Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
April 2013 Volume 42 Issue 4

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April 2013 Volume 42 Issue 4

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

The CD133+ subpopulation of the SW982 human synovial sarcoma cell line exhibits cancer stem-like characteristics

  • Authors:
    • Aiguo Liu
    • Baohua Feng
    • Wenguang Gu
    • Xiangyang Cheng
    • Tiejun Tong
    • Hongzhi Zhang
    • Yongzhen Hu
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedic Surgery, First Affiliated Hospital, Harbin Medical University, Harbin 150001, P.R. China, Department of Neurosurgery, First Affiliated Hospital, Harbin Medical University, Harbin 150001, P.R. China
  • Pages: 1399-1407
    |
    Published online on: February 15, 2013
       https://doi.org/10.3892/ijo.2013.1826
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Several soft tissues sarcomas have been reported to contain cancer stem-like cells (CSCs) or tumor-initiating cells, based on their ability to initiate and sustain tumor growth. However, these cells have not yet been identified in the human synovial sarcoma cell line SW982. CD133, a surface glycoprotein specific to stem and progenitor cells, has been described as a CSC marker in different tumor types. In the present study, we identified a CSC subpopulation in SW982 cells using the CD133 cell surface marker. CD133-positive (CD133+) cells were identified in SW982 cells (8.59%); these cells showed an increased ability to form spherical colonies and could self-renew in serum-starved culture conditions, compared to CD133-negative (CD133-) cells. Real-time PCR analysis of stemness genes revealed that the CD133+ subpopulation expresses higher levels of Bmi1, c-Myc, Nanog, Oct3/4 and Sox2. CD133+ cells showed increased resistance to cisplatin (CDDP) and doxorubicin (DXR), possibly due to upregulation of the ABCG2 drug transporter gene. In vivo studies revealed that the CD133+ subpopulation is highly tumorigenic. These findings indicate that CD133+ SW982 cells have characteristics similar to CSCs. This discovery may lead to the development of novel therapies that specifically target CD133+ synovial sarcoma CSCs.

Introduction

Synovial sarcoma (SS) is a high-grade malignant tumor that accounts for almost 10% of all adult soft tissue sarcomas (1). It can occur at any age and anatomical site, but is most commonly found in the para-articular regions in adolescents and young adults (2). SS is characterized by the presence of a chromosomal translocation t(X;18) (p11.2;q11.2) between chromosomes X and 18 that leads to the formation of a fusion protein (3).

Currently, SS is classified as a miscellaneous tumor of uncertain histological origin (4), which is thought to arise from undifferentiated mesenchymal cells. A recent report indicates that neural crest cells, which can differentiate into both ectoderm and mesoderm, are potential progenitors of SS (5). However, the cellular origin of SS has not been definitively resolved.

Clinically, SS appears as deep-seated slowly growing mass, with more than half of patients developing metastases, mainly to the lungs and sometimes to the lymph nodes and bone marrow (6). The 5- and 10-year survival rates are as low as 36 and 20%, respectively (7). Thus, SS remains a cancer associated with high morbidity and therefore, improved therapies are necessary.

The cancer stem-like cell (CSC) hypothesis holds that tumor cells are hierarchically organized according to their potential to initiate and sustain tumor growth. Only a small population of tumor cells, defined as CSCs or tumor-initiating cells, can form tumors in serial xenotransplantation assays, are resistant to chemotherapy and have the ability to re-establish the hierarchical cell organization and heterogeneity of the parental tumor at each passage in vivo(8,9). These cells were first described in acute myeloid leukemia (10) and subsequently in breast cancer (11), prostate cancer (12), glioblastoma (13), melanoma (14) and other types of cancer (15–18). Thus, the identification of the CSCs has significantly improved our understanding of tumor biology and may lead to more effective tumor therapies.

Recent technical advances have enabled the identification of CSCs by specific surface markers that are selectively expressed on these cells, but not on the majority of tumor cells. Of these, CD133 is a pentaspan membrane glycoprotein that was first described as a surface antigen specific to human hematopoietic stem and progenitor cells (19), but has also recently been recognized as a stem cell marker in brain (20), prostate (21), pancreatic (22), lung (23) and ovarian cancers (24). CD133 expression has also been identified in various sarcomas, including osteosarcoma (25) and Ewing’s sarcoma (16). CD133+ Ewing’s sarcoma cells express significantly higher levels of the stemness genes Nanog and Oct3/4 than their CD133− counterparts. Recently, the presence of CD133+ cell populations was reported in SS (26). However, until now it was unknown whether CD133+ cells with CSC properties could be isolated from the human SS cell line SW982.

Therefore, in the present study we used CD133 as a marker to identify CSCs within the SW982 cell population. We then examined the self-renewal, differentiation capacity and tumorigenicity of the SW982 CD133+ cell population using a spheroid formation assay and xenograft model in nude BALB/c mice. We also compared chemoresistance and examined expression of the specific drug transporter, ABCG2 and stemness genes in different subpopulations of SW982 cells. Our results allowed us to define the phenotype of SW982 CSCs, which may contribute to the development of more effective therapies for SS.

Materials and methods

Cell culture

The human SS cell line SW982 was obtained from the American Type Culture Collection (USA) and maintained in Leibovitz-15 medium (Gibco BRL, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS, Hyclone, UT, USA) at 37°C in a humidified atmosphere containing 5% CO2. The culture medium was changed every 3–4 days and cells were trypsinized and replated when 85% confluency was reached.

Magnetic- and fluorescence-activated cell sorting

CD133+ and CD133− populations were isolated from SW982 cell cultures by magnetic bead sorting using a magnetic-activated cell sorting (MACS) CD133 cell isolation kit. Briefly, SW982 cells were resuspended in MACS buffer [phosphate-buffered saline (PBS) without Ca2+ and Mg2+, supplemented with 0.5% BSA and 2 mM EDTA] at a concentration of 3.3×108 cells/ml. Single-cell suspensions (300 μl, containing 1×108 cells) were incubated with 100 μl FcR blocking reagent and 100 μl CD133 microbeads for 30 min at 4°C. After washing, cell populations were separated by passing through LS columns, which retain CD133+ cells, according to the manufacturer’s instructions. Before and after separation, cell samples were analyzed by fluorescence-activated cell sorting (FACS) using anti-CD133/2 phycoerythrin (293C3) and isotype control mouse IgG2b phycoerythrin antibodies using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA). All reagents were purchased from Miltenyi Biotec.

Spheroid formation assay

Spheroid formation assays were performed as described by Fujii et al(27) and Gibbs et al(28) with some modifications, using single-cell SW982 suspensions (dissociated using 0.25% trypsin/0.05% EDTA at ∼70% confluency) and both CD133+ and CD133− cell populations isolated by MACS. Briefly, cells were resuspended in B27-supplemented Leibovitz-15/1% methylcellulose medium without serum and containing human recombinant epidermal growth factor (EGF; 10 ng/ml) and basic fibroblast growth factor (bFGF; 10 ng/ml; PeproTech, Rocky Hill, NY, USA) and plated at 6×104 cells/well into ultra-low attachment 6-well plates (Corning Inc., Corning, NY, USA). B27 was purchased from Invitrogen. Fresh aliquots of EGF and bFGF were added every second day. After 10–14 days, colonies containing >50 cells were counted using inverted phase contrast microscopy (Olympus CKX41, Shinjuku, Tokyo, Japan). Spheroid formation was investigated through at least five cycles of dissociation and re-culturing in anchorage-independent, serum-starved condition on 96-well ultra-low attachment plates.

Chemosensitivity assays

To assess the effects of cisplatin (CDDP) and doxorubicin (DXR) (Sigma), which are frequently used for sarcoma chemotherapy, on the CD133+ and CD133− cell populations, the cells were dissociated, resuspended in Leibovitz-15/10% FBS at a concentration of 2×104 cells/ml, inoculated into 96-well microtiter plates (Corning Inc.) at 100 μl/well and incubated at 37°C. After 24 h, cells were exposed to 0–10 μM CDDP or DXR for 48 h. The viability of treated and control cells was measured by the MTS assay using the CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega, Madison, WI, USA), according to the manufacturer’s instructions.

For a more detailed characterization of the stemness properties of the CD133+ cell population, we compared drug resistance in CD133+ spheroids and adherent cells. CD133+ adherent cells were grown in medium containing serum, as previously described. CD133+ spheroids (5×104 cells/ml) were resuspended in B27-supplemented Leibovitz-15/1% methyl-cellulose medium, plated into 96-well ultra-low attachment microplates at 100 μl/well and incubated at 37°C for 14 days to induce spheroid formation. CD133+ spheroids and adherent cells were then treated with 0–10 μM CDDP or DXR and cell viability was measured by the MTS assay after 48 h. Triplicate wells were used for each treatment group.

Western blotting

Western blotting was performed as described previously, with some modifications (28). Briefly, cells were washed twice with cold PBS and lysed in buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.1% SDS, 1% Na deoxycholate, 1 mM Na vanadate and protease inhibitors (5 mg/ml pepstatin, 1 mM PMSF, 10 mg/ml leupeptin and 1 mM NaF; Sigma) for 1 h on ice. Lysates were clarified by centrifugation at 13,000 g for 10 min at 4°C and protein concentrations were measured using the BCA Protein Assay kit (Pierce, Rockford, IL, USA). Samples (30 μg total protein) were separated using 10% SDS polyacrylamide gels and transferred onto polyvinylidene difluoride membranes (Sigma). After blocking with 5% skimmed milk for 1 h at room temperature, membranes were incubated overnight at 4°C with primary antibody diluted in Tris-buffered saline (TBS) containing 0.1% Tween-20 (Bio-Rad Laboratories, Hercules, CA, USA) and 5% bovine albumin (Sigma). After washing three times in TBS with 0.1% Tween-20, blots were incubated with the appropriate horseradish peroxidaseconjugated secondary antibody (Cell Signaling Technology, Beverly, MA, USA; Jackson ImmunoResearch Laboratories, West Grove, PA, USA). Immunoreactive bands were visualized using ECL Plus SuperSignal West Pico (Thermo Scientific, Rockford, IL, USA). Protein levels were normalized to GAPDH. Primary antibodies used are as follows: anti-ABCG2 (1:1000), anti-Bmi1 (1:1000), anti-c-Myc (1:1000), anti-Nanog (1:1000), anti-Oct3/4 (1:1000) and anti-Sox2 (1:1000) were purchased from Cell Signaling Technology. GAPDH (1:5000) was purchased from Santa Cruz Biotechnology.

Real-time PCR

Total RNA was extracted from the CD133+ and CD133− cell populations using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcribed into cDNA using M-MLV reverse transcriptase (Sigma). Real-time PCR was performed according to the manufacturer’s instructions using an ABI PRISM 7900HT sequence detection system (Applied Biosystems); mRNA expression was normalized to GAPDH. The primer sequences are listed in Table I.

Table I

The primer sequences of the tested genes.

Table I

The primer sequences of the tested genes.

GeneForward (5′-3)Reverse (5′-3′)
ABCG2 GATAAAGTGGCAGACTCCAAGGT CCAATAAGGTGAGGCTATCAAACA
Bmi1 CTCCACCTCTTCTTGTTTGC GATGACCCATTTACTGATGATTT
c-Myc GCATACATCCTGTCCGTCCA CAAGAGTTCCGTAGCTGTTCAAG
Nanog AGGCAAACAACCCACTTCT TCACACCATTGCTATTCTTCG
Oct 3/4 TATTCAGCCAAACGACCATCT TCAGCTTCCTCCACCCACTT
Sox2 ATCACCCACAGCAAATGACA CAAAGCTCCTACCGTACCACTA
GAPDH GGGAAACTGTGGCGTGAT GAGTGGGTGTCGCTGTTGA
Xenograft experiments

To evaluate the tumorigenic potential of the CD133+ and CD133− cell populations, 1×103–1×106 cells were subcutaneously injected into the right side of the back of 6–8-week-old female BALB/c nude mice, obtained from the Animal Research Center, Harbin Medical University, China. All surgical procedures and animal treatments were performed in accordance with institute guidelines. Mice were monitored daily for tumor growth. Twelve weeks after injection, all mice were euthanized, tumors were aseptically excised and samples were processed for histopathological and immunohistochemical analysis. In addition, tumor samples were digested using collagenase II (Sigma) and the CD133+ cells were isolated and immediately re-injected into mice to generate second-round tumors. Data were obtained from at least three independent experiments.

Histopathological and immunohistochemical analysis of xenografts

Excised xenograft tumors derived from CD133+ and CD133− cells were fixed in 10% formalin and embedded in paraffin. Sections were cut and stained with hematoxylin and eosin (HE) using a standard protocol to assess tumor type. Immunohistochemistry was performed using an anti-CD133 antibody (Abcam, Cambridge, UK), according to standard immunohistochemical procedures. All microscopy images were captured.

Statistical analysis

Statistical software SPSS19.0 was used in data processing and analyzing. Data are expressed as mean ± SD, comparison between experimental groups of real-time PCR analysis were tested by one-way ANOVA. The results of the chemosensitivity assay was calculated with the survival rates and compared by using the χ2 test. A p<0.05 was regarded as statistically significant.

Results

Isolation of SW982 CD133+ and CD133− cell populations

We assessed CD133 expression in human SS SW982 cells using FACS analysis and found that CD133+ cells comprised 8.59% of the total population (Fig. 1A). We then isolated enriched CD133+ and CD133− cell populations using MACS. Using this technique, the CD133+ cell population could be enriched by ∼13-fold over CD133− cells (74.62 vs. 5.82%; Fig. 1B and C).

Figure 1

CD133 expression and separation in SW982 cell lines. (A) FACS analysis of CD133 expression in SW982 cell lines. (B and C) FACS analysis of CD133+ or CD133− cell population after MACS sorting. Black bars and percentage indicate the ratio of CD133+ cell population. Black broken lines indicate isotype matched control. Representative data of three independent experiments are shown.

SW982 CD133+ cells form spheroids in suspension culture

Suspension culture in serum-free medium was initially developed as a method to select neural stem cells through neurosphere formation, but has been widely adapted as a general tumor-initiating cell selection method. Both normal cells and CSCs from epithelial organs can be grown as spherical clones in serum-free EGF/bFGF-supplemented medium that favors the proliferation of undifferentiated cells (18).

We therefore evaluated SW982 cell self-renewal and ability to generate spherical clones under serum-starved culture conditions. Our results indicated that the CD133+ subpopulation proliferated as floating spheres (Fig. 2B), while the CD133− subpopulation did not form spheres. When CD133+ spheroids were seeded into serum containing Leibovitz-15 medium, they developed the spindle-like features of the original cell culture (Fig. 2A, C and D). Primary CD133+ spheroid cells that were enzymatically disaggregated after 10–14 days of culture and replated as single-cell suspension went on to generate second passage spheres (Fig. 2E). The ability to form spheres was maintained over five serial passages using this procedure.

Figure 2

Microscopic appearance of CD133+ cells in monolayer condition (A) and CD133+ cells grew as floating spheres in serum-free medium for 12 days (B). When these spheres were seeded in serum containing medium, adherent cells can be seen expanding from these spheres after 20 h (C) and 60 h (D) and dissociated primary CD133+ sphere cells showed a capacity for secondary sphere formation (E).

CD133+ SW982 subpopulations are resistant to chemotherapeutic agents

We found that CDDP and DXR inhibited the proliferation of both CD133+ and CD133− SW982 cell populations in a dose-dependent manner. The survival rates of CD133+ and CD133− cells after 48-h drug treatment were measured (Tables II and III; Fig. 3) and CD133+ cells were found to be significantly more resistant to both CDDP and DXR than CD133− cells (Fig. 3A and B): 10 μM CDDP inhibited CD133− and CD133+ proliferation by ≤54.4 and 24.5%, respectively; 10 μM DXR inhibited CD133− and CD133+ proliferation by ≤59.5 and 30.2%, respectively. These results indicate that CD133+ cells are resistant to both CDDP and DXR, the chemotherapeutic drugs most commonly used for sarcomas. We also compared the drug response in CD133+ spheroids and adherent cells. Maximal growth inhibition of CD133+ spheroids was 13.7% for CDDP and 19% for DXR (Fig. 3C and D), demonstrating spheroid cells were more resistant than adherent cells to both drugs.

Figure 3

Drug resistance of CD133+ and CD133− cells. The CD133+ cells were highly resistant to CDDP (A) and DXR (B) in comparison with the CD133− cells. The spheroids were significantly resistant to CDDP (C) and DXR (D) in comparison with the adherent CD133+ cells (± SD; *p<0.05; **p<0.01).

Table II

Cell survival rates (%) after 48 h CDDP and DXR treatments of CD133+ and CD133− cells.

Table II

Cell survival rates (%) after 48 h CDDP and DXR treatments of CD133+ and CD133− cells.

CDDPDXR


1 μM5 μM10 μM1 μM5 μM10 μM
CD133+93.80±1.2381.10±2.2675.54±1.8390.10±2.2176.87±1.2370.87±2.21
CD133−76.50±1.5957.63±1.6445.63±1.3077.13±0.8548.53±2.5240.50±1.44
χ211.8412.8718.716.1617.1118.60
p-value0.0010.0000.0000.0130.0000.000

[i] Values expressed as means ± SD. χ2 test, p<0.05, statistical significance.

Table III

Cell survival rates (%) after 48 h CDDP and DXR treatments of sphere and adherent CD133+ cells.

Table III

Cell survival rates (%) after 48 h CDDP and DXR treatments of sphere and adherent CD133+ cells.

CDDPDXR


1 μM5 μM10 μM1 μM5 μM10 μM
Sphere CD133+96.42±2.2090.91±2.1786.30±1.2095.00±1.3589.33±1.4181.10±1.20
Adherent CD133+93.80±1.2381.10±2.2675.54±1.8390.10±2.2176.87±1.2370.87±2.21
χ20.734.063.7741.745.552.84
p-value0.3940.0440.0490.1870.0180.092

[i] Values expressed as means ± SD. χ2 test, p<0.05, statistical significance.

Increased expression of stemness and drug transporter genes in SW982 CD133+ subpopulations

Expression levels of stemness and drug transporter genes were examined in both the CD133+ and CD133− subpopulations by real-time PCR and western blotting. We observed that the expression of genes that play a prominent role in stem cell maintenance and nuclear reprogramming, including Bmi1, c-Myc, Nanog, Oct3/4 and Sox2(29–31) were consistently higher in the CD133+ subpopulation compared with their CD133− counterparts (Fig. 4A). However, c-Myc and Bmi1 protein expression was not significantly increased in CD133+ cells in comparison with CD133− cells (Fig. 4B). In addition, both gene and protein expression of the ABCG2 drug transporter was significantly increased in CD133+ cells compared with CD133− cells.

Figure 4

The gene expression profile of CD133+ and CD133− subpopulations. (A) The real-time PCR analysis of stemness and drug transporter gene expression in the CD133+ and CD133− subpopulations (± SD; *p<0.05; **p<0.01; RQ, relative quantity). (B) Western blot analysis of the stemness and drug transporter gene, GAPDH was used as a loading control.

Increased cancer initiation by CD133+ cells in vivo

To investigate the tumorigenic potential of CD133+ and CD133− cells, both subpopulations of SW982 cells were injected into BALB/c nude mice to generate xenografts. A difference in tumorigenicity was observed between the CD133+ and CD133− cell populations (Table IV). Tumor formation was observed after the injection of as few as 5×103 CD133+ cells (Fig. 5A and B). In contrast, only one out of five mice injected with 1×105 CD133− cells and none of the mice injected with ≤1×104 CD133− cells developed tumors. CD133− cells (≥1×105) were required to initiate a tumor, suggesting that the in vivo tumorigenicity of CD133− cells is lower than that of CD133+ cells. In addition, CD133+ cells initiated both secondary and tertiary tumors, whereas CD133− cells did not.

Figure 5

Analysis of tumors grown from CD133+ and CD133− subpopulations. (A and B) CD133+ and CD133− cells (1×105) were subcutaneously injected into BALB/c nude mice and gross appearance of resected tumors. (C and D) CD133+ tumor revealed histologic characteristics similar to CD133− tumor. Left, H&E staining; right, expression of CD133.

Table IV

Tumor initiating capacity of CD133+ and CD133− subpopulations.

Table IV

Tumor initiating capacity of CD133+ and CD133− subpopulations.

Cell number for injection
1×103 5×103 1×104 1×105 1×106
CD133+0/52/54/55/5
CD133−0/50/51/55/5

We performed HE staining and immunohistochemistry to demonstrate that the xenografts were derived from the injected CD133+ and CD133− cells. However, both CD133+ and CD133− tumors had similar histological characteristics and levels of CD133 expression (Fig. 5C and D).

Discussion

CSCs are present in numerous types of cancer (15) and are capable of self-renewal and differentiation and spheroid formation and have a high tumorigenicity and resistance to current treatments. In many cases, cancer therapy failure may be caused by a lack of effect of current therapies upon CSCs, which are able to survive such treatments and regenerate the tumor. It is therefore necessary to be able to detect and characterize CSCs, in order to develop new CSC-targeted therapeutic strategies. The major problems involved in isolating CSCs are their rarity and the absence of specific markers to enable their purification.

In early investigations, the side population (SP), defined by Hoechst dye exclusion, was identified as a distinct subset of cells; these cells were subsequently isolated and designated CSCs, possess stemness characteristics and are responsible for tumorigenesis in several cancer types (32–35). Some SS have been shown to contain SP with enhanced tumorigenic potential (36). We originally tried to identify SP cells in the human SS cell line SW982, but failed, possibly because of inappropriate culture conditions or lack of a stem cell population in this cell line. Aldehyde dehydrogenase (ALDH) functions as a detoxifying enzyme, has been proposed as a marker of both normal and cancer stem cells (37) and has been successfully employed as a stem cell marker in breast (38), prostate (39), colon (40) and lung cancer (41). We demonstrated that SW982 cells contain a subpopulation with high ALDH activity, comprising ∼0.8% of the total cell population (Fig. 6). We also found that the CD133+ subpopulation comprises 8.59% of SW982 cells (Fig. 1A). Therefore, the CD133 antigen is potential CSC marker in SW982 cells; using this marker, we were able to isolate a population containing a high proportion of CD133+ cells. To our knowledge, this is the first report of the analysis of CD133 expression in SW982 cells.

Figure 6

ALDH expression in SW982 cell lines. (A) FACS analysis of SW982 with ALDH inhibitor DEAB as a control. (B) Aldefluor assay showing 1.0% of the cell population in SW982 express high ALDH1 activity.

Two SS cell lines have been reported to exhibit sarco spheres (42). In the present study, we identified many differences between the CD133+ and CD133− subpopulations; for example, CD133+ cells were better at forming spherical colonies and self-renewal in anchorage-independent, serum-starved culture conditions. Moreover, the CD133+ subpopulation expressed high levels of stemness genes. We compared the expression of genes that play a prominent role in stem cell maintenance, self-renewal and nuclear reprogramming, including Bmi1, c-Myc, Nanog, Oct3/4 and Sox2, in the CD133+ and CD133− subpopulations. The Oct3/4 transcription factor is critically involved in self-renewal and the maintenance of pluripotency in undifferentiated embryonic stem (ES) cells (43). The Sox family of transcription factors plays an essential role in cell differentiation and development. Sox2 was originally thought to be the only Sox protein expressed in ES cells (44) and associating with Oct3/4 to maintain ES cell self-renewal. C-Myc is a dominant-acting oncogene that encodes a transcription factor thought to regulate the G0-G1 cell cycle transition. Bmi1 is a member of the mammalian polycomb group (Pc-G) gene family (45), which contributes to the proliferative capacity and self-renewal of both normal and malignant stem cells (46). Bmi1 recently emerged as a Myc-cooperating oncogene (47). As both genes play an important role in stem cell maintenance, Bmi1 and c-Myc expression may correlate with self-renewal and anti-apoptotic mechanisms in CSCs. Another highly expressed gene in CD133+ cells is Nanog, which encodes a recently identified divergent homeoprotein that maintains ES cell self-renewal (48). All five stemness genes were consistently and significantly overexpressed in the CD133+ subpopulation by real-time PCR. Although we did not demonstrate a relationship between expression of the encoded proteins and the genesis of SS, these data provide compelling evidence that a CD133+ subpopulation with stem-like properties exists in SW982 cells.

CD133+ subpopulations were more resistant to the cytotoxic effects of both CDDP and DXR, showing improved survival compared to CD133− subpopulations. In addition, CD133+ subpopulation-derived spheroids were more drug-resistant than adherent cells. Increased expression of ABC trans porter proteins, in particular ABCG2, is reported to significantly contribute to the CSC phenotype, strongly correlates with drug-resistance and is associated with a poor clinical outcome (49,50). In our study, we revealed that ABCG2 mRNA and protein expression was elevated in CD133+ subpopulations; this may be responsible for high levels of CSC multi-drug resistance and therefore constitutes a good target for clinical cancer therapy.

In addition, using a BALB/c xenograft model we observed that the CD133+ subpopulation had a higher tumorigenic potential in vivo than the CD133− subpopulation. Furthermore, slower tumor formation was observed by the CD133− subpopulation, despite injection of more cells. This observation suggests the existence of other cell populations with tumor-initiating potential, although we cannot exclude the possibility of CD133+ cell contamination in the CD133− subpopulation during cell sorting procedures.

In conclusion, this study is the first to successfully isolate the CD133+ subpopulation from the human SS cell line SW982 and reveals that this CD133+ subpopulation exhibits several characteristic CSC properties, including high clonogenicity and self-renewal, increased chemotherapeutic drug resistance, elevated expression of stemness and drug transporter genes and high tumorigenic potential. Therefore, CD133 may represent a new stem cell marker for SS and may lead to novel approaches to develop therapies that selectively attack CSCs without affecting normal tissue stem cells and thus improve the prognosis for patients with SS.

Acknowledgements

This study was supported by a grant from the National Natural Science Foundation of China (no. 81072192).

References

1 

Eilber FC, Rosen G, Nelson S, Selch M, Dorey F, Eckardt J and Eilber FR: High-grade extremity soft tissue sarcomas: factors predictive of local recurrence and its effect on morbidity and mortality. Ann Surg. 237:218–226. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Fisher C: Synovial sarcoma. Ann Diagn Pathol. 2:401–421. 1998. View Article : Google Scholar

3 

Amary MF, Berisha F, Bernardi Fdel C, Herbert A, James M, Reis-Filho JS, Fisher C, Nicholson AG, Tirabosco R, Diss TC and Flanagan AM: Detection of SS18-SSX fusion transcripts in formalin-fixed paraffin-embedded neoplasms: analysis of conventional RT-PCR, qRT-PCR and dual color FISH as diagnostic tools for synovial sarcoma. Mod Pathol. 20:482–496. 2007. View Article : Google Scholar

4 

Fletcher CDM, Unni KK and Mertens F: Tumours of Soft Tissue and Bone. IARC Press; Lyon: pp. 200–204. 2002

5 

Nagayama S, Katagiri T, Tsunoda T, Hosaka T, Nakashima Y, Araki N, Kusuzaki K, Nakayama T, Tsuboyama T, Nakamura T, Imamura M, Nakamura Y and Toguchida J: Genome-wide analysis of gene expression in synovial sarcomas using a cDNA microarray. Cancer Res. 62:5859–5866. 2002.PubMed/NCBI

6 

Weiss SW and Goldblum JR: Enzinger and Weiss’s Soft Tissue Tumors. 5th edition. Mosby Inc.; St. Louis, MO: pp. 1161–1182. 2008

7 

Haldar M, Randall RL and Capecchi MR: Synovial sarcoma: from genetics to genetic-based animal modeling. Clin Orthop Relat Res. 466:2156–2167. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Reya T, Morrison SJ, Clarcke MF and Weissman IL: Stem cells, cancer and cancer stem cells. Nature. 414:105–111. 2001. View Article : Google Scholar : PubMed/NCBI

9 

Milas L and Hittelman WN: Cancer stem cells and tumor response to therapy: current problems and future prospects. Semin Radiat Oncol. 19:96–105. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Bonnet D and Dick JE: Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med. 3:730–737. 1997. View Article : Google Scholar : PubMed/NCBI

11 

Ponti D, Costa A, Zaffaroni N, Pratesi G, Petrangolini G, Coradini D, Pilotti S, Pierotti MA and Daidone MG: Isolation and in vitro propagation of tumorigenic breast cancer cells with stem/progenitor cell properties. Cancer Res. 65:5506–5511. 2005. View Article : Google Scholar : PubMed/NCBI

12 

Miki J, Furusato B, Li H, Gu Y, Takahashi H, Egawa S, Sesterhenn IA, McLeod DG, Srivastava S and Rhim JS: Identification of putative stem cell markers, CD133 and CXCR4, in hTERT-immortalized primary nonmalignant and malignant tumor-derived human prostate epithelial cell lines and in prostate cancer specimens. Cancer Res. 67:3153–3161. 2007. View Article : Google Scholar

13 

Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, Henkelman RM, Cusimano MD and Dirks PB: Identification of human brain tumour initiating cells. Nature. 432:396–401. 2004. View Article : Google Scholar : PubMed/NCBI

14 

Schatton T, Murphy GF, Frank NY, Yamaura K, Waaga-Gasser AM, Gasser M, Zhan Q, Jordan S, Duncan LM, Weishaupt C, Fuhlbrigge RC, Kupper TS, Sayegh MH and Frank MH: Identification of cells initiating human melanomas. Nature. 451:345–349. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Li C, Lee CJ and Simeone DM: Identification of human pancreatic cancer stem cells. Methods Mol Biol. 568:161–173. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Suvà ML, Riggi N, Stehle JC, Baumer K, Tercier S, Joseph JM, Suvà D, Clément V, Provero P, Cironi L, Osterheld MC, Guillou L and Stamenkovic I: Identification of cancer stem cells in Ewing’s sarcoma. Cancer Res. 69:1776–1781. 2009.

17 

O’Brien CA, Pollett A, Gallinger S and Dick JE: A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature. 445:106–110. 2007.PubMed/NCBI

18 

Ricci-Vitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M, Peschle C and De Maria R: Identification and expansion of human colon-cancer-initiating cells. Nature. 445:111–115. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Mizrak D, Brittan M and Alison MR: CD133: molecule of the moment. J Pathol. 214:3–9. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J and Dirks PB: Identification of a cancer stem cell in human brain tumors. Cancer Res. 63:5821–5828. 2003.PubMed/NCBI

21 

Vander Griend DJ, Karthaus WL, Dalrymple S, Meeker A, DeMarzo AM and Isaacs JT: The role of CD133 in normal human prostate stem cells and malignant cancer-initiating cells. Cancer Res. 68:9703–9711. 2008.PubMed/NCBI

22 

Hermann PC, Huber SL, Herrler T, Aicher A, Ellwart JW, Guba M, Bruns CJ and Heeschen C: Distinct populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer. Cell Stem Cell. 1:313–323. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Eramo A, Lotti F, Sette G, Pilozzi E, Biffoni M, Di Virgilio A, Conticello C, Ruco L, Peschle C and De Maria R: Identification and expansion of the tumorigenic lung cancer stem cell population. Cell Death Differ. 15:504–514. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Curley MD, Therrien VA, Cummings CL, Sergent PA, Koulouris CR, Friel AM, Roberts DJ, Seiden MV, Scadden DT, Rueda BR and Foster R: CD133 expression define s a tumor initiating cell population in primary human ovarian cancer. Stem Cells. 27:2875–2883. 2009.PubMed/NCBI

25 

Tirino V, Desiderio V, d’Aquino R, De Francesco F, Pirozzi G, Graziano A, Galderisi U, Cavaliere C, De Rosa A, Papaccio G and Giordano A: Detection and characterization of CD133+ cancer stem cells in human solid tumors. PLoS One. 3:e37692008. View Article : Google Scholar

26 

Terry J and Nielsen T: Expression of CD133 in synovial sarcoma. Appl Immunohistochem Mol Morphol. 18:159–165. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Fujii H, Honoki K, Tsujiuchi T, Kido A, Yoshitani K and Takakura Y: Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int J Oncol. 34:1381–1386. 2009.PubMed/NCBI

28 

Gibbs CP, Kukekov VG, Reith JD, Tchigrinova O, Suslov ON, Scott EW, Ghivizzani SC, Ignatova TN and Steindler DA: Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7:967–976. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Okita K, Ichisaka T and Yamanaka S: Generation of germline-competent induced pluripotent stem cells. Nature. 448:313–317. 2007. View Article : Google Scholar : PubMed/NCBI

30 

Takahashi K and Yamanaka S: Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126:663–676. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Wernig M, Meissner A, Foreman R, Brambrink T, Ku M, Hochedlinger K, Bernstein BE and Jaenisch R: In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448:318–324. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Kondo T, Setoguchi T and Taga T: Persistence of a small subpopulation of cancer stem-like cells in the C6 glioma cell line. Proc Natl Acad Sci USA. 101:781–786. 2004. View Article : Google Scholar : PubMed/NCBI

33 

Haraguchi N, Utsunomiya T, Inoue H, Tanaka F, Mimori K, Barnard GF and Mori M: Characterization of a side population of cancer cells from human gastrointestinal system. Stem Cells. 24:506–513. 2006. View Article : Google Scholar : PubMed/NCBI

34 

Chiba T, Kita K, Zheng YW, Yokosuka O, Saisho H, Iwama A, Nakauchi H and Taniguchi H: Side population purified from hepatocellular carcinoma cells harbors cancer stem cell-like properties. Hepatology. 44:240–251. 2006. View Article : Google Scholar : PubMed/NCBI

35 

Szotek PP, Pieretti-Vanmarcke R, Masiakos PT, Dinulescu DM, Connolly D, Foster R, Dombkowski D, Preffer F, Maclaughlin DT and Donahoe PK: Ovarian cancer side population defines cells with stem cell-like characteristics and Mullerian inhibiting substance responsiveness. Proc Natl Acad Sci USA. 103:11154–11159. 2006. View Article : Google Scholar : PubMed/NCBI

36 

Wu C, Wei Q, Utomo V, Nadesan P, Whetstone H, Kandel R, Wunder JS and Alman BA: Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer Res. 67:8216–8222. 2007. View Article : Google Scholar : PubMed/NCBI

37 

Ginestier C, Hur MH, Charafe-Jauffret E, Monville F, Dutcher J, Brown M, Jacquemier J, Viens P, Kleer CG, Liu S, Schott A, Hayes D, Birnbaum D, Wicha MS and Dontu G: ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor outcome. Cell Stem Cell. 1:555–567. 2007. View Article : Google Scholar : PubMed/NCBI

38 

Charafe-Jauffret E, Ginestier C, Iovino F, Wicinski J, Cervera N, Finetti P, Hur MH, Diebel ME, Monville F, Dutcher J, Brown M, Viens P, Xerri L, Bertucci F, Stassi G, Dontu G, Birnbaum D and Wicha MS: Breast cancer cell lines contain functional cancer stem cells with metastatic capacity and a distinct molecular signature. Cancer Res. 69:1302–1313. 2009. View Article : Google Scholar : PubMed/NCBI

39 

Kim H, Lapointe J, Kaygusuz G, Ong DE, Li C, van de Rijn M, Brooks JD and Pollack JR: The retinoic acid synthesis gene ALDH1a2 is a candidate tumor suppressor in prostate cancer. Cancer Res. 65:8118–8124. 2005. View Article : Google Scholar : PubMed/NCBI

40 

Huang EH, Hynes MJ, Zhang T, Ginestier C, Dontu G, Appelman H, Fields JZ, Wicha MS and Boman BM: Aldehyde dehydrogenase 1 is a marker for normal and malignant human colonic stem cells (SC) and tracks SC overpopulation during colon tumorigenesis. Cancer Res. 69:3382–3389. 2009. View Article : Google Scholar : PubMed/NCBI

41 

Jiang F, Qiu Q, Khanna A, Todd NW, Deepak J, Xing L, Wang H, Liu Z, Su Y, Stass SA and Katz RL: Aldehyde dehydrogenase 1 is a tumor stem cell-associated marker in lung cancer. Mol Cancer Res. 7:330–338. 2009. View Article : Google Scholar : PubMed/NCBI

42 

Naka N, Takenaka S, Araki N, Miwa T, Hashimoto N, Yoshioka K, Joyama S, Hamada K, Tsukamoto Y, Tomita Y, Ueda T, Yoshikawa H and Itoh K: Synovial sarcoma is a stem cell malignancy. Stem Cells. 28:1119–1131. 2010.PubMed/NCBI

43 

Tokuzawa Y, Kaiho E, Maruyama M, Takahashi K, Mitsui K, Maeda M, Niwa H and Yamanaka S: Fbx15 is a novel target of Oct3/4 but is dispensable for embryonic stem cell self-renewal and mouse development. Mol Cell Biol. 23:2699–2708. 2003. View Article : Google Scholar : PubMed/NCBI

44 

Maruyama M, Ichisaka T, Nakagawa M and Yamanaka S: Differential roles for Sox15 and Sox2 in transcriptional control in mouse embryonic stem cells. J Biol Chem. 280:24371–24379. 2005. View Article : Google Scholar : PubMed/NCBI

45 

Brunk BP, Martin EC and Adler PN: Drosophila genes posterior sex combs and suppressor two of zeste encodes proteins with homology to the murine bmi-1 oncogene. Nature. 353:351–353. 1991. View Article : Google Scholar : PubMed/NCBI

46 

Lessard J and Sauvageau G: Bmi-1 determines the proliferative capacity of normal and leukaemic stem cells. Nature. 423:255–260. 2003. View Article : Google Scholar : PubMed/NCBI

47 

Haupt Y, Alexander WS, Barri G, Klinken SP and Adams JM: Novel zinc finger gene implicated as myc collaborator by retrovirally accelerated lymphomagenesis in E mu-myc transgenic mice. Cell. 65:753–763. 1991. View Article : Google Scholar : PubMed/NCBI

48 

Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, Maruyama M, Maeda M and Yamanaka S: The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell. 113:631–642. 2003. View Article : Google Scholar : PubMed/NCBI

49 

Ho MM, Ng AV, Lam S and Hung JY: Side population in human lung cancer cell lines and tumors is enriched with stem-like cancer cells. Cancer Res. 67:4827–4833. 2007. View Article : Google Scholar : PubMed/NCBI

50 

Ding XW, Wu JH and Jiang CP: ABCG2: a potential marker of stem cells and novel target in stem cell and cancer therapy. Life Sci. 86:631–637. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu A, Feng B, Gu W, Cheng X, Tong T, Zhang H and Hu Y: The CD133+ subpopulation of the SW982 human synovial sarcoma cell line exhibits cancer stem-like characteristics. Int J Oncol 42: 1399-1407, 2013.
APA
Liu, A., Feng, B., Gu, W., Cheng, X., Tong, T., Zhang, H., & Hu, Y. (2013). The CD133+ subpopulation of the SW982 human synovial sarcoma cell line exhibits cancer stem-like characteristics. International Journal of Oncology, 42, 1399-1407. https://doi.org/10.3892/ijo.2013.1826
MLA
Liu, A., Feng, B., Gu, W., Cheng, X., Tong, T., Zhang, H., Hu, Y."The CD133+ subpopulation of the SW982 human synovial sarcoma cell line exhibits cancer stem-like characteristics". International Journal of Oncology 42.4 (2013): 1399-1407.
Chicago
Liu, A., Feng, B., Gu, W., Cheng, X., Tong, T., Zhang, H., Hu, Y."The CD133+ subpopulation of the SW982 human synovial sarcoma cell line exhibits cancer stem-like characteristics". International Journal of Oncology 42, no. 4 (2013): 1399-1407. https://doi.org/10.3892/ijo.2013.1826
Copy and paste a formatted citation
x
Spandidos Publications style
Liu A, Feng B, Gu W, Cheng X, Tong T, Zhang H and Hu Y: The CD133+ subpopulation of the SW982 human synovial sarcoma cell line exhibits cancer stem-like characteristics. Int J Oncol 42: 1399-1407, 2013.
APA
Liu, A., Feng, B., Gu, W., Cheng, X., Tong, T., Zhang, H., & Hu, Y. (2013). The CD133+ subpopulation of the SW982 human synovial sarcoma cell line exhibits cancer stem-like characteristics. International Journal of Oncology, 42, 1399-1407. https://doi.org/10.3892/ijo.2013.1826
MLA
Liu, A., Feng, B., Gu, W., Cheng, X., Tong, T., Zhang, H., Hu, Y."The CD133+ subpopulation of the SW982 human synovial sarcoma cell line exhibits cancer stem-like characteristics". International Journal of Oncology 42.4 (2013): 1399-1407.
Chicago
Liu, A., Feng, B., Gu, W., Cheng, X., Tong, T., Zhang, H., Hu, Y."The CD133+ subpopulation of the SW982 human synovial sarcoma cell line exhibits cancer stem-like characteristics". International Journal of Oncology 42, no. 4 (2013): 1399-1407. https://doi.org/10.3892/ijo.2013.1826
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team