Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
July-2014 Volume 45 Issue 1

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2014 Volume 45 Issue 1

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

The oncoprotein hepatitis B X-interacting protein promotes the migration of ovarian cancer cells through the upregulation of S-phase kinase-associated protein 2 by Sp1

  • Authors:
    • Fuqiang Xu
    • Xiaoming Zhu
    • Tao Han
    • Xiaona You
    • Fabao Liu
    • Lihong Ye
    • Xiaodong Zhang
    • Xiaohong Wang
    • Yuanqing Yao
  • View Affiliations / Copyright

    Affiliations: Department of Gynecology and Obstetrics, General Hospital Chinese PLA, Beijing 100853, P.R. China, Department of Orthopedics, Hainan Branch of PLA General Hospital, Sanya, Hainan 572013, P.R. China, Department of Cancer Research, Key Laboratory of Molecular Microbiology and Technology of Ministry of Education, Institute for Molecular Biology, College of Life Sciences, Nankai University, Tianjin 300071, P.R. China, Department of Biochemistry, State Key Laboratory of Medicinal Chemical Biology, College of Life Sciences, Nankai University, Tianjin 300071, P.R. China, Department of Obstetrics and Gynecology, Tangdu Hospital, Fourth Military Medical University, Xi'an, Shanxi 710038, P.R. China
  • Pages: 255-263
    |
    Published online on: April 29, 2014
       https://doi.org/10.3892/ijo.2014.2411
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Hepatitis B X-interacting protein (HBXIP) is a novel oncoprotein. We have previously reported that HBXIP promotes the proliferation and migration of breast cancer cells. S-phase kinase-associated protein 2 (Skp2) is another oncoprotein which is important for migration. In this study, we investigated whether Skp2 is involved in the migration enhanced by HBXIP in ovarian cancer. The expression of HBXIP and Skp2 in ovarian cancer tissues was examined by immunohistochemistry using tissue microarrays. The role of HBXIP and Skp2 in the migration of ovarian cancer cells was investigated by wound-healing assay and Transwell migration assay. The effect of HBXIP on Skp2 was assessed by reverse transcription polymerase chain reaction (RT-PCR), western blot analysis, luciferase reporter gene assays and chromatin immunoprecipitation in ovarian cancer cells (SKOV3 and CAOV3). We found that both HBXIP and Skp2 were highly expressed in ovarian cancer tissues. We observed that the overexpression of HBXIP enhanced the migration of ovarian cancer cells, while Skp2 siRNAs decreased the cell migration enhanced by HBXIP. The HBXIP siRNAs inhibited ovarian cancer cell migration and Skp2 rescued the migration inhibition induced by HBXIP siRNA. HBXIP could upregulate Skp2 at the levels of mRNA and protein in ovarian cancer cells. Moreover, HBXIP increased the activity of Skp2 promoter via binding to the transcription factor Sp1. HBXIP is highly expressed in ovarian cancer tissues. HBXIP enhances the migration of ovarian cancer cells. HBXIP was able to stimulate the activity of Skp2 promoter via transcription factor Sp1 thus promoting the migration of ovarian cancer cells.

Introduction

Mammalian hepatitis B X-interacting protein (HBXIP) is a conserved 18 kDa protein, which was originally identified because of its interaction with the C-terminus of hepatitis B virus X protein (HBx) (1,2). HBXIP sequences are well conserved among mammalian species, with close orthologues found in all vertebrate species where sequence data exist. HBXIP formed a complex with survivin, an anti-apoptotic protein that is overexpressed in most human cancers, resulting in the suppression of cell apoptosis through the mitochondrial/cytochrome pathway. HBXIP also regulates centrosome duplication, causing excessive centrosome production and multipolar mitotic spindles in HeLa cells (3,4). HBXIP is involved in mTORC1 pathway regulating cell growth (5). Our previous studies reported that HBXIP was able to promote cell proliferation and migration through S100A4 and IL-8 in breast cancer cells (6,7). However, the mechanism by which HBXIP enhances migration of ovarian cancer cells is poorly understood.

S-phase kinase-associated protein 2 (Skp2) belongs to the family of the F-box proteins. Skp2, which was originally discovered by Zhang et al in 1995, because of its ability to interact with the cell cycle protein cyclin A, is necessary for DNA replication (8). The Skp2 protein levels changes during the cell cycle, which is low in early G1 phase, while it is high during G1/S transition (9). This alteration in the Skp2 protein level during cell cycle progression is partly due to a change in its gene expression and protein stability (10). A previous report showed that Skp2 overexpression in prostate cancer cells markedly promoted cancer cell growth and tumorigenesis in a xenograft tumor model (11). And other groups showed that Skp2 deficiency displayed a defect in cell migration and metastasis, while Skp2 overexpression promoted cell migration and invasion (11,12). Inuzuka et al have shown that acetylation of Skp2 enhanced cellular migration through ubiquitination and destruction of E-cadherin (13). Subsequent experiments revealed that Skp2 was involved in cell cycle progression. Cardozo and Pagano have shown that Skp2 plays an important role in governing cell cycle progression and cell survival by promoting the destruction of numerous tumor suppressor proteins, including p27, p21, p57, p130 and FOXO1 (14). Aberrant Skp2 signaling has been implicated as a driving event in tumorigenesis. Overexpression of Skp2 was frequently observed in numerous human cancers, such as ovarian, colorectal, gastric, prostate, lung, sarcoma, breast and other cancers (15–26). These observations suggest that Skp2 may contribute to the development of human cancers. Accumulated evidence suggests that Skp2 displays a proto-oncogenic role in vitro and in vivo. Previous report showed that repamycin, an mTOR inhibitor, could downregulate the expression of Skp2 in breast cancer (27). Thus, we speculate Skp2 may play an important role in the function mediated by HBXIP.

In the present study, we investigated the role of HBXIP and Skp2 in migration of ovarian cancer cells, with the hope that such associations might provide insight into the causal mechanisms by which HBXIP enhances the migration of ovarian cancer cells.

Materials and methods

Immunohistochemistry

The ovarian carcinoma tissue micro-arrays were obtained from the Xi’an Aomei Biotechnology Co., Ltd. (Xi’an, China). These microarrays (catalog no. C1026) were composed of 80 ovarian carcinoma tissue samples (average age 39), which included duplicate core biopsies (1 mm in diameter) from fixed, paraffin-embedded tumors. Immunohistochemical staining of samples were performed as previously reported (28) and the primary antibody of rabbit anti-HBXIP (1:100, Proteintech Group, Chicago, IL, USA) or the primary antibody of rabbit anti-Skp2 (1:30, Boster Group, Wuhan, China) was used. Immunostained slides were evaluated under a microscope. Categorization of immunostaining intensity was performed by three independent observers. The staining levels of HBXIP and Skp2 were classified into three groups using a modified scoring method based on the intensity of staining (0, negative; 1, low; and 2, high) and the percentage of stained cells (0, 0% stained; 1, 1–49% stained; and 2, 50–100% stained). A multiplied score (intensity score x percentage score) lower than 1 was considered to be a negative staining (−), 1 and 2 were considered to be moderate staining (+), and 4 was considered to be intense staining (++).

Cell lines and cell culture

Ovarian cancer cell lines, SKOV3 cells (29) were cultured in RPMI-1640 medium (Gibco-BRL, Grand Island, NY, USA), 10% fetal bovine serum (FBS); CAOV3 cells (29) were cultured in DMEM medium (Gibco-BRL), 10% FBS. 100 U/ml penicillin and 100 μg/ml streptomycin in humidified 5% CO2 at 37°C.

Plasmid construction and small interference RNA (siRNA)

pCMV-tag2B, pGL3-Basic vectors (Promega, Madison, WI, USA), pCMV-HBXIP was maintained in our laboratory (6). The 5′-flanking region (from -1309 to +235 nt) of Skp2 gene was inserted into the KpnI/XhoI site upstream of the luciferase gene in the pGL3-basic vector, termed pGL3-Skp2 promoter. Mutant construction of Skp2 promoter, termed as pGL3-Skp2 promoter mut, carried a series substitution of nucleotides within Sp1 binding site. The complete human Skp2 (GenBank accession no. NC 000005.9) gene was subcloned into pCMV-tag2B vector to generate the pCMV-Skp2 construct. siRNA duplexes targeting human HBXIP (or Skp2) gene and siRNA duplexes with non-specific sequences using as negative control (NC) were synthesized by RiboBio (Guangzhou, China) (3,30). All primers and siRNA sequences are listed in Table I.

Table I.

The primers and sequences usxed in this study.

Table I.

The primers and sequences usxed in this study.

GenePrimerSequence (5′→3′)
Primers for Skp2 promoter
−1309Forward CGGGGTACCCCGTCCCTTCTTTACACCAATCTC
+235Reverse CCGCTCGAGCGGCGTTTACCTGTGCATAGCG
Sp-1-MUTForward CACGCTCGGAGCAGCTGTGCGCCAAAGCGG
Reverse CCGCTTTGGCGCACAGCTGCTCCGAGCGTG
Primers for qRT-PCR
Skp2Forward CTTTCTGGGTGTTCTGGATTCTC
Reverse TGGAAGTTCTGTATGTTTGAGGG
HBXIPForward ATGGAGCCAGGTGCAGGTC
Reverse TGGAGGGATTCTTCATTGTG
GAPDHForward CATCACCATCTTCCAGGAGCG
Reverse TGACCTTGCCCACAGCCTTG
Primers for ChIP
−640Forward GCGGGACGGAAACTACAA
−443Reverse TGCATTAACTGCAGAGCTGC
siRNA duplexes
HBXIP siRNASense CGGAAGCGCAGUGAUGUUUdTdT
AntisenseAAACAUCACUGCGCUUCCG dTdT
Skp2 siRNASense GCAAAGGGAGTGACAAAdTdT
Antisense TTTGTCACTCCCTTTGCdTdT
Control siRNASense UUCUCCGAACGUGUCACGUdTdT
Antisense ACGUGACACGUUCGGAGAAdTdT
Transfection

One day before transfection, cells were harvested and seeded into 6- or 24-well plates. Cells were transfected with plasmid or siRNAs using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol.

Wound-healing assay and Transwell migration assay

Cells transfected with plasmid of HBXIP, plasmid of HBXIP and siRNAs of Skp2, siRNAs of HBXIP, siRNAs of HBXIP and pCMV-Skp2 were seeded in a 6-well plate and cultured for 24 h to form confluent monolayers. A wound was created by dragging a pipette tip through the monolayer, and plates were washed using pre-warmed PBS to remove cellular debris. Wound images were photographed at 0, 24, 48 and 72 h after wounding. The wound gaps were measured at each time point. For Transwell migration assay using SKOV3 and CAOV3 cells with indicated treatment, 5×105 cells were plated on 8 μm Transwell filters (Corning Incorporated, Corning, NY, USA). The cells were induced to migrate towards medium containing 10% FBS for 20 h. Non-migrating cells were removed with a cotton swab. The remaining cells were fixed, stained with hematoxylin and eosin, and analysed by a bright-field microscope.

RNA extraction and reverse-transcription polymerase chain reaction (RT-PCR)

Total RNA of cells was extracted using TRIzol reagent (Invitrogen). First-strand cDNA was synthesized by PrimeScript reverse transcriptase (Takara Bio, Dalian, China) and oligo (dT) following the manufacturer’s instructions. The primers are listed in Table I.

Western blot analysis

Western blot analysis was carried out with standard protocols. Primary antibodies used were rabbit anti-Skp2 (1:300, Boster Group), rabbit anti-HBXIP (1:1,000, Proteintech Group), and mouse anti-β-actin (1:800, Sigma-Aldrich, St. Louis, MO, USA). All experiments were repeated 3 times.

Luciferase reporter gene assays

For luciferase reporter gene assays, the ovarian cancer cells were transfected with plasmids encoding HBXIP by Lipofectamine 2000. The luciferase activities were determined 48 h after transfection, and the results are the average of 3 independent repeats. The luciferase activities in the cell lysates were measured by a dual luciferase reporter assay kit (Promega), and the luciferase activity was normalized with renilla luciferase activity.

Chromatin immunoprecipitation (ChIP) and ReChIP assay

The ChIP assay was performed using the EpiQuik™ chromatin immunoprecipitation kit from Epigentek Group Inc (Farmingdale, NY, USA) according to the published methods (6,31). Protein-DNA complexes were immunoprecipitated with HBXIP antibodies, whereas rabbit preimmune serum served as a control. DNA from input or immunoprecipitated samples was assayed using SYBR-Green-based quantitative PCR with specific primers designed to amplify the Skp2 promoter around the SREs. ChIP/ReChIP: ChIP was performed as above, binding complexes from the first immunoprecipitation were eluted from the sepharose beads using Re-ChIP buffer. The eluted protein-DNA complexes were diluted in radioimmunoprecipitation buffer and resubjected to ChIP using a different antibody.

Statistical analysis

Each experiment was repeated at least three times. Statistical significance was assessed by comparing mean values (± SD) using a Student’s t-test for independent groups or pairing χ2 for dependent groups and was assumed for *P<0.05, **P<0.01 and ***P<0.001.

Results

The expression of HBXIP is positively associated with that of Skp2 in clinical ovarian cancer tissues

Our previous reports showed that HBXIP was overexpressed in breast cancer and other cancer cells. However, there is no report concerning the expression of HBXIP in ovarian cancer. In this study, we examined the expression of HBXIP in ovarian cancer. The data revealed that HBXIP was overexpressed in ovarian cancer tissue (Fig. 1). It has been reported that Skp2 is also over-expressed in ovarian cancer tissues (23). Thus, we supposed that overexpression of Skp2 might be correlated with enhanced HBXIP in ovarian cancer. Then, we investigated the expression correlation between HBXIP and Skp2 by IHC using tissue microarrays from the same tissue paraffin block. Our data showed that the positive rate of HBXIP was 75% (60/80) in clinical ovarian cancer tissue samples, and the positive rate of Skp2 was 81.67% (49/60) in the HBXIP-positive specimens (Fig. 1). Pairing χ2 analysis showed that there was no significant difference between the positive rate of HBXIP and that of Skp2 in the tissues (P>0.05, Table II), suggesting that the expression of Skp2 is relevant to that of HBXIP in ovarian cancer tissues. Additionally, in this study, IHC staining showed that the expression of HBXIP could be observed in both cytoplasm and nucleus in ovarian cancer tissues (Fig. 1B). We also observed that Skp2 was expressed in both cytoplasm and nucleus in ovarian cancer tissues (Fig. 1C), which is consistent with a previous study (32). Thus, we speculated that HBXIP might be involved in the transcriptional regulation of Skp2.

Figure 1.

The expression levels of HBXIP are positively associated with those of Skp2 in clinical ovarian cancer tissues. The expression of HBXIP and Skp2 was examined by immunohistochemical staining in ovarian cancer tissues using tissue microarrays. (A) negative control; (B) ovarian cancer tissues with HBXIP-positive staining; (C) ovarian cancer tissues with Skp2-positive staining.

Table II.

Cross tabulation analysis of HBXIP and Skp2 in ovarian cancer tissues.

Table II.

Cross tabulation analysis of HBXIP and Skp2 in ovarian cancer tissues.

HBXIP

TotalNegativePositive
Skp2
Negative205 (25.00%)15 (75.00%)
Positive6011 (18.33%)49 (81.67%)
Total8016 (20.00%)64 (80.00%)

[i] The expression of HBXIP and Skp2 was immunohistochemically examined by tissue array with 80 clinical cancer tissues. Pairing χ2 was used in this statistical analysis by SPSS, P>0.05.

Skp2 is responsible for HBXIP-enhanced migration of ovarian cancer cells in vitro

Cell migration is an essential process in cancer metastasis and HBXIP can promote cell migration in breast cancer cells (6,7). Other reports showed that Skp2 can modulate cell migration of breast cancer, prostate cancer and myxofibrosarcoma (18,21,22,24). Thus, we supposed that Skp2 might be involved in the migration enhanced by HBXIP. Wound-healing and Transwell assays showed that treatment with plasmid encoding HBXIP enhanced the migration of SKOV3 cells, while additionally treated with Skp2 siRNAs abolished the effect (Fig. 2A and B). Furthermore, we performed the same assay using another ovarian cancer cell line CAOV3, and obtained similar results (Fig. 2C and D). We found that the inhibited migration of SKOV3 ovarian cancer cells induced by HBXIP siRNAs, was rescued by the overexpression of Skp2 (Fig. 3A and B). Similar results occurred in CAOV3 ovarian cancer cell line (Fig. 3C and D). Furthermore, as shown in Fig. 4, the RNA interference of HBXIP (or Skp2) decreased the expression of protein levels in SKOV3 and CAOV3 cells. Thus, our data suggest that HBXIP promotes the migration of ovarian cancer cells through Skp2 in vitro.

Figure 2.

Skp2 is responsible for HBXIP-enhanced migration of ovarian cancer cells in vitro. (A–D) SKOV3 (or CAOV3) cells were transfected with either pCMV, pCMV-HBXIP, or pCMV-HBXIP and si-Skp2. The cell migration was determined by wound healing and transwell assays. The images are representative of at least three independent experiments. Statistically significant differences are indicated: *P<0.05, **P<0.01, ***P<0.001, Student’s t-test.

Figure 3.

Skp2 is responsible for HBXIP-enhanced migration of ovarian cancer cells in vitro. (A–D) SKOV3 (or CAOV3) cells were transfected with NC, si-HBXIP, or si-HBXIP and pCMV-Skp2. The cell migration was determined by wound healing and transwell assays. The images are representative of at least three independent experiments. Statistically significant differences are indicated: *P<0.05, **P<0.01, Student’s t-test.

Figure 4.

The RNA interference decreases the protein expression levels of HBXIP and Skp2 in SKOV3 and CAOV3 cells. (A–D) SKOV3 (or CAOV3) cells were transfected with either NC or si-HBXIP (either NC or si-Skp2), respectively. The protein expression levels of HBXIP (or Skp2) were determined by western blot analysis. The experiments are repeated at least three times.

HBXIP upregulates the expression of Skp2 in ovarian cancer cells

Next, we evaluated whether HBXIP was able to upregulate Skp2 in ovarian cancer cell lines. After transfection with plasmid encoding HBXIP, we observed that the levels of mRNA and protein of Skp2 were upregulated by HBXIP in SKOV3 and CAOV3 cell lines in a dose-dependent manner (Fig. 5). Thus, we verified that HBXIP was able to upregulate Skp2 in ovarian cancer cells.

Figure 5.

HBXIP regulates the expression of Skp2 in different ovarian cancer cell lines. (A and B) SKOV3 (or CAOV3) cells were transfected with plasmid of either pCMV or pCMV-HBXIP. The mRNA and protein expression levels of HBXIP and Skp2 were determined by RT-PCR and western blot analysis, respectively.

HBXIP activates Skp2 promoter via transcription factor Sp1

Furthermore, to explore the mechanism by which HBXIP upregulated Skp2, we cloned the promoter region of Skp2 (-1309/+235) into pGL3-Basic plasmid. Luciferase reporter gene assays showed that HBXIP could increase the promoter activities of Skp2 in SKOV3 or CAOV3 ovarian cancer cells in a dose-dependent manner (Fig. 6A and B), suggesting that HBXIP is capable of activating the Skp2 promoter in the ovarian cancer cells. Next, we investigated the underlying mechanism by which HBXIP activates Skp2 promoter. To map the HBXIP binding site in Skp2 promoter, we designed a series of primers of Skp2 promoter fragments in 5′-flanking region, including the fragments −776/−567, −640/−443 and −464/−250. Interestingly, ChIP assays showed that HBXIP was able to occupy the Skp2 promoter fragment −640/−443 (Fig. 6C), suggesting that the −640/−443 region of Skp2 promoter is the regulatory target sequence of HBXIP. Then, we used online promoter analysis tool Search Promoter Site (http://alggen.lsi.upc.es/cgibin/promo_v3/promo/promoinit.cgi?dir-DB=TF8.3) to predict the putative transcription factor binding sites in the −640/−443 promoter region of Skp2. Strikingly, we observed a putative Sp1 binding site in the region (Fig. 6D). ChIP/ReChIP assay showed that HBXIP and Sp1 were able to form a transcriptional complex on the Skp2 promoter (Fig. 6E). Luciferase reporter gene assays showed that HBXIP failed to work when the Sp1 binding site in Skp2 promoter was mutated (Fig. 6F and G). Thus, we conclude that HBXIP activates Skp2 promoter activity through the transcription factor Sp1.

Figure 6.

HBXIP activates Skp2 promoter via transcription factor Sp1. (A and B) SKOV3 (or CAOV3) cells were co-transfected with renilla luciferase plasmid containing Skp2 promoter and either pCMV or pCMV-HBXIP. Luciferase activity was determined 48 h after transfection. Statistically significant differences are indicated: *P<0.05, **P<0.01, ***P<0.001, Student’s t-test. (C) The interaction between HBXIP and promoter region of Skp2 was examined by ChIP assay. (D) The binding site region in Skp2 promoter. (E) ChIP/ReChIP analysis of HBXIP and Sp1 binding to the Skp2 promoter. (F and G) The promoter activities of Skp2 mediated by HBXIP were measured by luciferase reporter gene assay when the Sp1 binding site was mutated in SKOV3 (or CAOV3) cells. Statistically significant differences are indicated: *P<0.05, Student’s t-test.

Discussion

Our studies have showed that HBXIP is a novel oncoprotein. HBXIP was highly expressed in breast cancer tissues and metastatic lymph node tissues and significantly associated with the growth and metastasis of breast cancer cells (6,7,33). However, the expression and role of HBXIP in ovarian cancer cells is poorly understood. Many studies have shown that over-expression of Skp2 is observed in a variety of human cancers, including ovarian cancer, gastric cancer, colorectal cancer, prostate cancer, sarcoma, breast cancer, lung cancer, pancreatic cancer and other cancers (15,26). In addition, Skp2 has an established role in the migration of cancer cells. Therefore, we are interested in the effect of HBXIP on cell migration in ovarian cancer and the role Skp2 plays in the signaling pathway.

Latest study showed that HBXIP was a regulator components that is required for mTORC1 activation by amino acids (5). Cross-talk between mTOR pathway and Skp2 pathway has been reported recently. Shapira et al showed that repamycin, an mTOR inhibitor, could downregulate the expression of Skp2 in breast cancer (27). Shigemasa et al proved that Skp2 was expressed in nearly half of the 91 ovarian adenocarcinomas (23). In this study, we first observed that HBXIP is overexpressed in ovarian cancer tissues. We noted that the expression of HBXIP was significantly correlated with Skp2 in ovarian cancer tissues.

Skp2 overexpression has been correlated with tumor progression such as stage and survival in ovarian cancer and other human cancers (16), indicating that Skp2 may be important in cancer cell migration, invasion and metastasis. Previous reports showed that Skp2 deficiency displayed a defect in cell migration and metastasis, while Skp2 overexpression promoted cell migration and invasion (11,12). It has also been shown that acetylation of Skp2 enhanced cellular migration (13). Consistent with this notion, we found that Skp2 is responsible for the enhanced migration of ovarian cancer cells mediated by HBXIP.

We observed that HBXIP was able to upregulate the mRNA and protein levels of Skp2 in ovarian cancer cells. Next, we sought to elucidate the underlying mechanism by which HBXIP upregulates Skp2. We previously observed the nuclear localization of HBXIP in MCF-7 cells (6), we found a similar phenomenon in ovarian cancer tissues, implying that HBXIP may be involved in the transcriptional regulation of Skp2. Then, we predicted the putative transcription factor binding sites in the -640/-443 promoter region of Skp2. Strikingly, we found a Sp1 binding site in the region. Sp1 is a transcription factor that either enhance or repress the activity of promoters of genes involved in differentiation, cell cycle progression and oncogenesis (34). In comparison to normal tissues or cells, Sp1 level is greater in breast carcinomas, thyroid cancer, hepatocellular carcinomas, pancreatic cancer, colorectal cancer, gastric cancer and lung cancer (34–37). Sp1 is also overexpressed in ovarian cancer (38) and plays an important role in the process of cancer. We found that HBXIP was able to bind to the Skp2 promoter region through interacting with Sp1 by ChIP/ReChIP assays. We further demonstrated that HBXIP activated Skp2 promoter through the transcription factor Sp1. Thus, we report that the transcription factor Sp1 plays a role in regulating Skp2 mediated by HBXIP in ovarian cancer cells.

In summary, our finding indicates that HBXIP promotes the migration of ovarian cancer cells through upregulating Skp2, in which HBXIP activates the transcription of Skp2 through interaction with transcription factor Sp1. HBXIP may act as a co-activator of transcription factors to upregulate many genes in the development of cancer. Therefore, our finding provides new insight into the mechanism of HBXIP in promotion of migration of ovarian cancer cells.

Acknowledgements

This study was supported by grants from the National Basic Research Program of China (973 Program, nos. 2011CB512113 and 2009CB521702) and National Natural Science Foundation of China (nos. 81071623, 81071624 and 81272217).

References

1. 

Melegari M, Scaglioni PP and Wands JR: Cloning and characterization of a novel hepatitis B virus x binding protein that inhibits viral replication. J Virol. 72:1737–1743. 1998.PubMed/NCBI

2. 

Lok AS: Hepatitis B infection: pathogenesis and management. J Hepatol. 32:89–97. 2000. View Article : Google Scholar : PubMed/NCBI

3. 

Fujii R, Zhu C, Wen Y, Marusawa H, Bailly-Maitre B, Matsuzawa S, Zhang H, Kim Y, Bennett CF, Jiang W and Reed JC: HBXIP, cellular target of hepatitis B virus oncoprotein, is a regulator of centrosome dynamics and cytokinesis. Cancer Res. 66:9099–9107. 2006. View Article : Google Scholar : PubMed/NCBI

4. 

Wen Y, Golubkov VS, Strongin AY, Jiang W and Reed JC: Interaction of hepatitis B viral oncoprotein with cellular target HBXIP dysregulates centrosome dynamics and mitotic spindle formation. J Biol Chem. 283:2793–2803. 2008. View Article : Google Scholar : PubMed/NCBI

5. 

Bar-Peled L, Schweitzer LD, Zoncu R and Sabatini DM: Ragulator is a GEF for the Rag GTPases that signal amino acid levels to mTORC1. Cell. 150:1196–1208. 2012. View Article : Google Scholar : PubMed/NCBI

6. 

Liu S, Li L, Zhang Y, Zhang Y, Zhao Y, You X, Lin Z, Zhang X and Ye L: The oncoprotein HBXIP uses two pathways to up-regulate S100A4 in promotion of growth and migration of breast cancer cells. J Biol Chem. 287:30228–30239. 2012. View Article : Google Scholar : PubMed/NCBI

7. 

Hu N, Zhang J, Cui W, Kong G, Zhang S, Yue L, Bai X, Zhang Z, Zhang W, Zhang X and Ye L: miR-520b regulates migration of breast cancer cells by targeting hepatitis B X-interacting protein and interleukin-8. J Biol Chem. 286:13714–13722. 2011. View Article : Google Scholar : PubMed/NCBI

8. 

Zhang H, Kobayashi R, Galaktionov K and Beach D: p19Skp1 and p45Skp2 are essential elements of the cyclin A-CDK2 S phase kinase. Cell. 82:915–925. 1995. View Article : Google Scholar

9. 

Kurland JF and Tansey WP: Crashing waves of destruction: the cell cycle and APC(Cdh1) regulation of SCF(Skp2). Cancer Cell. 5:305–306. 2004. View Article : Google Scholar : PubMed/NCBI

10. 

Suzuki S, Fukasawa H, Misaki T, Togawa A, Ohashi N, Kitagawa K, Kotake Y, Liu N, Niida H, Nakayama K, Nakayama KI, Yamamoto T and Kitagawa M: The amelioration of renal damage in Skp2-deficient mice canceled by p27 Kip1 deficiency in Skp2−/−p27−/−mice. PLoS One. 7:e362492012.PubMed/NCBI

11. 

Lin HK, Wang G, Chen Z, Teruya-Feldstein J, Liu Y, Chan CH, Yang WL, Erdjument-Bromage H, Nakayama KI, Nimer S, Tempst P and Pandolfi PP: Phosphorylation-dependent regulation of cytosolic localization and oncogenic function of Skp2 by Akt/PKB. Nat Cell Biol. 11:420–432. 2009. View Article : Google Scholar : PubMed/NCBI

12. 

Chan CH, Lee SW, Li CF, Wang J, Yang WL, Wu CY, Wu J, Nakayama KI, Kang HY, Huang HY, Hung MC, Pandolfi PP and Lin HK: Deciphering the transcriptional complex critical for RhoA gene expression and cancer metastasis. Nat Cell Biol. 12:457–467. 2010. View Article : Google Scholar : PubMed/NCBI

13. 

Inuzuka H, Gao D, Finley LW, Yang W, Wan L, Fukushima H, Chin YR, Zhai B, Shaik S, Lau AW, Wang Z, Gygi SP, Nakayama K, Teruya-Feldstein J, Toker A, Haigis MC, Pandolfi PP and Wei W: Acetylation-dependent regulation of Skp2 function. Cell. 150:179–193. 2012. View Article : Google Scholar : PubMed/NCBI

14. 

Cardozo T and Pagano M: The SCF ubiquitin ligase: insights into a molecular machine. Nat Rev Mol Cell Biol. 5:739–751. 2004. View Article : Google Scholar : PubMed/NCBI

15. 

Bretones G, Acosta JC, Caraballo JM, Ferrándiz N, Gómez-Casares MT, Albajar M, Blanco R, Ruiz P, Hung WC, Albero MP, Perez-Roger I and León J: SKP2 oncogene is a direct MYC target gene and MYC down-regulates p27(KIP1) through SKP2 in human leukemia cells. J Biol Chem. 286:9815–9825. 2011. View Article : Google Scholar : PubMed/NCBI

16. 

Einama T, Kagata Y, Tsuda H, Morita D, Ogata S, Ueda S, Takigawa T, Kawarabayashi N, Fukatsu K, Sugiura Y, Matsubara O and Hatsuse K: High-level Skp2 expression in pancreatic ductal adenocarcinoma: correlation with the extent of lymph node metastasis, higher histological grade, and poorer patient outcome. Pancreas. 32:376–381. 2006. View Article : Google Scholar

17. 

Hung WC, Tseng WL, Shiea J and Chang HC: Skp2 overexpression increases the expression of MMP-2 and MMP-9 and invasion of lung cancer cells. Cancer Lett. 288:156–161. 2010. View Article : Google Scholar : PubMed/NCBI

18. 

Li CF, Wang JM, Kang HY, Huang CK, Wang JW, Fang FM, Wang YH, Wu WR, Li SH, Yu SC, Lee JC, Lan J, Shiue YL, Wu LC and Huang HY: Characterization of gene amplification-driven SKP2 overexpression in myxofibrosarcoma: potential implications in tumor progression and therapeutics. Clin Cancer Res. 18:1598–1610. 2012. View Article : Google Scholar : PubMed/NCBI

19. 

Lim MS, Adamson A, Lin Z, Perez-Ordonez B, Jordan RC, Tripp S, Perkins SL and Elenitoba-Johnson KS: Expression of Skp2, a p27(Kip1) ubiquitin ligase, in malignant lymphoma: correlation with p27(Kip1) and proliferation index. Blood. 100:2950–2956. 2002. View Article : Google Scholar : PubMed/NCBI

20. 

Lu M, Zhao Y, Xu F, Wang Y, Xiang J and Chen D: The expression and prognosis of FOXO3a and Skp2 in human ovarian cancer. Med Oncol. 29:3409–3415. 2012. View Article : Google Scholar : PubMed/NCBI

21. 

Masuda TA, Inoue H, Sonoda H, Mine S, Yoshikawa Y, Nakayama K, Nakayama K and Mori M: Clinical and biological significance of S-phase kinase-associated protein 2 (Skp2) gene expression in gastric carcinoma: modulation of malignant phenotype by Skp2 overexpression, possibly via p27 proteolysis. Cancer Res. 62:3819–3825. 2002.

22. 

Shapira M, Ben-Izhak O, Linn S, Futerman B, Minkov I and Hershko DD: The prognostic impact of the ubiquitin ligase subunits Skp2 and Cks1 in colorectal carcinoma. Cancer. 103:1336–1346. 2005. View Article : Google Scholar : PubMed/NCBI

23. 

Shigemasa K, Gu L, O’Brien TJ and Ohama K: Skp2 over-expression is a prognostic factor in patients with ovarian adenocarcinoma. Clin Cancer Res. 9:1756–1763. 2003.PubMed/NCBI

24. 

Sonoda H, Inoue H, Ogawa K, Utsunomiya T, Masuda TA and Mori M: Significance of skp2 expression in primary breast cancer. Clin Cancer Res. 12:1215–1220. 2006. View Article : Google Scholar : PubMed/NCBI

25. 

Traub F, Mengel M, Luck HJ, Kreipe HH and von Wasielewski R: Prognostic impact of Skp2 and p27 in human breast cancer. Breast Cancer Res Treat. 99:185–191. 2006. View Article : Google Scholar : PubMed/NCBI

26. 

Wang Z, Gao D, Fukushima H, Inuzuka H, Liu P, Wan L, Sarkar FH and Wei W: Skp2: a novel potential therapeutic target for prostate cancer. Biochim Biophys Acta. 1825:11–17. 2012.PubMed/NCBI

27. 

Shapira M, Kakiashvili E, Rosenberg T and Hershko DD: The mTOR inhibitor rapamycin down-regulates the expression of the ubiquitin ligase subunit Skp2 in breast cancer cells. Breast Cancer Res. 8:R462006. View Article : Google Scholar : PubMed/NCBI

28. 

Zhang X, Dong N, Yin L, Cai N, Ma H, You J, Zhang H, Wang H, He R and Ye L: Hepatitis B virus X protein upregulates survivin expression in hepatoma tissues. J Med Virol. 77:374–381. 2005. View Article : Google Scholar

29. 

Al-Alem L, Southard RC, Kilgore MW and Curry TE: Specific thiazolidinediones inhibit ovarian cancer cell line proliferation and cause cell cycle arrest in a PPARgamma independent manner. PLoS One. 6:e161792011. View Article : Google Scholar : PubMed/NCBI

30. 

Liang M, Liang YY, Wrighton K, Ungermannova D, Wang XP, Brunicardi FC, Liu X, Feng XH and Lin X: Ubiquitination and proteolysis of cancer-derived Smad4 mutants by SCFSkp2. Mol Cell Biol. 24:7524–7537. 2004. View Article : Google Scholar : PubMed/NCBI

31. 

Nelson JD, Denisenko O and Bomsztyk K: Protocol for the fast chromatin immunoprecipitation (ChIP) method. Nat Protoc. 1:179–185. 2006. View Article : Google Scholar

32. 

Hu D, Liu W, Wu G and Wan Y: Nuclear translocation of Skp2 facilitates its destruction in response to TGFbeta signaling. Cell Cycle. 10:285–292. 2011. View Article : Google Scholar : PubMed/NCBI

33. 

Wang FZ, Sha L, Ye LH and Zhang XD: Promotion of cell proliferation by HBXIP via upregulation of human telomerase reverse transcriptase in human mesenchymal stem cells. Acta Pharmacol Sin. 29:83–89. 2008. View Article : Google Scholar

34. 

Davie JR, He S, Li L, Sekhavat A, Espino P, Drobic B, Dunn KL, Sun JM, Chen HY, Yu J, Pritchard S and Wang X: Nuclear organization and chromatin dynamics - Sp1, Sp3 and histone deacetylases. Adv Enzyme Regul. 48:189–208. 2008. View Article : Google Scholar : PubMed/NCBI

35. 

Zheng Y, Ritzenthaler JD, Sun X, Roman J and Han S: Prostaglandin E2 stimulates human lung carcinoma cell growth through induction of integrin-linked kinase: the involvement of EP4 and Sp1. Cancer Res. 69:896–904. 2009. View Article : Google Scholar : PubMed/NCBI

36. 

Kong LM, Liao CG, Chen L, Yang HS, Zhang SH, Zhang Z, Bian HJ, Xing JL and Chen ZN: Promoter hypomethylation up-regulates CD147 expression through increasing Sp1 binding and associates with poor prognosis in human hepatocellular carcinoma. J Cell Mol Med. 15:1415–1428. 2011. View Article : Google Scholar : PubMed/NCBI

37. 

Chuang JY, Wu CH, Lai MD, Chang WC and Hung JJ: Overexpression of Sp1 leads to p53-dependent apoptosis in cancer cells. Int J Cancer. 125:2066–2076. 2009. View Article : Google Scholar : PubMed/NCBI

38. 

Previdi S, Malek A, Albertini V, Riva C, Capella C, Broggini M, Carbone GM, Rohr J and Catapano CV: Inhibition of Sp1-dependent transcription and antitumor activity of the new aureolic acid analogues mithramycin SDK and SK in human ovarian cancer xenografts. Gynecol Oncol. 118:182–188. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xu F, Zhu X, Han T, You X, Liu F, Ye L, Zhang X, Wang X and Yao Y: The oncoprotein hepatitis B X-interacting protein promotes the migration of ovarian cancer cells through the upregulation of S-phase kinase-associated protein 2 by Sp1. Int J Oncol 45: 255-263, 2014.
APA
Xu, F., Zhu, X., Han, T., You, X., Liu, F., Ye, L. ... Yao, Y. (2014). The oncoprotein hepatitis B X-interacting protein promotes the migration of ovarian cancer cells through the upregulation of S-phase kinase-associated protein 2 by Sp1. International Journal of Oncology, 45, 255-263. https://doi.org/10.3892/ijo.2014.2411
MLA
Xu, F., Zhu, X., Han, T., You, X., Liu, F., Ye, L., Zhang, X., Wang, X., Yao, Y."The oncoprotein hepatitis B X-interacting protein promotes the migration of ovarian cancer cells through the upregulation of S-phase kinase-associated protein 2 by Sp1". International Journal of Oncology 45.1 (2014): 255-263.
Chicago
Xu, F., Zhu, X., Han, T., You, X., Liu, F., Ye, L., Zhang, X., Wang, X., Yao, Y."The oncoprotein hepatitis B X-interacting protein promotes the migration of ovarian cancer cells through the upregulation of S-phase kinase-associated protein 2 by Sp1". International Journal of Oncology 45, no. 1 (2014): 255-263. https://doi.org/10.3892/ijo.2014.2411
Copy and paste a formatted citation
x
Spandidos Publications style
Xu F, Zhu X, Han T, You X, Liu F, Ye L, Zhang X, Wang X and Yao Y: The oncoprotein hepatitis B X-interacting protein promotes the migration of ovarian cancer cells through the upregulation of S-phase kinase-associated protein 2 by Sp1. Int J Oncol 45: 255-263, 2014.
APA
Xu, F., Zhu, X., Han, T., You, X., Liu, F., Ye, L. ... Yao, Y. (2014). The oncoprotein hepatitis B X-interacting protein promotes the migration of ovarian cancer cells through the upregulation of S-phase kinase-associated protein 2 by Sp1. International Journal of Oncology, 45, 255-263. https://doi.org/10.3892/ijo.2014.2411
MLA
Xu, F., Zhu, X., Han, T., You, X., Liu, F., Ye, L., Zhang, X., Wang, X., Yao, Y."The oncoprotein hepatitis B X-interacting protein promotes the migration of ovarian cancer cells through the upregulation of S-phase kinase-associated protein 2 by Sp1". International Journal of Oncology 45.1 (2014): 255-263.
Chicago
Xu, F., Zhu, X., Han, T., You, X., Liu, F., Ye, L., Zhang, X., Wang, X., Yao, Y."The oncoprotein hepatitis B X-interacting protein promotes the migration of ovarian cancer cells through the upregulation of S-phase kinase-associated protein 2 by Sp1". International Journal of Oncology 45, no. 1 (2014): 255-263. https://doi.org/10.3892/ijo.2014.2411
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team