Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
November-2018 Volume 16 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2018 Volume 16 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effects of Ginkgo biloba leaf extract, shenmai and matrine on a human embryonic lung fibroblast fibrosis model

  • Authors:
    • Xingcai Zhang
    • Yuli Cai
  • View Affiliations / Copyright

    Affiliations: Department of Lung Diseases, Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan, Shandong 250011, P.R. China, Department of Orthopedics, Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan, Shandong 250011, P.R. China
  • Pages: 4289-4295
    |
    Published online on: September 5, 2018
       https://doi.org/10.3892/etm.2018.6698
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The aim of the present study was to investigate the effects of Ginkgo biloba leaf extract (GBLE), shenmai (S), and matrine (M) on human embryonic lung fibroblasts (HELFs). HELFs were allocated into the following groups: Group A (control group), group B [transforming growth factor β1 (TGF‑β1) model group], groups C1‑3 (TGF‑β1 + low‑, moderate‑ and high‑dose GBLE), groups D1‑3 (TGF‑β1 + low‑, moderate‑ and high‑dose S) and groups E1‑3 (TGF‑β1 + low‑, moderate‑ and high‑dose oM). Cell proliferation was assessed with an MTT assay and apoptosis was measured by annexin V/propidium iodide double staining and flow cytometry analysis. Collagen type I (COL‑I), collagen type III (COL‑III), α‑smooth muscle actin (α‑SMA) and extracellular superoxide dismutase (ECSOD) mRNA expression levels were measured using semi‑quantitative reverse transcription‑polymerase chain reaction, and protein content was measured using ELISA. The cell growth inhibition rates of the S groups were significantly higher than those of the other treatment groups (P<0.05). The rate of apoptosis was significantly increased in the treatment groups compared with the model group (P<0.05), and S induced a significant increase in HELF apoptosis compared with the other treatment groups (P<0.05). The mRNA and protein expressions of COL‑III, COL‑I and α‑SMA in the GBLE, S and M groups were significantly decreased, while the expression of ECSOD was significantly increased when compared with the model group (P<0.05). In conclusion, GBLE, S and M inhibited the pro‑fibrotic role of TGF‑β1 by targeting different steps in TGF‑β1‑mediated fibrosis.

Introduction

The most prevalent type of idiopathic interstitial pneumonia is idiopathic pulmonary fibrosis (IPF) (1). Chronic progressive fibrosis in IPF is characterized by unexplained progressive dyspnea, decreased exercise tolerance and lung parenchyma interstitial infiltration or restricted pulmonary ventilation function (restrictive lung ventilation disorder) confirmed by histopathology and/or imaging (1). Following diagnosis, the average survival rate of patients ranges between 2.5–3.5 years, which is due to the difficulty of early diagnosis and lack of effective treatment methods (2,3). Over the past several decades, studies into the pathogenesis of IPF have made substantial progress, and an initial hypothesis suggested that chronic inflammation in early IPF may stimulate and damage the lung tissue, regulate fibroplasia and induce extracellular matrix (ECM)deposition, leading to late PF (4). However, mechanistic studies have indicated that chronic inflammation does not sufficiently explain the occurrence and development of IPF (5–8); therefore, a novel hypothesis that IPF is caused by abnormal damage and repair of alveolar epithelial cells (AECs) has been proposed (9). This hypothesis suggests that AECs, fibroblasts and their interaction, and not chronic inflammation, are the key factors in the pathogenesis of IPF. Recent studies have indicated that IPF results from abnormal cellular repair following sustained epithelial cell damage in the lung parenchyma, along with the proliferation and accumulation of fibroblasts/myofibroblasts and excessive ECM deposition (10–12). Injured AECs following repeated complex minor stimulations, including repeated infections and physical and chemical injuries, have been demonstrated to secrete pro-fibrotic factors, including transforming growth factor-β (TGF-β), tumor necrosis factor-α and platelet-derived growth factor (13–15), thereby initiating the proliferation, migration and differentiation of fibroblasts (9). Fibroblasts/myofibroblasts are able to stimulate the formation of fibroblast foci and secrete large quantities of ECM proteins, in addition to matrix metalloproteinases (MMPs) and MMP tissue inhibitors, thus resulting in the deposition of ECM (9). Furthermore, AECs have been demonstrated to induce the formation of a pro-coagulant alveolar environment, leading to increased fibrosis (9). In addition, myofibroblasts may secrete angiotensinogen to induce AEC apoptosis, thus resulting in continuous injury (9). Injured AECs have been reported to activate fibroblasts, resulting in a vicious cycle that critically alters normal alveolar structure (9). A previous study indicated that IPF pathogenesis was a result of the combined effects of inflammatory reaction pathways, epithelial damage pathways and abnormal repair pathways (16).

In the present study, human embryonic lung fibroblasts (HELFs) were cultured in vitro and used to construct a TGF-β1-induced HELF PF model, in order to characterize the effect of Ginkgo biloba leaf extract (GBLE), shenmai (S) and matrine (M) on PF. It has been previously reported that GBLE has a positive effect on the treatment of pulmonary interstitial fibrosis and tis mechanism of action may be via inhibiting the activity of nuclear factor-κB and decreasing TGF-β, which ameliorates inflammation and fibrosis (17). Shenmai may inhibit collagen synthesis and TGF-β and regulate the biological redox equilibrium (18). While matrine exerts an anti-PF effect by inhibiting the JAK-STAT signaling transduction pathways (19). This was hoped to elucidate an experimental basis for the treatment of PF with GBLE, S and M.

Materials and methods

HELF culture and grouping

HELFs (cat. no. KG062; Nanjing Keygen BioTech Co., Ltd., Nanjing, China) were cultured in α-Minimum Essential Medium (α-MEM; Nanjing Keygen BioTech Co., Ltd.) supplemented with 5% penicillin, 5% streptomycin and 10% fetal bovine serum (Nanjing Keygen BioTech Co., Ltd.) at 37°C in an atmosphere containing 5% CO2. When the cells had reached ~80% confluence, trypsin (Sigma-Aldrich; Merck KGaA; Darmstadt, Germany) was utilized for passage. Cells generated from passage 3–4 were used for the following experiments.

Following trypsinization, the cells were centrifuged at 37°C at 256 × g for 10 min and resuspended in 4 ml fresh supplemented α-MEM (as described above) and counted using a DVM6 optical microscope (Leica Microsystems GmbH, Wetzlar, Germany). Cells were allocated into the following groups: Group A, control group; group B, TGF-β1 (model) group (1 ng/ml; Nanjing Keygen BioTech Co., Ltd.); group C1, TGF-β1 (1 ng/ml) + GBLE (approval number: X20010117; Dr. Willmar Schwabe GmbH & Co. KG, Karlsruhe, Germany; 5 µl/ml); group C2: TGF-β1 (1 ng/ml) + GBLE (10 µl/ml); group C3: TGF-β1 (1 ng/ml) + GBLE (20 µl/ml); group D1: TGF-β1 (1 ng/ml) + S (approval number: Z51022290; Sichuan Chuanda West China Pharmaceutical Co., Ltd., Chengdu, China; 10 µl/ml); group D2: TGF-β1 (1 ng/ml) + S (20 µl/ml); group D3: TGF-β1 (1 ng/ml) + S (40 µl/ml); group E1: TGF-β1 (1 ng/ml) + M (approval number: H22024149; Changchun Tiancheng Pharmaceutical Co., Ltd., Changchun, China; 10 µl/ml); group E2: TGF-β1 (1 ng/ml) + M (20 µl/ml); and group E3: TGF-β1 (1 ng/ml) + M (40 µl/ml). After treatments were administered, cells were incubated for 24 h at 37°C in a humidified atmosphere containing 5% CO2. The treatment groups were incubated in 12-well plates (6 wells per group) and 96-well plates (5 wells per group).

MTT cell proliferation assay

An MTT assay was performed using 96-well plates with 5 repeat wells per group. Cells (1×105 cells/ml) were cultured in 200 µl α-MEM in the 96-well plates with 10 µl MTT solution (Amresco, Solon, OH, USA) at 37°C in an atmosphere containing 5%CO2 for 4 h. The edges of wells were filled with sterile phosphate-buffered saline (PBS) to prevent evaporation. If the drug reacted with MTT, MTT was added after the culture was centrifuged at 256 × g at room temperature and washed two to three times with PBS. After 4 h, the supernatant was removed from the plates by gently tapping on a pre-prepared absorbent paper one to two times. To dissolve the crystals, 50 µl dimethylsulfoxide (Sigma-Aldrich; Merck KGaA) was added to the cells, and the plates were placed on a low-speed oscillator for 10 min at room temperature. The optical density (OD) of each well was measured at 490 nm and the growth inhibition rate of each group was calculated, as follows: Cell growth inhibition rate = (OD of the control group-OD of treatment group)/OD of the control group ×100% (20).

Detection of cell apoptosis by flow cytometry

The rate of apoptosis was detected by flow cytometry, using 12-well plates with 6 repeat wells per group. Cells were seeded at a density of 1×105 cells/ml in 2 ml/wells with α-MEM and FBS. Following incubation for 24 h at 37°C with the drug treatments, cells in the 12-well plates were removed from the incubator, imaged under a DVM6 optical microscope and 1 ml of the supernatant from each well was stored at −80°C for measurement of protein content by ELISA. The remaining supernatant was discarded and cells were washed twice with PBS. Trypsinized cells were collected, centrifuged at 650 × g for 7 min at 4°C and washed twice with PBS. Cells were subsequently resuspended in 500 µl of 1X binding buffer, filtered through a 80 µm filter and transferred to a tube for antigen labeling. Cells were then incubated with 4 µl fluorescein isothiocyanate-annexin V and 8 µl propidium iodide (PI) for 5 min in the dark at room temperature. A FACSCalibur flow cytometer was used for analysis using Winmidi 2.9 analysis software (both BD Biosciences, San Jose, CA, USA) to detect cells undergoing apoptosis. Normal living cells and early apoptotic cells were defined as those cells resistant to PI staining, whereas necrotic cells were identified by PI-positive staining.

ELISA

The levels of collagen type I (COL-1; cat. no. ab6308), collagen type III (COL-III; cat. no. ab7778), α-smooth muscle actin (α-SMA; ab5694) and extracellular superoxide dismutase (ECSOD; ab13534) in the ECM of HELFs were measured by ELISA (Abcam, Cambridge, UK), according to manufacturer's protocol.

Semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR)

The levels of COL-I, COL-III, α-SMA and ECSOD mRNA expression were assessed by semi-quantitative RT-PCR. The primer sequences used are presented in Table I.

Table I.

Primer sequences used in the present study.

Table I.

Primer sequences used in the present study.

GeneDirectionSequence, 5′-3′Size, bp
β-actinForward GTGGGGCGCCCCAGGCACC500
Reverse CTCCTTAATGTCACGCACGATTT
COL-IIIForward ACGGAAACACTGGTGGACAG386
Reverse GTAGTCTCACAGCCTTGCGT
COL-IForward GCTCGTGGAAATGATGGTGC449
Reverse CCTCGCTTTCCTTCCTCTCC
α-SMAForward GACCTTTGGCTTGGCTTGTC418
Reverse AGCTGCTTCACAGGATTCCC
ECSODForward GTGAAGGTGTGGGGAAGCAT339
Reverse TCCAGCGTTTCCCGTCTTTG

[i] COL-III, collagen type III; COL-I, collagen type I; α-SMA, α-smooth muscle actin; ECSOD, extracellular superoxide dismutase.

At 24 h after treatment, the 12-well plates were removed from the incubator and the cells were washed twice with PBS. Cells were resuspended in 1 ml TRIzol (Tianjin Kailiqi Biopharma Technology Co., Ltd., Tianjin, China) and placed into diethyl pyrocarbonate (DEPC; Fuzhou Maixin Biotech Co., Ltd., Fuzhou, China) water-treated Eppendorf tubes for total RNA extraction on ice. RT-PCR primers were designed using Primer 5.0 software (Premier, Inc., Charlotte, NC, USA). RNA was extracted using TRIzol, and RNA concentration and purity were measured using a UV spectrophotometer at an absorbance (A) ratio of 260/280 nm. cDNA was synthesized from 2.5 µg total RNA according to RT kit instructions (MBI Fermentas; Thermo Fisher Scientific, Inc., Pittsburgh, PA, USA) using oligo dTs (Bio Basic, Inc., Markham, ON, Canada). PCR was performed with 5 µl cDNA, 2.5 µl 10 X PCR buffer, 2 µl 25 mM MgCl2, 0.25 µl primers (25 pmol each), 0.5 µl 10 mM dNTPs, 0.5 µl Taq DNA polymerase (MBI Fermentas; Thermo Fisher Scientific, Inc.) and 14 µl DEPC water. The PCR reaction underwent the following conditions: 95°C for 5 min, 94°C for 1 min, 58–60°C for 1 min and 72°C for 1 min for 26 cycles, followed by an extension step at 70°C for 10 min. PCR products were electrophoresed and analyzed on a 1.5% gel stained with ethidium bromide and an Alpha Innotech Digital Imaging System (Bosch Institute, Sydney Medical School, University of Sydney, NSW, Australia) was used with Essential version 6 software (UVItec Ltd., Cambridge, UK) to determine the relative levels of target gene expression by calculating the gray value ratio between the target gene bands and β-actin control bands.

Statistical analysis

SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA) was used for analysis of the data. The data were expressed as the mean ± standard deviation. One-way analysis of variance and paired t-tests were used for intergroup comparisons, and the Fisher's least significant difference test was used for pairwise comparisons among multiple groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Comparison of cell proliferation

Compared with the control group, the OD value in the model group significantly increased (P<0.05). Compared with the model group, the OD value in each treatment group were significantly decreased (P<0.05). The OD values and cell growth inhibitory rates exhibited significant differences among Group C1, C2, and C3 (P<0.05), as well as among Group D1, D2, and D3 (P<0.05), and among Group E1, E2, and E3 (P<0.05). The OD value in Group D3 was significantly lower (P<0.05) and the cell growth inhibition rate was significantly higher, compared with other treatment groups with the same concentrations (P<0.05). The results are reported in Table II.

Table II.

Results of human embryonic lung fibroblast MTT assay.

Table II.

Results of human embryonic lung fibroblast MTT assay.

GroupOD value of cell proliferationGrowth inhibition rate (%)
Control0.177±0.0071–
Model 0.214±0.0045a6.5±1.45
C1 0.166±0.0076b 0.0651±0.014c,d
C2 0.153±0.0056b,c 0.1342±0.0078c,e
C3 0.146±0.0043b,d,e 0.1762±0.0085d,e
D1 0.146±0.0060b 0.1783±0.0090c,d
D2 0.132±0.0076b,c 0.2551±0.0191c,e
D3 0.117±0.0046b,d–f0.3384±0. 0125d–f
E1 0.153±0.0061b 0.1351±0.0083c,d
E2 0.143±0.0050b,c 0.1973±0.0107c,e
E3 0.128±0.0060b,d,e 0.2782±0.0094d,e

{ label (or @symbol) needed for fn[@id='tfn2-etm-0-0-6698'] } Data are presented as the mean ± standard deviation.

a P<0.05 vs. control group

b P<0.05 vs. model group

c P<0.05 different concentration of the same drug treatment

d P<0.05 for group 3 vs. group 1 of each drug treatment.

e P<0.05 for group 3 vs. group 2 of each drug treatment

f P<0.05 vs. the C3 group. C1-3, transforming growth factor β1 + low-, moderate- and high-dose Ginkgo leaf extract, respectively; D1-3, transforming growth factor β1 + low-, moderate- and high-dose shenmai, respectively; E1-3, transforming growth factor β1 + low-, moderate- and high-dose matrine, respectively; OD, optical density.

Comparison of apoptosis

Compared with the control group, the apoptosis rate in the model group was significantly decreased (P<0.05; Fig. 1). Compared with the model group, the apoptosis rate in each treatment group was significantly increased (P<0.05). The apoptosis rate had significant difference among the C1, C2 and C3 groups (P<0.05), among the D1, D2 and D3 groups (P<0.05), and among the E1, E2 and E3 groups (P<0.05). The apoptosis rate in the D3 group was significantly higher than in the other treatment groups at the same dose (P<0.05). The results are presented in Table III and Fig. 1.

Figure 1.

Flow cytometry scatter plots of cell apoptotic rate in each group. (A) Control group; (B) model group; (C1) low-, (C2) moderate- and (C3) high-dose Ginkgo leaf extract groups; (D1) low-, (D2) moderate- and (D3) high-dose shenmai groups; and (E1) low-, (E2) moderate- and (E3) high-dose matrine groups. B1, necrotic cells; B2, necrotic cells + late apoptotic cells; B3, living cells, B4, early apoptotic cells.

Table III.

Results of human embryonic lung fibroblast apoptosis assay.

Table III.

Results of human embryonic lung fibroblast apoptosis assay.

GroupApoptotic rate, %
Control0.0731±0.0060
Model 0.0262±0.0036a
C1 0.0451±0.0049b–d
C2 0.0673±0.0045b,c,e
C3 0.0831±0.0046b,d,e
D1 0.0812±0.0021b–d
D2 0.1071±0.0030b,c,e
D3 0.1252±0.0051b,d–f
E1 0.0651±0.0038b–d
E2 0.0833±0.0040b,c,e
E3 0.1034±0.0050b,d,e

{ label (or @symbol) needed for fn[@id='tfn9-etm-0-0-6698'] } Data are presented as the mean ± standard deviation.

a P<0.05 vs. control group

b P<0.05 vs. model group

c P<0.05 for group 2 vs. group 1 of each drug treatment

d P<0.05 for group 3 vs. group 1 of each drug treatment.

e P<0.05 for group 3 vs. group 2 of each drug treatment

f P<0.05 vs. the C3 group. C1-3, transforming growth factor β1 + low-, moderate- and high-dose Ginkgo leaf extract, respectively; D1-3, transforming growth factor β1 + low-, moderate- and high-dose shenmai, respectively; E1-3, transforming growth factor β1 + low-, moderate- and high-dose matrine, respectively.

Comparison of extracellular matrix protein expression levels

Compared with the control group, the protein and mRNA expression levels of COL-III, COL-I and α-SMA in the model group were significantly increased (P<0.05; Fig. 2 and Table IV). Compared with the model group, the above indexes in each treatment group were significantly decreased (P<0.05). There was a significant difference in each index among the C1, C2 and C3 groups (P<0.05), among the D1, D2 and D3 groups (P<0.05), and among the E1, E2 and E3 groups (P<0.05). The protein and mRNA expression levels of COL-III, COL-I and α-SMA in the E3 group were significantly lower than in the other treatment groups (P<0.05). The results are presented in Compared with the control group, the expressions of COL-III, COL-I, α-SMA protein and mRNA in the model group increased significantly (P<0.05). Compared with the model group, the expressions of COL-III, COL-I, α-SMA protein and mRNA, exhibiting significant differences among Group C1, C2, and C3 (P<0.05), as well as among Group D1, D2, and D3 (P<0.05), and among Group E1, E2, and E3 (P<0.05). The expressions of COL-III, COL-I, α-SMA protein and mRNA in Group Matrine Injection was significantly lower (P<0.05). The results are shown in Tables IV, V and Fig. 2.

Figure 2.

mRNA expression of β-actin (control) and the extracellular matrix components COL-III, COL-I, α-SMA and ECSOD. Lanes 1–5 represent the control, model, C3, D3 and E3 groups, respectively. COL-I collagen type I; COL-III, collagen type III; α-SMA, α-smooth muscle actin; ECSOD, extracellular superoxide dismutase.

Table IV.

Extracellular matrix protein content.

Table IV.

Extracellular matrix protein content.

GroupCOL-IIICOL-Iα-SMA
Control8.44±0.2817.43±0.33180.93±2.24
Model 55.28±0.17a 25.85±0.47a 252.20±4.87a
C1 51.74±0.37b–d 24.51±0.37b–d 246.49±0.79b–d
C2 48.37±0.41b,c,e 22.55±0.22b,c,e 234.07±4.75b,c,e
C3 43.30±0.42b,d,e 19.71±0.31b,d,e 225.20±2.76b,d,e
D1 49.15±1.60b–d 23.48±0.33b–d 234.94±3.92b–d
D2 45.43±0.24b,c,e 21.59±0.27b,c,e 217.39±5.41b,c,e
D3 40.14±0.83b,d,e 18.99±0.30b,d,e 207.90±3.13b,d,e
E1 44.26±0.27b–d 22.89±0.25b–d 219.34±3.85b–d
E2 40.46±0.22b,c,e 20.50±0.25b,c,e 205.78±2.47b,c,e
E3 37.76±0.20b,d–f 17.89±0.20b,d–f 193.41±1.76b,d–f

{ label (or @symbol) needed for fn[@id='tfn16-etm-0-0-6698'] } Data are represented as the mean ± standard deviation.

a P<0.05 vs. control group

b P<0.05 vs. model group

c P<0.05 for group 2 vs. group 1 of each drug treatment

d P<0.05 for group 3 vs. group 1 of each drug treatment.

e P<0.05 for group 3 vs. group 2 of each drug treatment

f P<0.05 vs. the C3 group. C1-3, transforming growth factor β1 + low-, moderate- and high-dose Ginkgo leaf extract, respectively; D1-3, transforming growth factor β1 + low-, moderate- and high-dose shenmai, respectively; E1-3, transforming growth factor β1 + low-, moderate- and high-dose matrine, respectively; COL-III, collagen type III; COL-I, collagen type I; α-SMA, α-smooth muscle actin.

Table V.

COL-III, COL-I, α-SMA and ECSOD mRNA (n=6).

Table V.

COL-III, COL-I, α-SMA and ECSOD mRNA (n=6).

Group COL-III/β-actinCOL-I/β-actinα-SMA/β-actinECSOD/β-actin
Control0.1988±0.00780.1929±0.01090.2002±0.00070.8987±0.0027
Model 0.9822±0.0224a 0.9762±0.0193a 0.9912±0.0014a 0.0977±0.0012a
C3 0.6152±0.0113b 0.6098±0.0125b 0.6023±0.0445b 0.7024±0.0106b
D3 0.4351±0.0223b 0.4289±0.0089b 0.4278±0.0169b 0.3532±0.0072b,c
E3 0.2221±0.0121b,c 0.2091±0.0435b,c 0.2332±0.0651b,c 0.1977±0.0124b,c

{ label (or @symbol) needed for fn[@id='tfn23-etm-0-0-6698'] } Data are presented as the mean ± standard deviation.

a P<0.05 vs. the control group

b P<0.05 vs. the model group

c P<0.05 vs. the C3 group. C3, transforming growth factor β1 + high-dose Ginkgo leaf extract; D3, transforming growth factor β1 + high-dose shenmai; E3, transforming growth factor β1 + high-dose matrine.

Impact of antioxidant factors on ECSOD

Compared with the control group, the expression of ECSOD mRNA in the model group was significantly decreased (P<0.05; Table V). Compared with the model group, the expression of ECSOD mRNA in each treatment group was significantly increased (P<0.05). There was a significant difference in each index among the C1, C2 and C3 groups (P<0.05), among the D1, D2 and D3 groups (P<0.05) and among the E1, E2 and E3 groups (P<0.05). The expression of ECSOD mRNA in the C3 group was significantly lower than in the other treatment groups at the same dose (P<0.05). The results are presented in Tables V, VI and Fig. 3).

Figure 3.

mRNA expression of COL-III, COL-I, α-SMA and ECSOD. 1, control; 2, Model; 3, C3-transforming growth factor β1 + high-dose Ginkgo leaf extract; 4, D3-transforming growth factor β1 + high-dose shenmai; 5, E3-transforming growth factor β1 + high-dose matrine. COL-I collagen type I; COL-III, collagen type III; α-SMA, α-smooth muscle actin; ECSOD, extracellular superoxide dismutase. #P<0.05 vs. the control group; *P<0.05 vs. the model group; %P<0.05 vs. the C3 group; &P<0.05 vs. the D3 group; $P<0.05 vs. the E3 group.

Table VI.

ECSOD protein content.

Table VI.

ECSOD protein content.

GroupECSOD (mU/l)
Control49.67±0.95
Model 34.82±0.43a
C1 39.98±0.26b–d
C2 44.40±0.84b,c,e
C3 48.46±0.65b,d,e
D1 38.53±0.44b–d
D2 42.74±0.77b,c,e
D3 46.24±0.43b,d–f
E1 37.30±0.37b–d
E2 40.81±0.36b,d,e
E3 43.89±0.67b,d,e

{ label (or @symbol) needed for fn[@id='tfn27-etm-0-0-6698'] } Data are represented as mean ± standard deviation.

a P<0.05 vs. control group

b P<0.05 vs. model group

c P<0.05 for group 2 vs. group 1 of each drug treatment

d P<0.05 for group 3 vs. group 1 of each drug treatment.

e P<0.05 for group 3 vs. group 2 of each drug treatment

f P<0.05 vs. the C3 group. C1-3, transforming growth factor β1 + low-, moderate- and high-dose Ginkgo leaf extract, respectively; D1-3, transforming growth factor β1 + low-, moderate- and high-dose shenmai, respectively; E1-3, transforming growth factor β1 + low-, moderate- and high-dose matrine, respectively; ECSOD, extracellular superoxide dismutase.

Discussion

Under homeostatic conditions, fibroblasts in the lung tissues assume a resting state; however, during fibrosis, various internal and external factors stimulate and activate fibroblasts to transition from a resting state to a hyperproliferative state, leading to the formation of a lung fibroblastic focus (10). Inducing fibroblast apoptosis may alleviate PF, thereby promoting recovery (21). In the lung tissue, increased expression of ECM proteins, particularly of collagens, is an important indicator of the degree of fibrosis (22,23), as demonstrated by previous studies that identified large quantities of collagen deposition within fibrotic alveoli, in which COL-I and COL-III were the primary constituents (24,25). The detection of ECM protein expression at the mRNA and protein level may be of significant value in the assessment of anti-fibrotic drug efficacy. Activated fibroblasts transform into myofibroblasts following functional and phenotypic changes, leading to the expression of α-SMA (26). Myofibroblasts are the primary cell responsible for the abnormal synthesis and deposition of ECM proteins, and α-SMA may be used as a marker of myofibroblasts (27). A previous study demonstrated that the degree of PF in patients was positively correlated with the level of oxidative stress in vivo (28). ECSOD as the primary antioxidant within lung tissue, exhibits the highest enzyme activity in the lungs (29). ECSOD removes superoxide from cells and inhibits the reaction between nitric oxide and superoxide, which protects lung tissue and collagen from free radical-induced injury during the inflammatory process (30). Therefore, ECSOD exerts critical protective effects against oxidative stress-induced PF (30).

Previous studies have suggested that the predominant active ingredients in GBLE are flavonoids (31–33). These flavonoids have the ability to dilate blood vessels, improve microcirculation, resist oxidation, scavenge oxygen free radicals and prevent or reverse the fibrosis of multiple organs, thus alleviating PF and reducing the degree of alveolitis and fibrosis (33,34). Ginseng saponin and Ophiopogonin D are the primary active ingredients in S, which may inhibit the activation of myofibroblasts by scavenging free radicals and blocking the free-radical-generation enzyme system, thus acting as antioxidants and reducing PF (35–37). Tetracyclic quinodines are active ingredients in M that have been reported to directly scavenge cytotoxic free radicals, aid in the inhibition of fibroblast division and proliferation, promote the expression of TGF-β1 and CT-GF and prevent tissue injury and PF (38,39).

The present data demonstrated that GBLE, S and M inhibited the proliferation and induced the apoptosis of lung fibroblasts, inhibited the synthesis and secretion of COL-I, COL-III and α-SMA, and promoted the synthesis and secretion of ECSOD.S exhibited the greatest activity in suppressing the abnormal proliferation of lung fibroblasts and promoting their apoptosis, while M exhibited the greatest activity in reducing the synthesis of collagens, potentially by inhibiting expression of the collagen gene. In addition, GBLE exhibited the greatest activity in promoting the secretion of the antioxidant factor ECSOD. The above activities were all significantly associated with drug concentration.

The present findings suggest that different traditional Chinese medicines have various anti-fibrotic targets. Thus, drug treatment should be selected based on the particular stage of fibrosis and mechanism of drug action.

Acknowledgements

The present study was supported by the Taishan Scholar Duty Foundation of Lung Diseases in Chinese Medicine (grant no. ts20110819) and the Innovation Projects of Shandong Provincial Postdoctoral Special Foundation (grant no. 201 303 066).

Competing interests

The authors declare that they have no competing interests.

References

1 

Raghu G, Collard HR, Egan JJ, Martinez FJ, Behr J, Brown KK, Colby TV, Cordier JF, Flaherty KR, Lasky JA, et al: An official ATS/ERS/JRS/ALAT statement: Idiopathic pulmonary fibrosis: Evidence-based guidelines for diagnosis and management. Am J Respir Crit Care Med. 183:788–824. 2011. View Article : Google Scholar : PubMed/NCBI

2 

King TE Jr, Albera C, Bradford WZ, Costabel U, Hormel P, Lancaster L, Noble PW, Sahn SA, Szwarcberg J, Thomeer M, et al: Effect of interferon gamma-1b on survival in patients with idiopathic pulmonary fibrosis (INSPIRE): A multicentre, randomized, placebo-controlled trial. Lancet. 374:222–228. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Raghu G, Rochwerg B, Zhang Y, Garcia CA, Azuma A, Behr J, Brozek JL, Collard HR, Cunningham W, Homma S, et al: An official ATS/ERS/JRS/ALAT clinical practice guideline: Treatment of idiopathic pulmonary fibrosis An update of the 2011 clinical practice guideline. Am J Respir Crit Care Med. 192:e3–e19. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Merrill WW and Reynoldss HY: Bronchial lavage in inflammatory lung disease. Clin Chest Med. 4:71–84. 1983.PubMed/NCBI

5 

Katzenstein AL and Myers JL: Idopathic pulmonary fibrosis: Clinical relevance of pathologic classification. Am J Respir Crit Care Med. 157:1301–1315. 1998. View Article : Google Scholar : PubMed/NCBI

6 

Munger JS, Huang X, Kawakatsu H, Griffiths MJ, Dalton SL, Wu J, Pittet JF, Kaminski N, Garat C, Matthay MA, et al: The integrin alpha v beta 6 binds and activates latent TGF beta 1: A mechanism for regulating pulmonary inflammation and fibrosis. Cell. 96:319–328. 1999. View Article : Google Scholar : PubMed/NCBI

7 

Remy-Jardin M, Giraud F, Remy J, Copin MC, Gosselin B and Duhamel A: Importance of groundglass attenuation in chronic diffuse infiltrative lung disease: Pathologic-CT correlation. Radiology. 189:693–698. 1993. View Article : Google Scholar : PubMed/NCBI

8 

Baroke E, Gauldie J and Kolb M: New treatment and markers of prognosis for idiopathic pulmonary fibrosis: Lessons learned from translational research. Expert Rev Respir Med. 7:465–478. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Selman M, King TE and Pardo A: American Thoracic Society; European Respiratory Society and American College of Chest Physicians: Idiopathic pulmonary fibrosis: Prevailing and evolving hypotheses about its pathogenesis and implications for therapy. Ann Intern Med. 134:136–151. 2001. View Article : Google Scholar : PubMed/NCBI

10 

Noble PW, Barkauskas CE and Jiang D: Pulmonary fibrosis: Patterns and perpetrators. J Clin Invest. 122:2756–2762. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Lawson WE, Cheng DS, Degryse AL, Tanjore H, Polosukhin VV, Xu XC, Newcomb DC, Jones BR, Roldan J, Lane KB, et al: Endoplasmic reticulum stress enhances fibrotic remodeling in the lungs. Pro Natl Acad Sci USA. 108:10562–10567. 2011. View Article : Google Scholar

12 

Lawson WE, Crossno PF, Polosukhin VV, Roldan J, Cheng DS, Lane KB, Blackwell TR, Xu C, Markin C, Ware LB, et al: Endoplasmic reticulum stress in alveolar epithelial cells is prominent in IPF: Association with altered surfactant protein processing and herpesvirus infection. Am J Physiol Lung Cell Mol Physiol. 294:L1119–L1126. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Chen CY, Peng WH, Wu LC, Wu CC and Hsu SL: Luteolin ameliorates experimental lung fibrosis both in vivo and in vitro: Implications for therapy of lung fibrosis. J Agric Food Chem. 58:11653–11661. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Broekelmann TJ, Limper AH, Colby TV and McDonald JA: Transforming growth factor beta-1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis. Proc Natl Acad Sci USA. 88:6642–6646. 1991. View Article : Google Scholar : PubMed/NCBI

15 

Ho YY, Lagares D, Tager AM and Kapoor M: Fibrosis-a lethal component of systemic sclerosis. Nat Rev Rheumatol. 10:390–402. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Park S and Lee EJ: Recent advances in idiopathic pulmonary fibrosis. Tuber Respir Dis (Seoul). 74:1–6. 2013. View Article : Google Scholar

17 

Chen J, He B and Liu X: Experimental study on effect of folium Ginkgo biloba in treating pulmonary interstitial fibrosis in rats. Zhongguo Zhong Xi Yi Jie He Za Zhi. 20:441–443. 2000.(In Chinese). PubMed/NCBI

18 

Xiao-Jiao LI, Guo G, Cheng ZX, Hui-Yun LI, Zhang HS and Zhong QC: Effect of Shenmai Kaifei San on the level of IL-6, TNF-α and TGF-β1 in patients with systemic sclerosis complicated by pulmonary fibrosis. Rheumatism and Arthritis. 5:10–12. 2016.(In Chinese).

19 

Ma X, Chen R, Liu X, Xie J, Si K and Duan L: Effects of matrine on JAK-STAT signaling transduction pathways in bleomycin-induced pulmonary fibrosis. Afr J Tradit Complement Altern Med. 10:442–448. 2013.PubMed/NCBI

20 

He WW, Zhang DP and Xie N: Effect of curcumin on proliferation, apoptosis and the extracellular matrix of human embryonic lung fibroblast. Pharm Clin Res. 21:322–325. 2013.

21 

Thannickal VJ and Horowitz JC: Evolving concepts of apoptosis in idiopathic pulmonary fibrosis. Proc Am Thorc Soc. 3:350–356. 2006. View Article : Google Scholar

22 

Nkyimbeng T, Ruppert C, Shiomi T, Dahal B, Lang G, Seeger W, Okada Y, D'Armiento J and Günther A: Pivotal role of matrix metalloproteinase 13 in extracellular matrix turnover in idiopathic pulmonary fibrosis. PLoS One. 8:e732792013. View Article : Google Scholar : PubMed/NCBI

23 

Tsukui T, Ueha S, Abe J, Hashimoto S, Shichino S, Shimaoka T, Shand FH, Arakawa Y, Oshima K, Hattori M, et al: Qualitative rather than quantitative changes are hallmarks of fibroblasts in bleomycin-induced pulmonary fibrosis. Am J Pathol. 183:758–773. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Kliment CR and Oury TD: Oxidative stress, extracellular matrix targets, and idiopathic pulmonary fibrosis. Free Radic Biol Med. 49:707–717. 2010. View Article : Google Scholar : PubMed/NCBI

25 

Meltzer EB and Noble PW: Idiopathic pulmonary fibrosis. Orphanet J Rare Dis. 3:82008. View Article : Google Scholar : PubMed/NCBI

26 

Hinz B, Phan SH, Thannickal VJ, Galli A, Bochaton-Piallat ML and Gabbiani G: The myofibroblast: One function, multiple origins. Am J Pathol. 170:1807–1816. 2007. View Article : Google Scholar : PubMed/NCBI

27 

Zheng L, Zhou Z, Lin L, Alber S, Watkins S, Kaminski N, Choi AM and Morse D: Carbon monoxide modulates alpha-smooth muscle actin and small proline rich-1a expression in fibrosis. Am J Respir Cell Mol Biol. 41:85–92. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Daniil ZD, Papageorgiou E, Koutsokera A, Kostikas K, Kiropoulos T, Papaioannou AI and Gourgoulianis KI: Serum levels of oxidative stress as a marker of disease severity in idiopathic pulmonary fibrosis. Pulm Pharmacol Ther. 21:26–31. 2008. View Article : Google Scholar : PubMed/NCBI

29 

Bowler RP and Crapo JD: Oxidative stress in airways: Is there a role for extracellular superoxide dismutase. Am J Respir Crit Care Med. 166:S38–S43. 2002. View Article : Google Scholar : PubMed/NCBI

30 

Serra V, von Zglinicki T, Lorenz M and Saretzki G: Extracellular superoxide dismutase is a major antioxidant in human fibroblasts and slows telomere shortening. J BiolChem. 278:6824–6830. 2003.

31 

Chen X and Chen WZ: Recent phremacological progress of Ginkgobiloba extract for cardiovascular and neuronal disease. Chin J Integ Trad West Med. 2:3001996.(In Chinese).

32 

Isah T: Rethinking Ginkgo biloba L: Medicinal uses and conservation. Pharmacogn Rev. 9:140–148. 2015. View Article : Google Scholar : PubMed/NCBI

33 

Wang CG, Dai Y, Li DL and Ma KY: Ginkgo biloba leaf extract action in scavenging free radicals and reducing mutagenicity and toxicity of cigarette smoke in vivo. J Environ Sci Health A Tox Hazard Subst Environ Eng. 45:498–505. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Akiba S, Chiba M, Mukaida Y, Tamura A and Sato T: The leaf extract of Ginkgo Biloba L. suppresses oxidized LDL-stimulated fibronectin production through an antioxidant action in rat mesangial cells. Br J Pharmacol. 142:419–424. 2004. View Article : Google Scholar : PubMed/NCBI

35 

Su X, Ma Y, Huang R, Wang X and Wang Y: Effects of shenmai injection on blood SOD activity and MDA level in senile patients with coronary heart disease. J Tradit Chin Med. 25:50–53. 2005.PubMed/NCBI

36 

Zhao LM, Ma LJ, Zhang LX and Wu JZ: Shenmai injection inhibiting the extracellular signal regulated kinase-lnduced human airway smooth muscle proliferation in asthma. Chin J Integr Med. 16:331–336. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Yu YH, Cui NQ, Fu Q and Li J: Change of TH1/TH2 cytokine equilibrium in rats with severe sepsis and therapeutic effect of recombinant interleukin-12 and shenmai injection. Chin J Integr Med. 11:136–141. 2005. View Article : Google Scholar : PubMed/NCBI

38 

Li Y, Wang B, Zhou C and Bi Y: Matrine induces apoptosis in angiotensin II-stimulated hyperplasia of cardiac fibroblasts: Effects on Bcl-2/Bax expression and caspase-3 activation. Basic Clin Pharmacol Toxicol. 101:1–8. 2007. View Article : Google Scholar : PubMed/NCBI

39 

Jung E, Lee J, Huh S, Lee J, Hwang H, Kim Y, Kim YW, Byun SY and Park D: Matrine inhibits PMA-induced MMP-1 expression in human dermal fibroblasts. Biofactors. 33:121–128. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang X and Cai Y: Effects of Ginkgo biloba leaf extract, shenmai and matrine on a human embryonic lung fibroblast fibrosis model. Exp Ther Med 16: 4289-4295, 2018.
APA
Zhang, X., & Cai, Y. (2018). Effects of Ginkgo biloba leaf extract, shenmai and matrine on a human embryonic lung fibroblast fibrosis model. Experimental and Therapeutic Medicine, 16, 4289-4295. https://doi.org/10.3892/etm.2018.6698
MLA
Zhang, X., Cai, Y."Effects of Ginkgo biloba leaf extract, shenmai and matrine on a human embryonic lung fibroblast fibrosis model". Experimental and Therapeutic Medicine 16.5 (2018): 4289-4295.
Chicago
Zhang, X., Cai, Y."Effects of Ginkgo biloba leaf extract, shenmai and matrine on a human embryonic lung fibroblast fibrosis model". Experimental and Therapeutic Medicine 16, no. 5 (2018): 4289-4295. https://doi.org/10.3892/etm.2018.6698
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang X and Cai Y: Effects of Ginkgo biloba leaf extract, shenmai and matrine on a human embryonic lung fibroblast fibrosis model. Exp Ther Med 16: 4289-4295, 2018.
APA
Zhang, X., & Cai, Y. (2018). Effects of Ginkgo biloba leaf extract, shenmai and matrine on a human embryonic lung fibroblast fibrosis model. Experimental and Therapeutic Medicine, 16, 4289-4295. https://doi.org/10.3892/etm.2018.6698
MLA
Zhang, X., Cai, Y."Effects of Ginkgo biloba leaf extract, shenmai and matrine on a human embryonic lung fibroblast fibrosis model". Experimental and Therapeutic Medicine 16.5 (2018): 4289-4295.
Chicago
Zhang, X., Cai, Y."Effects of Ginkgo biloba leaf extract, shenmai and matrine on a human embryonic lung fibroblast fibrosis model". Experimental and Therapeutic Medicine 16, no. 5 (2018): 4289-4295. https://doi.org/10.3892/etm.2018.6698
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team