Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
November-2016 Volume 5 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2016 Volume 5 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Overexpression of suppressor of IKBKE 1 is associated with vincristine resistance in colon cancer cells

  • Authors:
    • Chun‑Peng Zhao
    • Zhong‑Jie Xu
    • Qing Guo
    • Yun‑Xiao Li
    • Xiang‑Zheng Gao
    • Yi‑You Peng
  • View Affiliations / Copyright

    Affiliations: Department of Biochemistry and Molecular Biology, Xinxiang Medical University, Xinxiang, Henan 453003, P.R. China, Department of Life Science and Technology, Xinxiang Medical University, Xinxiang, Henan 453003, P.R. China, Department of College of Basic Medicine, Xinxiang Medical University, Xinxiang, Henan 453003, P.R. China
  • Pages: 585-588
    |
    Published online on: September 21, 2016
       https://doi.org/10.3892/br.2016.759
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

In a previous study, the suppressor of IKBKE 1 expression level was confirmed to be higher in vincristine (VCR)‑resistant HCT‑8 (HCT‑8/V) colon cancer cells than in non‑VCR‑resistant HCT‑8 cells. In the current study, IKBKE 1 expression in VCR‑resistant colon cancer cells was investigated further. HCT‑8 and HCT‑8/V human colon cancer cells were used, and polymerase chain reaction (PCR) primers were designed to amplify the IKBKE 1 gene. Fluorescence reverse transcription‑quantitative PCR (RT‑qPCR) was performed to detect differences in IKBKE 1 expression between sensitive and drug‑resistant colon cancer cell lines. Western blotting was performed to further observe IKBKE 1 expression. Based on the RT‑qPCR and western blot results, IKBKE 1 expression was observed to be markedly higher in the HCT‑8/V cells, and this difference was significant (P<0.05). Thus, IKBKE 1 expression was identified to be associated with the resistance of colon cancer cells to VCR.

Introduction

As a result of economic development and lifestyle changes, the incidence of colorectal cancer (CRC) is increasing annually, causing serious harm to human life and health. CRC is the third most common malignancy worldwide (1) and chemotherapy is an important component of comprehensive CRC treatment (2). Drug-resistant cells have become an issue for the treatment of malignant tumor cells, such as CRC cells; 90% of cancer patient mortalities are associated with the drug resistance of tumors (2,3). Therefore, understanding the occurrence and developmental mechanism of drug resistance is a key issue in the treatment of malignant tumors. Tumor resistance mechanisms act at the molecular and cell biology levels, and include changes in drug targets, the repair of damaged cells, activation or inhibition of cell death signaling pathways, genetic mutations, deletions, gene amplification, abnormal DNA methylation and other epigenetic changes, and post-transcriptional regulation by microRNAs (4–6).

Vincristine (VCR) is the most commonly administered chemotherapeutic agent to treat CRC in clinical practice. VCR is a cell cycle-specific medication that binds to tubulin; it inhibits the assembly of microtubule structures and arrests mitosis at metaphase (7). Suppressor of IKBKE 1 suppresses inhibitor-κB kinase ε (IKKε), a necrosis factor (NF)-κB modulator, via a non-canonical pathway (8). IKBKE 1 is known to interact with IKKε and TANK binding kinase 1 to inhibit virus-triggered and toll-like receptor 3-triggered activation (9). Hsieh et al (10) demonstrated that miR-146a-5p is a novel chemokine (C-X-C motif) ligand 12 and IKBKE 1 inhibitor. Therefore, regulating miR-146a-5p expression in mesenchymal stem cells may improve the engraftment of transplanted mesenchymal stem cells that are homing to injured tissues (10).

In the previous study, IKBKE 1 demonstrated decreasing expression in HCT-8 VCR-resistant (HCT-8/V) colon cancer cells using next-generation sequencing (11); however, the function and mechanism of IKBKE 1 require further investigation. In the current study, the expression of IKBKE 1 was further verified by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blotting, and investigated their role in modulating VCR resistance. IKBKE 1 may present as a novel candidate target for gene therapy in VCR-resistant ovarian cancer.

Materials and methods

Cell lines and culture

The human colon cancer cell line, HCT-8 was purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and HCT-8/V cells were generated according to our previous study (11). Cells were maintained in Dulbecco's modified Eagle's medium (Sigma-Aldrich, St. Louis, MO, USA) containing 10% fetal calf serum (Zhejiang Tianhang Biotechnology Co., Ltd., Hangzhou, China), 100 µg/ml penicillin and 100 µg/ml streptomycin at 37°C in a CO2 incubator. The cells were subcultured every 2–3 days following treatment with 0.02% EDTA acid and 0.1% trypsin (Hangzhou Genom Biological Pharmaceutical Technology Co., Ltd., Hangzhou, China).

RNA extraction

A total of 50–100 mg sample was grinded with liquid nitrogen, and 1 ml lysate (SinoGene Scientific Co., Ltd., Beijing, China) was added after samples were transferred to 1.5 ml RNase-free centrifuge tubes. The blended mixture was supplemented with 200 µl chloroform and was vigorously shaken for 30 sec. Then, the mixture was centrifuged for 15 min at 12,000 × g and 4°C. The supernatant was separated in a 1.5 ml RNase-free centrifuge tube and an equal volume of isopropanol was added. After centrifugation for 15 min at 12,000 × g and 4°C, the supernatant was removed and the remaining solution was supplemented with 750 µl 75% ethanol, and the mixture was centrifuged for 5 min at 12,000 × g and 4°C. The supernatant was removed and 45 µl diethylpyrocarbonate (DEPC) water was added to dissolve the RNA after drying with ethanol. The extracted RNA was used or stored at −80°C.

RT-qPCR

RT-qPCR was performed using a Custom RT-qPCR Gene Expression Assay kit (SinoGene Scientific Co., Ltd.) according to the manufacturer's instructions. The primers are presented in Table I (GAPDH served as an internal reference) and were synthesized by Shanghai Sangon Biological Engineering Technology Service Co., Ltd. (Shanghai, China). The volume of the reverse transcription (RT) system was 20 µl, including 10 µl total RNA, 1 µl Oligo(dT)18, 1 µl RT enzyme, 1 µl 10 mmol/l deoxynucleotides, 4 µl 5X Reaction Buffer, 0.5 µl ribonuclease inhibitor and DEPC water up to a volume of 20 µl. After centrifugation for 5 min at 12,000 × g and 4°C, the mixture was incubated for 60 min at 37°C and for 10 min at 85°C to inactivate the reverse transcriptase. The qPCR system included 7.5 µl 2X SG Green qPCR Mix, 10 µM primers (0.25 µl), 1 µl cDNA, and DEPC water up to a volume of 20 µl. The PCR reaction conditions were as follows: Predegeneration for 10 min at 95°C, followed by 45 cycles of 95°C (15 sec), 60°C (15 sec), and 72°C (30 sec). The Cq value method (2−ΔΔCq) was used to perform quantitative analysis (12).

Table I.

Primers used in the present study.

Table I.

Primers used in the present study.

PrimerSequence (5′-3′)Product length (bp)
Suppressor of IKBKE 1F: TGTCTTTCAAATCTGCCTCC  85
R: GGCTTGGCAACAACTTTC
GAPDHF: ACCCAGAAGACTGTGGATGG125
R: TTCAGCTCAGGGATGACCTT

[i] F, forward; R, reverse; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Western blot analysis

Cellular proteins were extracted with Cell Lysis Buffer (Cell Signaling Technology, Danvers, MA, USA) containing 1 mM phenylmethylsulfonyl fluoride. Equal quantities of protein (0.05 µg) were fractionated by 7% sodium dodecyl sulphate polyacrylamide gel electrophoresis (100 V for 30 min for concentration gel and 150 V for 80 min for separation gel) (13), transferred to a polyvinylidene difluoride membrane, and reacted with antibodies against IKBKE 1 (1;1,000 dilution; cat. no. B1310; Sigma-Aldrich), and β-actin (1;1,000 dilution cat. no. AC-74; Sigma-Aldrich). The band intensity was quantified using ImageJ software (version 1.47; National Institutes of Health, Bethesda, MD, USA) after normalization to the corresponding loading control.

Statistical analysis

All data were analyzed with SPSS 13.0 (SPSS, Inc., Chicago, IL, USA). Data are expressed as means ± standard deviation. One-way analysis of variance and Student's t-tests were used for statistical analyses, and P<0.05 was considered to indicate a statistically significant difference.

Results

RNA extraction

RNA extraction is an important step in RT-PCR, and the quality of extracted RNA indicates the success of PCR. RNA extracted in the current study exhibited complete bands using electrophoresis (Fig. 1). The concentrations of RNA for HCT-8 and HCT-8/V were 763 and 245 ng/µl, respectively, and the ratios of the optical density at 260 and 280 nm were 1.96 and 2.10, respectively (Table II). These findings demonstrate that the extracted RNA was high quality and could be used to perform RT-qPCR.

Figure 1.

RNA extraction from HCT-8 and HCT-8/V cells. HCT-8/V, vincristine-resistant HCT-8.

Table II.

RNA extraction from HCT-8 and HCT-8/V cells.

Table II.

RNA extraction from HCT-8 and HCT-8/V cells.

SampleRNA concentration (ng/µl) OD260/280
HCT-87631.96
HCT-8/V2452.10

[i] HCT-8/V, vincristine-resistant HCT-8; OD260/280, ratio of the optical density at 260 and 280 nm.

RT-qPCR

Expression of IKBKE 1 in the HCT-8/V colon cancer cells was detected using RT-qPCR using the extracted RNA and specific PCR primers. The amplification curves of IKBKE 1 and GAPDH were observed to be ‘S’ type and the melting curves were characterized by a single curve, indicating effective amplification (Fig. 2A and B). Relative expression of IKBKE 1 in HCT-8 sensitive cells (1.985±0.1050) was significantly higher than that in the HCT-8/V cells (1.000±0.0500) [1.985-fold (P<0.05; Fig. 2C and D)].

Figure 2.

IKBKE 1 expression in HCT-8 and HCT-8/V cells was detected by reverse transcription-quantitative polymerase chain reaction. β-actin served as a loading control. Melting curves for (A) IKBKE 1 and (B) glyceraldehyde-3-phosphate dehydrogenase. (C) Amplification plot IKBKE 1. (D) Analysis of IKBKE 1 expression. *P<0.05 vs. HCT-8. IKBKE 1, suppressor of IKBKE 1; HCT-8/V, vincristine-resistant HCT-8; Rn, fluorescence of the SYBR-Green reporter dye; ΔRn, baseline-corrected Rn; Rn', first derivative of Rn; Tm, melting temperature.

Western blot analysis

The total protein extracted from HCT-8 and HCT-8/V cells was used to estimate relative expression levels after correction using the internal reference (β-actin). The expression level of IKBKE 1 in the HCT-8/V cells was significantly higher than that in the HCT-8 cells (P<0.05; Fig. 3). The mean expression level was 0.6233±0.3654 for HCT cells, and was 2.13-fold higher in the HCT-8/V cells than in the HCT-8 cells.

Figure 3.

IKBKE 1 expression from HCT-8 and HCT-8/V was detected by (A) western blotting and β-actin served as a loading control. (B) Relative IKBKE 1 expression level of HCT-8 and HCT-8/V. IKBKE 1, suppressor of IKBKE 1; HCT-8/V, vincristine-resistant HCT-8.

Discussion

VCR is widely administered to clinically treat certain cancers, including leukemia and lung cancer; however, tumor cells may develop drug resistance (14–17). The resistance mechanism of VCR is complex and involves numerou molecules, such as insulin like growth factor binding protein 7, multidrug resistance protein 1, miRNAs, and long non-coding RNA (11,18–23).

A previous study demonstrated that IKBKE 1 in VCR-resistant colon cancer cell lines was significantly increased by >14-fold compared with in non-resistant cells (17). Consistent with this result, the present study identified that IKBKE 1 expression in the VCR-resistant cells was significantly higher than in the non-resistant cells using RT-qPCR and western blotting. IKBKE 1 is a target of miR-146a, which contributes to the proliferation of stem cells (10).

In conclusion, gene transcription and translation are two processes involved in gene expression, and certain genes are transcribed to mRNA, but are not translated to proteins (24). The results of the current study prove that the expression of IKBKE 1 is increased in VCR-resistant cells in colon cancer at the mRNA and protein levels. Therefore, the expression of IKBKE 1 has been demonstrated to be associated with VCR drug resistance; however, its function and underlying mechanisms require further investigation.

References

1 

Kim JH: Chemotherapy for colorectal cancer in the elderly. World J Gastroenterol. 21:5158–5166. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Davidson M, Okines AF and Starling N: Current and Future Therapies for Advanced Gastric Cancer. Clin Colorectal Cancer. 14:239–250. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Zhang L, Ngo JA, Wetzel MD and Marchetti D: Heparanase mediates a novel mechanism in lapatinib-resistant brain metastatic breast cancer. Neoplasia. 17:101–113. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Jin AH and Wei ZL: Molecular mechanism of increased sensitivity of cisplatin to ovarian cancer by inhibition of microRNA-23a expression. Int J Clin Exp Med. 8:13329–13334. 2015.PubMed/NCBI

5 

Wu Z, Zhang Z, Ge X, Lin Y, Dai C, Chang J, Liu X, Geng R, Wang C, Chen H, et al: Identification of short-form RON as a novel intrinsic resistance mechanism for anti-MET therapy in MET-positive gastric cancer. Oncotarget. 6:40519–40534. 2015.PubMed/NCBI

6 

Ho CM, Huang CJ, Huang SH, Chang SF and Cheng WF: Demethylation of HIN-1 reverses paclitaxel-resistance of ovarian clear cell carcinoma through the AKT-mTOR signaling pathway. BMC Cancer. 15:7892015. View Article : Google Scholar : PubMed/NCBI

7 

Jung SO, Kim SY, Kim JO, Jung SS, Park HS, Moon JY, Kim SM and Lee JE: Promising effects of 3rd line cyclophosphamide, adriamycin and vincristine (CAV) and 4th line ifosfamide and carboplatin chemotherapy in refractory small cell lung cancer. Thorac Cancer. 6:659–663. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Chau TL, Gioia R, Gatot JS, Patrascu F, Carpentier I, Chapelle JP, O'Neill L, Beyaert R, Piette J and Chariot A: Are the IKKs and IKK-related kinases TBK1 and IKK-epsilon similarly activated? Trends Biochem Sci. 33:171–180. 2008. View Article : Google Scholar : PubMed/NCBI

9 

Huang J, Liu T, Xu LG, Chen D, Zhai Z and Shu HB: SIKE is an IKK epsilon/TBK1-associated suppressor of TLR3- and virus-triggered IRF-3 activation pathways. EMBO J. 24:4018–4028. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Hsieh JY, Huang TS, Cheng SM, Lin WS, Tsai TN, Lee OK and Wang HW: miR-146a-5p circuitry uncouples cell proliferation and migration, but not differentiation, in human mesenchymal stem cells. Nucleic Acids Res. 41:9753–9763. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Sun QL, Zhao CP, Wang TY, Hao XB, Wang XY, Zhang X and Li YC: Expression profile analysis of long non-coding RNA associated with vincristine resistance in colon cancer cells by next-generation sequencing. Gene. 572:79–86. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Dong WH, Wang TY, Wang F and Zhang JH: Simple, time-saving dye staining of proteins for sodium dodecyl sulfate-polyacrylamide gel electrophoresis using Coomassie blue. PLoS One. 6:e223942011. View Article : Google Scholar : PubMed/NCBI

14 

Chao MW, Lai MJ, Liou JP, Chang YL, Wang JC, Pan SL and Teng CM: The synergic effect of vincristine and vorinostat in leukemia in vitro and in vivo. J Hematol Oncol. 8:822015. View Article : Google Scholar : PubMed/NCBI

15 

Lewis RS, Fidel J, Dassanayake S, Court MH, Burke NS and Mealey KL: Comparison of chemotherapeutic drug resistance in cells transfected with canine ABCG2 or feline ABCG2. Vet Comp Oncol. Oct 14–2015.(Epub ahead of print). View Article : Google Scholar : PubMed/NCBI

16 

Xu Y and Qiu L: Nonspecifically enhanced therapeutic effects of vincristine on multidrug-resistant cancers when coencapsulated with quinine in liposomes. Int J Nanomedicine. 10:4225–4237. 2015.PubMed/NCBI

17 

Martins A, Sipos P, Dér K, Csábi J, Miklos W, Berger W, Zalatnai A, Amaral L, Molnár J, Szabó-Révész P and Hunyadi A: Ecdysteroids sensitize MDR and non-MDR cancer cell lines to doxorubicin, paclitaxel, and vincristine but tend to protect them from cisplatin. Biomed Res Int. 2015:8953602015. View Article : Google Scholar : PubMed/NCBI

18 

Bartram I, Erben U, Ortiz-Tanchez J, Blunert K, Schlee C, Neumann M, Heesch S and Baldus CD: Inhibition of IGF1-R overcomes IGFBP7-induced chemotherapy resistance in T-ALL. BMC Cancer. 15:6632015. View Article : Google Scholar : PubMed/NCBI

19 

Tivnan A, Zakaria Z, O'Leary C, Kögel D, Pokorny JL, Sarkaria JN and Prehn JH: Inhibition of multidrug resistance protein 1 (MRP1) improves chemotherapy drug response in primary and recurrent glioblastoma multiforme. Front Neurosci. 9:2182015. View Article : Google Scholar : PubMed/NCBI

20 

Tsubaki M, Takeda T, Ogawa N, Sakamoto K, Shimaoka H, Fujita A, Itoh T, Imano M, Ishizaka T, Satou T, et al: Overexpression of survivin via activation of ERK1/2, Akt, and NF-κB plays a central role in vincristine resistance in multiple myeloma cells. Leuk Res. 39:445–452. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Moqadam F Akbari, Lange-Turenhout EA, Ariës IM, Pieters R and den Boer ML: miR-125b, miR-100 and miR-99a co-regulate vincristine resistance in childhood acute lymphoblastic leukemia. Leuk Res. 37:1315–1321. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Wang TY, Zhang QQ, Zhang X, Sun QL, Zhao CP and Wang XY: The effect of recombinant lentiviral vector encoding miR-145 on human esophageal cancer cells. Tumour Biol. 36:9733–9738. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Xu Y, Xia F, Ma L, Shan J, Shen J, Yang Z, Liu J, Cui Y, Bian X, Bie P, et al: MicroRNA-122 sensitizes HCC cancer cells to adriamycin and vincristine through modulating expression of MDR and inducing cell cycle arrest. Cancer Lett. 310:160–169. 2011.PubMed/NCBI

24 

Méndez C, Ahlenstiel CL and Kelleher AD: Post-transcriptional gene silencing, transcriptional gene silencing and human immunodeficiency virus. World J Virol. 4:219–244. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhao CP, Xu ZJ, Guo Q, Li YX, Gao XZ and Peng YY: Overexpression of suppressor of IKBKE 1 is associated with vincristine resistance in colon cancer cells. Biomed Rep 5: 585-588, 2016.
APA
Zhao, C., Xu, Z., Guo, Q., Li, Y., Gao, X., & Peng, Y. (2016). Overexpression of suppressor of IKBKE 1 is associated with vincristine resistance in colon cancer cells. Biomedical Reports, 5, 585-588. https://doi.org/10.3892/br.2016.759
MLA
Zhao, C., Xu, Z., Guo, Q., Li, Y., Gao, X., Peng, Y."Overexpression of suppressor of IKBKE 1 is associated with vincristine resistance in colon cancer cells". Biomedical Reports 5.5 (2016): 585-588.
Chicago
Zhao, C., Xu, Z., Guo, Q., Li, Y., Gao, X., Peng, Y."Overexpression of suppressor of IKBKE 1 is associated with vincristine resistance in colon cancer cells". Biomedical Reports 5, no. 5 (2016): 585-588. https://doi.org/10.3892/br.2016.759
Copy and paste a formatted citation
x
Spandidos Publications style
Zhao CP, Xu ZJ, Guo Q, Li YX, Gao XZ and Peng YY: Overexpression of suppressor of IKBKE 1 is associated with vincristine resistance in colon cancer cells. Biomed Rep 5: 585-588, 2016.
APA
Zhao, C., Xu, Z., Guo, Q., Li, Y., Gao, X., & Peng, Y. (2016). Overexpression of suppressor of IKBKE 1 is associated with vincristine resistance in colon cancer cells. Biomedical Reports, 5, 585-588. https://doi.org/10.3892/br.2016.759
MLA
Zhao, C., Xu, Z., Guo, Q., Li, Y., Gao, X., Peng, Y."Overexpression of suppressor of IKBKE 1 is associated with vincristine resistance in colon cancer cells". Biomedical Reports 5.5 (2016): 585-588.
Chicago
Zhao, C., Xu, Z., Guo, Q., Li, Y., Gao, X., Peng, Y."Overexpression of suppressor of IKBKE 1 is associated with vincristine resistance in colon cancer cells". Biomedical Reports 5, no. 5 (2016): 585-588. https://doi.org/10.3892/br.2016.759
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team