominant model
  RR126 (75.9)106 (64.2)Reference
  HH+RH40 (24.1)59 (35.8)1.07 (0.70–1.64)   0.751.07 (0.69–1.66)   0.78
Recessive model
  RR+RH165 (99.4)162 (98.2)Reference
  HH1 (0.6)3 (1.8)0.58 (0.06–5.19)   0.990.32 (0.03–3.23)   0.33
Allele
  R291 (87.7)268 (81.2)Reference
  H41 (12.3)62 (18.7)1.04 (0.70–1.53)   0.85

[i] OR, odds ratio; CI, confidence interval.

Discussion

The present study investigated the association between the PAF-AH genotypes and the risk of ischemic stroke in the eastern Chinese Han population. The major finding of this study is that in the Chinese Han population the frequencies of the minor alleles of the R92H polymorphisms of the PAF-AH gene were significantly higher in ischemic stroke patients. This difference remained following all the factor-related adjustments. However, no association of V279F with the risk of ischemic stroke was identified.

Several previous studies have explored the association between the PAF-AH polymorphism and cardiovascular disease. However, the results of these studies were inconsistent. Li et al (11) reported that the V279F variant was associated with coronary artery disease in the Chinese Han population. However, the association between the V279F variant and cardiovascular disease was not found in the South Korean population (12). With regards to ischemic stroke, Hiramoto et al (13) identified an association with the FF+VF genotype and the F allele. In the present study, this association has not been replicated in the population of eastern China. Two points should be considered with regards to these findings. Genetic heterogeneity may be an important factor. Firstly, genotype frequencies of the V279F in the control subjects (88% VV, 11% VF, and 1% FF) differ from those in the Japanese populations (75% VV, 22% VF, and 3% FF). Secondly, the study by Hiramoto et al (13) was conducted with a relatively small sample size and there was a low frequency of homozygosity of the minor allele. It may be more likely to produce false positive results.

The R92H is a polymorphism, with a non-synonymous change located within the coding region of the Lp-pla2 gene in exon 4, which should result in an arginine-to-histidine substitution at position 92. The association of R92H with cardiovascular disease is also contradictory. Sutton et al (8) reported that the R92H polymorphism was significantly associated with the risk of CHD, with the R92H variant allele observed more frequently in the experiment group compared to the control group. Zheng et al (14) identified the significant association of the R92H variant with premature myocardial infarction in the Chinese population. In the present study, the focus was on the association between R92H in the PAF-AH gene and ischemic stroke. The HH+RH genotype, the RH genotype and the H allele of R92H were significantly associated with the increased risk of ischemic stroke in the Chinese Han population.

The association between R92H in the PAF-AH gene and ischemic stroke in the Chinese population can possibly be explained as follows: i) Several previous studies have investigated the association between the PAF-AH polymorphism and the risk of ischemic stroke. A study of older individuals by Rosso et al (15) found that PAF-AH was associated with ischemic and hemorrhagic strokes. In the Bruneck study (16), PAF-AH activity was identified as a top hit associated with ischemic stroke. ii) A few studies have investigated the association between the R92H polymorphism and plasma PAF-AH activity. A meta-analysis including a total of 14 studies showed that the R92H variant shows the strongest association with PAF-AH activity among the variants in PAF-AH gene (17).

When evaluating the association of R92H with stroke subtypes, a significant association was found for this polymorphism with the LAA subgroup, but not the SVO subgroup. This can be explained by the role of PAF-AH in the process of atherosclerosis. Lyso-PC, the important bioproduct of PAF-AH, is involved in the inflammatory cytokine production and in the induction of the expression of adhesion molecules and cytokines. It has a chemoattractant property for macrophages, and it induces vascular smooth muscle migration (18). Additionally, Lyso-PC can upregulate PAF-AH activity, resulting in a vicious cycle in which pro-inflammatory mediators are upregulated, contributing to plaque progression and destabilization (19). In addition, oxNEFAs, another detrimental substrate of PAF-AH, can promote atherosclerosis by increasing oxidative stress and the presence of oxidized LDL and other lipoproteins in the plasma and arterial walls, thereby initiating fatty streak formation (20).

There are several limitations in the present study that require discussion, such as the relatively small sample size and the lack of PAF-AH activity measurements. Therefore, further studies including functional evaluations are warranted to elucidate the potential mechanism of these polymorphisms in ischemic stroke.

In conclusion, the present study demonstrated that the PAF-AH gene polymorphism R92H may modify the risk of ischemic stroke in the eastern Chinese Han population. Further studies involving functional evaluations are warranted to clarify the potential mechanism of these polymorphisms in ischemic stroke.

References

1 

Liu L, Wang D, Wong KS and Wang Y: Stroke and stroke care in China, Huge burden, significant workload and a national priority. Stroke. 42:3651–3654. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Thrift AG, Dewey HM, Macdonell RA, McNeil JJ and Donnan GA: Incidence of the major stroke subtypes, Initial findings from the North East Melbourne stroke incidence study (NEMESIS). Stroke. 32:1732–1738. 2001. View Article : Google Scholar : PubMed/NCBI

3 

Flossmann E, Schulz UG and Rothwell PM: Systematic review of methods and results of studies of the genetic epidemiology of ischemic stroke. Stroke. 35:212–227. 2004. View Article : Google Scholar : PubMed/NCBI

4 

Schunkert H, König IR, Kathiresan S, Reilly MP, Assimes TL, Holm H, Preuss M, Stewart AF, Barbalic M, Gieger C, et al: Large-scaleassociation analyses identifies 13 new susceptibility loci for coronary artery disease. Nat Genet. 43:333–338. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Libby P: Inflammation in atherosclerosis. Nature. 420:868–874. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Dada N, Kim NW and Wolfert RL: Lp-PLA2: An emerging biomarker of coronary heart disease. Expert Rev Mol Diagn. 2:17–22. 2002. View Article : Google Scholar : PubMed/NCBI

7 

Shi Y, Zhang P, Zhang L, Osman H, Mohler ER III, Macphee C, Zalewski A, Postle A and Wilensky : Role of lipoprotein-associated phospholipase A2 in leukocyte activation and inflammatory responses. Atherosclerosis. 191:54–62. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Sutton BS, Crosslin DR, Shah SH, Nelson SC, Bassil A, Hale AB, Haynes C, Goldschmidt-Clermont PJ, Vance JM, Seo D, et al: Comprehensive genetic analysis of the platelet activating factor acetylhydrolase (PLA2G7) gene and cardiovascular disease in case-control and family datasets. Hum Mol Genet. 17:1318–1328. 2008. View Article : Google Scholar : PubMed/NCBI

9 

Ragoschke-Schumm A, Yilmaz U, Kostopoulos P, et al: 'Stroke room': Diagnosis and treatment as a single location for rapid intraarterial stroke treatment. Cerebrovasc Dis. 40:251–257. View Article : Google Scholar : PubMed/NCBI

10 

Adams HP Jr, Bendixen BH, Kappelle LJ, Biller J, Love BB, Gordon DL and Marsh EE III: Classification of subtype of acute ischemic stroke. Definitions for use in a multicenter clinical trial. TOAST. Trial of Org 10172 in acute stroke treatment. Stroke. 24:35–41. 1993. View Article : Google Scholar : PubMed/NCBI

11 

Li L, Qi L, Lv N, Gao Q, Cheng Y, Wei Y, Ye J, Yan X and Dang A: Association between lipoprotein-associated phospholipase A2 gene polymorphism and coronary artery disease in the Chinese Han population. Ann Hum Genet. 75:605–611. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Jang Y, Kim OY, Koh SJ, Chae JS, Ko YG, Kim JY, Cho H, Jeong TS, Lee WS, Ordovas JM and Lee JH: The Val279Phe variant of the lipoprotein-associated phospholipase A2 gene is associated with catalytic activities and cardiovascular disease in Koreanmen. J Clin Endocrinol Metab. 91:3521–3527. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Hiramoto M, Yoshida H, Imaizumi T, Yoshimizu N and Satoh K: A mutation in plasma platelet-activating factor acetylhydrolase (Val279->Phe) is a genetic risk factor for stroke. Stroke. 28:2417–2420. 1997. View Article : Google Scholar : PubMed/NCBI

14 

Zheng GH, Xiong SQ, Chen HY, Mei LJ and Wang T: Associations of platelet-activating factor acetylhydrolase (PAFAH) gene polymorphisms with circulating PAF-AH levels and risk of coronary heart diseaseor blood stasis syndrome in the Chinese Han population. Mol Biol Rep. 41:7141–7151. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Rosso C, Rosenbaum D, Pires C, Cherfils C, Koujah N, Mestari F, Gillet E, Crozier S, Sahli-Amor M, Samson Y, et al: Lipoprotein-associated phospholipase A2 during the hyperacute stage of ischemic and hemorrhagic strokes. J Stroke Cerebrovasc Dis. 23:277–282. 2014. View Article : Google Scholar

16 

Tsimikas S, Willeit J, Knoflach M, Mayr M, Egger G, Notdurfter M, Witztum JL, Wiedermann CJ, Xu Q and Kiechl S: Lipoprotein-associated phospholipase A2 activity, ferritin levels, metabolic syndrome and 10-year cardiovascular and non-cardiovascular mortality, Results from the Bruneck study. Eur Heart J. 30:107–115. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Wang Q, Hao Y, Mo X, Wang L, Lu X, Huang J, Cao J, Li H and Gu D: PLA2G7 gene polymorphisms and coronary heart disease risk, A meta-analysis. Thromb Res. 126:498–503. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Zalewski A and Macphee C: Role of lipoprotein-associated phospholipase A2 in atherosclerosis: Biology epidemiology and possible therapeutic target. Arterioscler Thromb Vasc Biol. 25:923–931. 2005. View Article : Google Scholar : PubMed/NCBI

19 

Macphee CH, Nelson JJ and Zalewski A: Lipoprotein-associated phospholipase A2 as a target of therapy. Curr Opin Lipidol. 16:442–446. 2005. View Article : Google Scholar : PubMed/NCBI

20 

Vittos O, Toana B, Vittos A and Moldoveanu E: Lipoprotein-associated phospholipase A2 (Lp-PLA2): A review of its role and significance as a cardiovascular biomarker. Biomarkers. 17:289–302. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ma Y: Associations of platelet-activating factor acetylhydrolase gene polymorphisms with risk of ischemic stroke. Biomed Rep 4: 246-250, 2016.
APA
Ma, Y. (2016). Associations of platelet-activating factor acetylhydrolase gene polymorphisms with risk of ischemic stroke. Biomedical Reports, 4, 246-250. https://doi.org/10.3892/br.2015.560
MLA
Ma, Y."Associations of platelet-activating factor acetylhydrolase gene polymorphisms with risk of ischemic stroke". Biomedical Reports 4.2 (2016): 246-250.
Chicago
Ma, Y."Associations of platelet-activating factor acetylhydrolase gene polymorphisms with risk of ischemic stroke". Biomedical Reports 4, no. 2 (2016): 246-250. https://doi.org/10.3892/br.2015.560
Copy and paste a formatted citation
x
Spandidos Publications style
Ma Y: Associations of platelet-activating factor acetylhydrolase gene polymorphisms with risk of ischemic stroke. Biomed Rep 4: 246-250, 2016.
APA
Ma, Y. (2016). Associations of platelet-activating factor acetylhydrolase gene polymorphisms with risk of ischemic stroke. Biomedical Reports, 4, 246-250. https://doi.org/10.3892/br.2015.560
MLA
Ma, Y."Associations of platelet-activating factor acetylhydrolase gene polymorphisms with risk of ischemic stroke". Biomedical Reports 4.2 (2016): 246-250.
Chicago
Ma, Y."Associations of platelet-activating factor acetylhydrolase gene polymorphisms with risk of ischemic stroke". Biomedical Reports 4, no. 2 (2016): 246-250. https://doi.org/10.3892/br.2015.560
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team