Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
December-2014 Volume 45 Issue 6

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2014 Volume 45 Issue 6

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Methylation‑associated inactivation of LATS1 and its effect on demethylation or overexpression on YAP and cell biological function in human renal cell carcinoma

  • Authors:
    • Ke‑Hong Chen
    • Jiang He
    • De‑Lin Wang
    • Jian‑Jia Cao
    • Mei‑Cai Li
    • Xiu‑Min Zhao
    • Xia Sheng
    • Wen‑Bin Li
    • Wu‑Jiang Liu
  • View Affiliations / Copyright

    Affiliations: Department of Urology, The First Affiliated Hospital of Chongqing Medical University, Chongqing, P.R. China, Gastroenterology and Neurology Center, University‑Town Hospital of Chongqing Medical University, Chongqing, P.R. China, Institute of Urology, Peking University First Hospital, Beijing, P.R. China
  • Pages: 2511-2521
    |
    Published online on: September 30, 2014
       https://doi.org/10.3892/ijo.2014.2687
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Large tumor suppressor 1 (LATS1) gene is one of the key factors in Hippo signaling pathway. Inactivation of LATS1 by promoter methylation was found in colorectal cancer (CRC), head and neck squamous cell carcinoma (HNSCC), astrocytoma, breast cancer and it was proved to be a tumor suppressor. However, its role is unclear in renal cell carcinoma (RCC). In this study, the expression of LATS1 was determined by reverse transcription polymerase chain reaction (RT‑PCR) and immunohistochemistry in 30 pairs of RCC tissues and matched normal kidney tissues and RCC cells. We found that the expression of LATS1 was markedly reduced in RCC tissues and cells, in the RCC tissue in 46.7% (14/30), while in the normal kidney tissues in 76.7% (23/30), and was associated with pathological grade and clinical stage of RCC. We detected methylation status of LATS1 by bisulfite sequence‑PCR (BSP) in renal cancer cell line 786‑O which lowers expression of LATS1, and we found it hypermethy­lated (in 97.5%). In addition, pharmacological demethylation using 5‑Aza‑2'‑deoxycytidine (5‑Aza) restored the expression of LATS1 mRNA and protein in 786‑O cells, both LATS1 demethylation and overexpression of LATS1 downregulated the expression of Yes‑associated protein (YAP), inhibited cell proliferation, induced cell apoptosis and cell cycle G1 arrest in 786‑O cells. Thus, this report for the first time demonstrates the inactivation of LATS1 by promoter methy­lation and it is a tumor suppressor in kidney cancer. LATS1 may serve as a biomarker for possible early diagnosis and as a potential therapeutic target for human RCC.

Introduction

Renal cell carcinoma (RCC) has the highest fatality rate in urinary tract malignant tumors and accounts for 2–3% of all cancers worldwide, >102,000 RCC patients die annually of the malignancy, the main type of RCC is classified as clear cell renal cell carcinoma (ccRCC) (1,2). Due to RCC resistance to chemotherapy and radiotherapy, the mortality of patients with advanced RCC is very high. The localized RCC mainly relied on the surgical treatment, while therapy options of advanced RCC are very limited (3). Recent reports pointed out that the molecular target drugs (e.g., sunitinib, and sorafenib) were more effective in metastatic RCC (mRCC) and improved the survival rate of patients with mRCC, but the long-term effect of these drugs were limited to mRCC (4,5). The molecular characteristics of RCC are complex and its mechanism needs clarification (6).

Epigenetic alteration, especially aberrant hypermethylation of the promoter region within a CpG island is involved in silencing of transcription of classical tumor suppressor genes (TSGs) in cancers and it was considered to be one of the earliest and most frequent alterations in cancer (7), which had two main specific mechanisms: one is that DNA methylation may inhibit gene expression directly by blocking binding to DNA of factors required for optimal transcription (8). The other is that methylation affects gene expression directly by interfering with transcription factor binding, and/or indirectly by recruiting histone deacetylases through methyl-DNA-binding proteins (9), however, the gene methylation is reversible, unlike mutation or loss of heterozigosity (LOH). Therefore, we should search for novel TSGs by way of promoter CpG methylation so as to reveal the epigenetic mechanism of carcinogenesis and also identify potential tumor biomarkers for early detection of RCC (10). At present, many candidate TSGs silenced by DNA methylation modification also have been reported in RCC, such as RASSF1 (11), DLC1 (12), and LRRC3B (13).

The large tumor suppressor 1 (LATS1) gene has been identified as a TSG in Drosophila and encodes a putative serine/threonine kinase at the earliest time, which is a member of the nuclear Dbf2-related (NDR) family (14). LATS1 gene is located at chromosome 6q25.1 and its open reading frame is 3,393 bp encoding a 1130-amino acid polypeptide with molecular weight of 126.87 kDa, which is highly similar to LATS2 in structure and function (15). Recently LATS1 has been identified as a key factor of the Hippo signaling pathway that plays pivotal roles in various biological processes such as cell proliferation, genetic stability, cell migration, cell metastasis, tumorigenesis, organ size control, stem cell differentiation and renewal, drug resistance, spindle formation, actin polymerization of modulation (16–19). However, studies have shown that the expression of LATS1 was reduced or in deficient in a wide variety of tumors, including gliomas (15), cervical cancer (20), gastric cancer (21), skin cancer (22), and metastatic prostate cancer (23). LATS1 knockout mice spontaneously developed non-metastatic soft tissue sarcomas and metastatic ovarian stromal cell tumors (24). Therefore, LATS1 has been considered as a TSG, but its role in human cancer is unclear (25). Recently, LATS1 downregulated by promoter hypermethylation has been reported in various human tumors including colorectal cancer (CRC) (26), head and neck squamous cell carcinoma (HNSCC) (27), soft tissue sarcoma (28), astrocytoma (29), and breast cancer (30), which indicated that LATS1 promoter hypermethylation was related to tumorigenesis. Thus, LATS1 may be a potential target gene for cancer gene therapy. However, whether LATS1 is subjected to epigenetic silencing and its function in RCC is unclear.

In this study, we hypothesized that LATS1 is epigenetically downregulated and functions as a TSG in RCC. To test this point of view, we first dectected the expression of LATS1 in RCC tissues by immunohistochemistry and reverse transcription polymerase chain reaction (RT-PCR) and analyzed its relationship with the clinicopathologic characteristics of RCC, then selected 786-O cells with low expression of LATS1 mRNA, which promoter methylation was examined by bisulfite sequence-PCR (BSP), we subsequently investigated the effects of LATS1 gene demethylation and overexpression on the biological function and Yes-associated protein (YAP) in human RCC 786-O cells. The ultimate goal of this report is to determine whether LATS1 can be used as a potential target gene for RCC diagnosis and therapy.

Materials and methods

Patients and tissue specimens

The study was approved by the local Ethics Committees and informed written consent was obtained. Permission for the use of tissue, it was obtained from the First Affiliated Hospital of Chongqing Medical University from March to December 2012. Eligible patients were diagnosed to have clear cell carcinoma of the kidney by pathological methods. The total number of patients was 30, 15 male and 15 female, aged 36–77 with an average age of 63. We chose the RCC tissues and matched normal kidney tissues (4 cm away from the cancer tissues) undergone radical nephrectomy. Each specimen was divided into two equal parts, one was drawn into a Haoe frozen tube after being treated by diethylpyrocarbonate (DEPC) water, liquid nitrogen frozen condensate, cryopreserved at −80°C for RT-PCR experiments; the other was placed in 10% formalin solution for the immunohistochemistry experiment.

Immunohistochemisty

The tissues were fixed with 10% formaldehyde (ZSGB-BIO, Beijing, China) embedded in paraffin, sectioned into 4 μm thick slices and used for staining. In brief, anti-LATS1 (1:100) (Santa Cruz Biotechnology, Inc., Dallas, TX, USA) antibodies were applied to the paraffin section, after deparaffinization, antigen reconditioning and serum (Gibco-BRL, Carlsbad, CA, USA) was blocked. Then incubated in 37°C water bath for 2 h and the secondary antibody and streptomycin antibiotics-peroxidase was applied on the section. Visualization was performed using DAB chromogen. Sections were restained with hematoxylin (Shanghai BlueGene Biotech Co., Ltd., Shanghai, China), dehydrated, and mounted in neutral gum, and analyzed using a bright field microscope. The tissues were scored according to positive areas and staining intensity. The percentage of positive areas was graded as 0 (≤5%), 1 (6–25%), 2 (26–50%), 3 (≥51%), and the staining intensity was graded as 0–2 (i.e., 0, negative; 1, weak; 2, strong). The two grades were multiplied and tissues were assigned to one of three levels: 0 was negative, 1–4 was weak positive, 5–6 was strong positive.

Cell culture and 5-Aza

786-O and HEK-293 were purchased from American Type Culture Collection (ATCC) (Rockville, MD, USA), 786-O cells were maintained in RPMI-1640 containing 10% Gibco fetal bovine serum (FBS) (Gibco-BRL) with 1% antibiotics. HEK-293 cells were grown in DMEM/HG supplemented with FBS and antibiotics. All cells were maintained at 37°C in a humidified incubator with 5% CO2. Cells were treated with 5-Aza-2′-deoxycytidine (5-Aza) (Sigma-Aldrich, St. Louis, MO, USA) 1 μM for 4 days. Culture medium and 5-Aza were replaced daily.

RNA isolation and RT-PCR

Total RNA was isolated from RCC cells or tissues using RNAiso Plus (Takara Bio, Inc., Osaka, Japan). The total RNA quality was detected by UV spectrophotometer (Bio-Rad, Hercules, CA, USA), 1 μg RNA was reverse to synthesis the single-stranded cDNA using PrimeScript RT reagent kit and then amplified with Premix Taq Q3 2.0 kit (both from Takara Bio, Inc.) according to the manufacturer’s instructions. The primers used are as follows. LATS1 forward, 5′-CCACCCTACCCAAAACATCTG-3′ and reverse, 5′-CGC TGCTGATGAGATTTGAGTAC-3′; YAP forward, 5′-TGA ACAAACGTCCAGCAAGATAC-3′ and reverse, 5′-CAGCCC CCAAAATGAACAGTAG-3′. GAPDH was used as internal control. GAPDH forward, 5′-ACCACCATGGAGAAGGC TGG-3′ and reverse, 5′-CTCAGTGTAGCCCAGGATGC-3′. PCR conditions were as follows: 94°C for 5 min, followed by 30 cycles of 94°C for 30 sec, 56°C for 60 sec, and 72°C for 60 sec. The PCR products were run on a 2% agarose gel. The relative expressions of LATS1 and YAP were quantitatively measured using densitometry by Quantity One software (Bio-Rad).

Western blot analysis

Cells were scraped and lysates were prepared in 80 μl of radioimmunoprecipitation assay (RIPA) lysis buffer containing 1% phenylmethanesulfonyl fluoride (PMSF), and protein concentration was determined by protein quantitated kit (all from Beyotime, Shanghai, China). After mixing with loading buffer and denaturalizing by boiling for 10 min, 50 μg of protein was loaded and separated on 6% (for LATS1) or 10% (for YAP and β-actin) sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) at 80 V. The proteins were transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA) at 250 mA. The membranes were blocked by 5% non-fat dry milk in TBS containing 0.05% Tween-20 (TBST) for 2 h at room temperature, primary antibodies against LATS1 (Santa Cruz Biotechnology, Inc.) at 1:150, YAP (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) at 1:200, and β-actin (Beyotime) at 1:500 were applied overnight at 4°C, membranes were washed with TBST, and then incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (Bioworld Technology Co., Ltd., Jiangsu, China) for 1 h at 37°C. The proteins of interest were visualized with the enhanced ECL detection system (Beyotime). The densitometry of band was quantified by Quantity One software (Bio-Rad).

BSP

Cells were collected and washed with PBS. BSPs were carried out as described previously (31), DNA was extracted from the cells using TIANamp Genomic DNA kit [Tiangen Biotech (Beijing) Co., Ltd., Beijing, China] according to the manufacturer’s protocol, bisulfite-treated DNA was PCR amplified using primers BSP forward, 5′-AGAAGAAAGTTT TGGATTTATTAAAT-3′ and reverse, 5′-CATTTATAAATT AACTTCTAAAATAC-3′. The PCR products were electrophoresed and purified using Spin-X tubes, and then cloned into the pUC-T vector (both from CWbiotech, Beijing, China), with 10 colonies randomly chosen and sequenced.

Lentiviral vectors and infection

To overexpress LATS1 in 786-O cells, LATS1-expressing lentiviruses were generated using the GV218 system (Shanghai GeneChem Co., Shanghai, China) containing the full-length coding region (from GAGGAT CCCCGGGTACCGGTCGCCACCATGAAGAGGAGTGAA AAGCCAGAAGG to TCACCATGGTGGCGACCGGAA CATATACTAGATCGCGATTTTTAATC) of LATS1. The recombinant virus was purified, and titrated by qPCR, and its infectivity was detected after transduction at increasing multiplicity of infection (MOI). The experiment was divided into three groups: control group, mock virus and lentiviral-LATS1.

Flow cytometry analysis (FCM)

To evaluate the cell apoptosis and cell cycle, the cells were digested and adjusted in density of 1×106/ml, washed two times with PBS and add 1 ml PBS to beat it after centrifugal, cells were stained with Annexin V-FITC (Nanjing KeyGen Biotech Co., Ltd., Nanjing, China) and propidium iodide (PI) (BD Biosciences, Shanghai, China) for 30 min at room temperature and determined by FCM (Becton-Dickinson, Franklin Lakes, NJ, USA) to detect the cell apoptosis. According to the aforementioned method, the cells were centrifugated, fixed with 70% ethanol, and incubated for 10 min with 2 mg/ml RNase (Sigma-Aldrich), the cellular DNA was then stained with 50 ng/ml PI for 30 min at room temperature in darkness, and the cell cycle was analyzed by FCM.

Cell counting kit-8 (CCK-8)

The cells were seeded in 96-well plates. After demethylation or infection, the cell proliferation was determined by using a CCK-8 (Nanjing KeyGen Biotech Co., Ltd.) following manufacturer’s instructions. The optical density (OD) was measured with a microplate reader (SpectraMax M2; Molecular Devices, Sunnyvale, CA, USA) at 450 nm wavelength, then the cell proliferation inhibition rate (IR) was calculated.

Statistical analysis

Statistical analyses were performed with SPSS, version 19.0 (SPSS, Inc., Chicago, IL, USA). Data are shown as mean values ± standard deviation (SD). Differences between the two independent groups were analyzed by the Student’s t-test. The χ2 test was used to calculate differences in the patients’ age, gender, tumor stage, clinical stage and pathological grade. P<0.05 was considered significant.

Results

Expression of LATS1 in RCC tissues and cell lines

We examined the expression of LATS1 in 30 pairs of RCC tissues and matched normal kidney tissues by RT-PCR and immunohistochemistry. RT-PCR results (Fig. 1A) showed that the expression of LATS1 mRNA was significantly decreased (P<0.05) in RCC tissues, while the expression of LATS1 mRNA in normal kidney tissues was increased.

Figure 1

Expression of large tumor suppressor 1 (LATS1) in renal cell carcinoma (RCC) tissues and cells. (A) Expression of LATS1 mRNA in random RCC tissues and normal kidney tissues. T, RCC tissues; N, normal kidney tissues. (B) The expression of LATS1 protein in RCC tissues and normal kidney tissues by immunohistochemistry (x400). (C) Expression of LATS1 and Yes-associated protein (YAP) mRNA in 786-O and HEK-293 cells.

We examined the expression of LATS1 mRNA in 786-O and HEK-293 cell line by RT-PCR. As shown in Fig. 1C, compared with HEK-293, the expression of LATS1 mRNA was significantly decreased (P<0.05) in 786-O.

Immunohistochemistry revealed that the expression rate of LATS1 in the RCC tissue was 46.7% (14/30) and negative or weakly positive, while the expression rate of LATS1 in the normal kidney tissues was 76.7% (23/30) and strongly positive (Fig. 1B). LATS1 mainly accumulated in cytoplasm of kidney tubules and presented as brown-yellow or brown particles.

LATS1 expression is related with clinicopathologic characteristics of RCC

The relationships between LATS1 expression with the clinicopathologic characteristics in RCC was analyzed. We did not find a significant correlation of the expression of LATS1 with patients’ gender, age, tumor size and renal vein metastasis in RCC (P>0.05). However, we observed that the expression of LATS1 was related to the clinical stage and pathological grade in RCC (Table I).

Table I

The correlation of LATS1 protein expression with clinicopathologic characteristics in RCC (χ2 test).

Table I

The correlation of LATS1 protein expression with clinicopathologic characteristics in RCC (χ2 test).

LATS1 expression

GroupNo.(+)(−)Positive (%)P
Gender0.464
 Male156940
 Female158753.3
Age (years)0.232
 <601810855.6
 ≥60124833.3
Renal vein metastasis0.171
 Yes2020
 No28141450
Size of RCC (cm)0.295
 >585362.5
 ≤52291340.9
Pathological grading0.024
 Well86275
 Moderate137653.8
 Poor91811.1
Clinical staging0.024
 I–II1711664.7
 III–IV1331023.1

[i] LATS1, large tumor suppressor 1; RCC, renal cell carcinoma.

Methylation status of the LATS1 promoter region

The LATS1 CpG island is located in chromosome 5′ UTR of 6q24–25 (32). We selected 786-O with low expression of LATS1 mRNA, and the methylation status at eight CpG sites of the LATS1 CpG islands from −600 to 500 bp was characterized by BSP. This analysis indicated that the CpG islands were densely methylated in 786-O cells. The methylation rate accounted for 97.5% (Fig. 2).

Figure 2

The large tumor suppressor 1 (LATS1) promoter methylation status was detected by bisulfite sequence-PCR (BSP). (A) Monoclonal bacterial colony was detected by PCR. M, Marker; 1 to 16 represent 16 clones, positive clones were located in 500 bp. (B) Use BSP primer to amplify LATS1. M, Marker; Lane 1, 786-O cell line. (C) The 1–10 represent 10 positive clones, A–H represent eight CpG islands, each row of circles represents an individual CpG site in LATS1 by BSP; filled circle, methylated; empty circle, unmethylated. (D) Representative sequencing data of LATS1 CpG methylation. Boxes in the figure represent LATS1 promoter regions from −600 to 500 bp in eight CpG islands.

Restoration of LATS1 expression and downregulation of YAP expression by treatment with 5-Aza demethylation

To test whether methylation directly induced LATS1 silencing, we demethylated the LATS1 gene in 786-O cells and HEK-293 cells with 5-Aza, an inhibitor of DNA methyltransferases (DNMTs). As shown in Fig. 3, after treating with 1 μM 5-Aza for 96 h, the mRNA and protein of LATS1 were restored, while the mRNA and protein of YAP were downregulated in 786-O cells, but, there was no obvious change in HEK-293 cells. These results indicate that methylation directly mediates the transcriptional silencing of LATS1 in RCC.

Figure 3

The expression of large tumor suppressor 1 (LATS1) and Yes-associated protein (YAP) after pharmacological demethylation using 5-Aza-2′-deoxycytidine (5-Aza) for each group. (A) The expression of LATS1 and YAP mRNA were detected by reverse transcription polymerase chain reaction (RT-PCR). (B) The expression of LATS1 and YAP protein were detected by western blot analysis. Lane 1, 786-O cells in control group; lane 2, 786-O cells treated with 1 μM 5-Aza group; lane 3, HEK-293 cells in control group; lane 4, HEK-293 cells treated with 1 μM 5-Aza group.

Biological function is affected by LATS1 demethylation with 5-Aza

To investigate the effects of LATS1 gene demethylation on the biological function in human RCC cell line 786-O. According to the above, in the treatment of cells with 1 μM 5-Aza for 96 h, the FCM revealed that the apoptosis rate of 786-O cells in experiment group (27.73±2.85)% was significantly higher than that of control group (7.54±1.71)% (P<0.05), while the apoptosis rate of HEK-293 had no obvious difference in the experiment group (16.16±0.94)% from its control (15.77±0.98)% (P>0.05). This result showed that demethylation of LATS1 induced apoptosis of 786-O cells (Fig. 4A).

Figure 4

The biological function was detected by flow cytometry analysis (FCM) and cell counting kit-8 (CCK-8) after pharmacological demethylation using 5-Aza-2′-deoxycytidine (5-Aza) to deal with each group. (A) The apoptosis was detected by FCM. (B) The cell cycle was also detected by FCM. (C) The cell proliferation was detected by CCK-8. Cell growth curves were delineated and inhibition rate (IR) of cell proliferation was calculated by measuring absorbance at 450 nm, aP<0.05.

In order to ascertain the cell cycle, the FCM showed that G1 stage (82.12±3.01)% of 786-O cells in experiment group was significantly higher than that of control group (57.43±1.13)% (P<0.05), while G1 stage (61.14±1.05)% of HEK-293 cells in experiment group had no obvious difference from its control group (60.35±0.94)% (P>0.05). These results indicate that demethylation of LATS1 induced 786-O cell cycle to arrest in G1 stage (Fig. 4B).

To investigate cell proliferation, CCK-8 showed that the OD value (1.16±0.01) of 786-O cells in the experimental group was obviously lower than that of the control group (1.98±0.01) (P<0.05) after treatment with 1 μM 5-Aza for 96 h. The cell proliferation IR was 32, 46, 45, and 41%, respectively, after 24, 48, 72, and 96 h of LATS1 demethylation, while the HEK-293 cells were not obviously inhibited. This result indicated that cell proliferation was markedly inhibited by LATS1 demethylation with 5-Aza in 786-O cells (Fig. 4C).

Lentiviral vectors mediated LATS1 overexpression and downregulated YAP

To test the effect of LATS1 on YAP in RCC cells, 786-O cells were infected with lentiviral-LATS1 (Shanghai GeneChem Co.) at MOI 60 for each viral vector after 96 h. Proportion of infected 786-O cells was detected by FCM. Results showed that the transfection efficiency in control group, mock virus group and lentiviral-LATS1 group was 0.06, 95.96 and 81.69% (Fig. 5A), respectively. Expression of green fluorescent protein (GFP) after transfection was detected by fluorescence microscopy (Fig. 5B). The expression of LATS1 and YAP was detected at both mRNA and protein levels by RT-PCR and western blot analysis (Fig. 6). Compared with control group and mock virus group, the data show that the expression of LATS1 mRNA and protein in lentiviral-LATS1 group was dramatically increased (P<0.05), but the expression of YAP mRNA and protein was clearly decreased (P<0.05).

Figure 5

Expression of green fluorescent protein (GFP) in 786-O cells. (A) The transfection efficiency was assayed by flow cytometry analysis (FCM). M1, untransfected 786-O cells; M2, transfected 786-O cells. Control group represents untransfected 786-O cells; Mock virus group represents the empty vector transfected 786-O cells; Transfection efficiency was 95.96% (M2); Lentiviral-large tumor suppressor 1 (LATS1) group represents lentiviral-LATS1 transfected 786-O cells. Transfection efficiency was 81.69% (M2). (B) Expression of GFP after transfection was detected by fluorescence microscopy. a1, untransfected 786-O cells under optical microscope; a2, untransfected 786-O cells under fluorescence microscope; a3, the overlap figure of a1 and a2; b1, the empty vector transfected 786-O cells under optical microscope; b2, the empty vector transfected 786-O cells under fluorescence microscope; b3, the overlap figure of b1 and b2; c1, 786-O cells transfected with lentiviral-LATS1 under optical microscope; c2, 786-O cells transfected with lentiviral-LATS1 under fluorescence microscope; c3, the overlap figure of c1 and c2.

Figure 6

The expression of large tumor suppressor 1 (LATS1) and Yes-associated protein (YAP) in 786-O cells transfected with lentiviral-LATS1. (A) The expression of LATS1 and YAP mRNA in 786-O cells was detected by reverse transcription polymerase chain reaction (RT-PCR). (B) The expression of LATS1 and YAP protein in 786-O cells was detected by western blot analysis. Lane 1, control group; lane 2, mock virus group; lane 3, lentiviral-LATS1 group.

Effect of LATS1 overexpression on biological function

To test the functions of LATS1 in RCC cell 786-O, apoptosis in 786-O cells transduced by lentiviral-LATS1 after 96 h was determined by FCM (Fig. 7A), the percentage of apoptotic cells in the groups was: control group (8.40±1.11)%, mock virus (8.12±1.01)%, lentiviral-LATS1 (22.76±1.09)%. Based on our data, it suggested that 786-O cells transduced by lentiviral-LATS1 induced cell apoptosis.

Figure 7

The biological function was evaluated by flow cytometry analysis (FCM) and cell counting kit-8 (CCK-8) after transfection with lentiviral-large tumor suppressor 1 (LATS1). (A) Effects of lentiviral-LATS1 on apoptosis in 786-O cells by FCM. (B) Effects of lentiviral-LATS1 on the cell cycle in 786-O cells by FCM. (C) The cell proliferation was detected by CCK-8. Cell growth curves were delineated and the inhibition rate of cell proliferation was calculated by measuring absorbance at 450 nm, aP<0.05.

To investigate the effect of LATS1-mediation on the RCC cell cycle, the transfected 786-O cells were assayed by FCM. The results showed increasing numbers of cells arrested in G1 stage. The frequency of cells in G1 was (58.20±1.27)% in the control group, (58.12±1.06)% in mock virus group, and (79.06±1.43)% in the lentiviral-LATS1 group. These results suggested LATS1 caused G1 stage arrest (P<0.05) (Fig. 7B).

We used the CCK-8 assay to determine the cell proliferation of 786-O cells which were transduced by lentiviral-LATS1. During the first 3 days, we found the OD value had no significant difference (P>0.05) in the three groups, but starting from the fourth day, the lentiviral-LATS1 group (1.512±0.019) was strikingly lower than the control group (1.808±0.02) (P<0.05) and mock virus group (1.763±0.014) (P<0.05), and the cell proliferation IR was 4.71, 5.43, 3.70, 16.37, and 22.85%, respectively, after transfecting cell for 24, 48, 72, 96, and 120 h by lentiviral-LATS1, but the mock virus group and control group were not obviously inhibited. The results presented in Fig. 7C show that cell proliferation was markedly inhibited by the LATS1 gene.

Discussion

The Hippo signaling pathway has been shown to be involved in tumorigenesis, and the core components of this pathway include MST1/2, WW45, LATS1/2, MOB1, and YAP, and they interact with each other (33). In mammals, when the pathway is activated by cell-cell contact or high cell density (34), a core kinase cascade causes a series of reactions (25), MST1/2 kinase interacts with and phosphorylates WW45, an adaptor protein. Together, this complex phosphorylates and activates LATS1/2, which, together with its co-factor MOB1, phosphorylates YAP. Once phosphorylated, YAP is sequestered or degraded in the cytoplasm, which inhibits the expression of proliferation related genes cyclin D1 and cyclin E (35). If any one of the core components mentioned above changes, it will lead to the unlimited growth in tissues and organs, and eventually trigger tumors. Recent research shows, that Hippo signaling pathway, in addition to the core components found above, can interact with KIBRA (36) and FRMD6 (37). Although these factors may belong to the Hippo signaling pathway, how LATS1 is negatively regulated is largely unknown. Research over the past decades has revealed that LATS1 is a central part of a complex signal transduction cascade in multicellular eukaryotes (38) and a regulator in cellular homeostasis (39). Absence of LATS1 would lead to the formation of a variety of cancers, including gliomas (15), cervical cancer (20), gastric cancer (21), skin cancer (22), metastatic prostate cancer (23), ovarian stromal cell tumors (24). However, the expression of LATS1 in RCC is unclear.

In this study, we first demonstrated that LATS1 was silenced in RCC tissues and found LATS1 mainly accumulated in cytoplasm of kidney tubules by immunohistochemistry. This suggested RCC is likely to begin in the renal tubules. Furthermore, the expression of LATS1 protein was related with clinicopathologic characteristics of RCC, and the expression of LATS1 was related to the tumor clinical stage and pathological grade. We subsequently measured the expression of LATS1 mRNA in human RCC tissues and matched normal kidney tissues, and found that the expression of LATS1 mRNA was significantly decreased in RCC tissues. We further validated the downregulation of LATS1 mRNA in RCC cells by RT-PCR. The results suggested that the decreased expression of LATS1 contributes to RCC progression and may play a role of TSG in tumorigenesis of RCC.

Though studies have shown that LATS1 inactivation was caused by other mechanisms, including LATS1 regulated by ubiquitination regulatory factors (40), integrin-linked kinase (ILK) (41), protease-activated receptors (PARs) (42), G protein-coupled receptor (GPCR) signaling pathway (43), LATS1 was supposed to be inactivated in three major mechanisms: LOH, gene mutations, and hypermethylation of its promoter region (32). Despite the relatively high frequency of LOH at the locus containing LATS1 reported in breast cancers (44,45), only one specimen with reduced LATS1 expression was demonstrated with an allelic LOH and somatic mutation of LATS1 was not detected in 25 breast cancers by RT-PCR-SSCP (46). Takahashi et al (30) reported that methylation frequency of LATS1 was 56.7% in breast cancer, which indicated that hypermethylation of the promoter regions of LATS1 is likely to play an important role in the downregulation of mRNA levels in breast cancers. These results showed LATS1 was unlikely to be inactivated in such a classic way as a combination of LOH and somatic mutation, but was more likely to be induced by hypermethylation. Therefore, we selected the 786-O cells which decreased LATS1, and analyzed promoter methylation of LATS1 at eight CpG sites from −600 to 500 bp by BSP. We found its promoter was densely methylated, the methylation rate accounted for 97.5%. Other similar results were also reported, Wierzbicki et al (26) found that the promoter regions of LATS1 was hypermethylated as high as 57% in 44 CRCs, and they concluded that decreased expression of LATS1 in CRC was associated with promoter hypermethylation, but not microsatellite instability (MSI) status. Steinmann et al (27) analyzed the promoter methylation of LATS1 in 54 HNSCC specimens, and found that its hypermethylation accounted for 24%, and that a trend of increased LATS1 methylation in more advanced tumor stages and less differentiated HNSCC was observed. Jiang et al (29) found that the promoter of LATS1 was hypermethylated as high as 63.66% in 88 astrocytomas, indicating that LATS1 may be a useful target for astrocytoma therapy. However, the above studies only reported LATS1 methylation in tumors, did not investigate how LATS1 demethylation affected tumor cells. Therefore, we used 1 μM 5-Aza to process 786-O cells for 4 days, and we found LATS1 demethylation could restore its expression and downregulate YAP. It demonstrated that the inactivation of LATS1 was not caused by a genetic alteration, such as mutation, but by a reversible epigenetic mechanism.

We explored the effect of LATS1 overexpression on YAP in 786-O cells. 786-O cells were infected with lentiviral-LATS1 at MOI 60 after 96 h, and the transfection efficiency was 81.69% by FCM. GFP expression in 786-O cells was high and the exogenous expression of LATS1 strongly downregulated YAP. Its proposed mechanism may be that YAP was phosphorylated at S127 by LATS1 and likely directly interacted by YAP WW domain and LATS1 PPXY motif to activate YAP HXRXXS motif to phosphorylate, which results in YAP binding to 14-3-3 protein and cytoplasmic sequestration (47), YAP might be also phosphorylated by LATS1 kinases at S381, which caused casein kinase 1 (CK1) phosphorylation in succession and recruited ubiquitin factors E3 to degrade YAP in the cytoplasm (48).

The dynamic balance between cell proliferation and apoptosis maintains the normal size of the tissues and organs and the homeostasis of the organisms. However, tumorigenesis which is often related to cell apoptosis is restrained (49). We measured effect of LATS1 overexpression and demethylation on cell apoptosis and proliferation. The results showed the percentage of apoptotic cells in lentiviral-LATS1 groups was higher than other groups and the cell proliferation was inhibited clearly in a time-dependent manner by lentiviral-LATS1. We also found the apoptosis rate of 786-O cells in experiment group was significantly higher than that of control group, and the 786-O cells proliferation was obviously inhibited with 1 μM 5-Aza treatment for 96 h, our data for the first time suggested LATS1 overexpression and demethylation obviously induced cell apoptosis and inhibited proliferation in 786-O cells. The mechanism may be through the upregulating pro-apoptosis protein p53 and Bax (50) or enhancing the stability of p53 (51) to induce cell apoptosis and inhibit proliferation.

Regulation of cell cycle is a refined biological process and depends on a series of cell engine molecules which form a complex molecular signal network system, but any one of the molecules or signals which is abnormal will result in disorder of cell cycle regulation and lead to tumorigenesis. LATS1 is a member of the subfamily of protein kinases including Dbf2, Orb6, Cot-1, NDR, and Kpm, which are involved in cell cycle regulation (52), so we investigated the cell cycle by FCM, and found that exogenous expression of LATS1 and demethylation strongly induced cell cycle arrested in G1 stage. Consistent with our notion, Li et al (53) found 3,3′-diindolylmethane (DIM) was able to upregulate expression of LATS1 and induce cell arrest in G1 stage in human gastric cancer cell lines (SNU-1 and SNU-484). Its mechanism is probably that the DIM through MST1/2-LATS1-MOB1 complex promotes an active Hippo signaling pathway and favors YAP phosphorylation. Our studies were different from these research results. Yang et al (50) and Xia et al (54) reported that overexpression of LATS1 caused G2/M arrest through the inhibition of CDC2 kinase activity in breast cancer cells. Its potential reason may derive from the fact that cell cycle was detected in different tumor cells selected or in different microenvironments of tumor cells.

In conclusion, our research strongly indicates that LATS1 is a TSG in RCC and associated with tumor clinical stage and pathological grade. We are the first to report on that LATS1 is silenced at least in part through promoter hypermethylation in RCC cells. Demethylation of LATS1 promoter by 5-Aza was able to restore the expression by itself, to downregulate YAP, inhibit cell proliferation, induce cell apoptosis and cell cycle arrest in G1 stage. Moreover, overexpression of LATS1 by lentivirus mediation was also able to downregulate YAP, inhibit cell proliferation, induce cell apoptosis and cell cycle arrest in G1 stage. Thus, it would be worth further investigating the possible use of LATS1 methylation as a target for future molecular therapy and diagnosis.

Acknowledgements

This study was supported by the National Natural Science Foundation of P.R. China (30972999) and Science and Project of Chongqing Municipal Health Bureau (2013-2-082).

References

1 

Junker K, Ficarra V, Kwon ED, Leibovich BC, Thompson RH and Oosterwijk E: Potential role of genetic markers in the management of kidney cancer. Eur Urol. 63:333–340. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Siegel R, Ward E, Brawley O and Jemal A: Cancer statistics, 2011: the impact of eliminating socioeconomic and racial disparities on premature cancer deaths. CA Cancer J Clin. 61:212–236. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Linehan WM and Rathmell WK: Kidney cancer. Urol Oncol. 30:948–951. 2012. View Article : Google Scholar

4 

Motzer RJ, Hutson TE, Tomczak P, et al: Overall survival and updated results for sunitinib compared with interferon alfa in patients with metastatic renal cell carcinoma. J Clin Oncol. 27:3584–3590. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Escudier B, Eisen T, Stadler WM, et al: Sorafenib in advanced clear-cell renal-cell carcinoma. New Engl J Med. 356:125–134. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Cancer Genome Atlas Research Network. Comprehensive molecular characterization of clear cell renal cell carcinoma. Nature. 499:43–49. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Ricketts CJ, Morris MR, Gentle D, et al: Genome-wide CpG island methylation analysis implicates novel genes in the pathogenesis of renal cell carcinoma. Epigenetics. 7:278–290. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Watt F and Molloy PL: Cytosine methylation prevents binding to DNA of a HeLa cell transcription factor required for optimal expression of the adenovirus major late promote. Genes Dev. 2:1136–1143. 1988. View Article : Google Scholar

9 

Zhu WG, Srinivasan K, Dai Z, et al: Methylator of adjacent CpG sites affects Sp1/Sp3 binding and activity in the p21(Cip1) promoter. Mol Cell Biol. 23:4056–4065. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Morris MR, Ricketts C, Gentle D, et al: Identification of candidate tumour suppressor genes frequently methylated in renal cell carcinoma. Oncogene. 29:2104–2117. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Reu FJ, Leaman DW, Maitra RR, et al: Expression of RASSF1A, an epigenetically silenced tumor suppressor, overcomes resistance to apoptosis induction by interferons. Cancer Res. 66:2785–2793. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Zhang Q, Ying J, Zhang K, et al: Aberrant methylation of the 8p22 tumor suppressor gene DLC1 in renal cell carcinoma. Cancer Lett. 249:220–226. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Kondratov AG, Stoliar LA, Kvasha SM, et al: Methylation pattern of the putative tumor-suppressor gene LRRC3B promoter in clear cell renal cell carcinomas. Mol Med Rep. 5:509–512. 2012.PubMed/NCBI

14 

Justice RW, Zilian O, Woods DF, Noll M and Bryant PJ: The Drosophila tumor suppressor gene warts encodes a homolog of human myotonic dystrophy kinase and is required for the control of cell shape and proliferation. Genes Dev. 9:534–546. 1995.

15 

Ji T, Liu D, Shao W, Yang W, Wu H and Bian X: Decreased expression of LATS1 is correlated with the progression and prognosis of glioma. J Exp Clin Cancer Res. 31:672012. View Article : Google Scholar : PubMed/NCBI

16 

Zhao B, Tumaneng K and Guan KL: The Hippo pathway in organ size control, tissue regeneration and stem cell self-renewal. Nat Cell Biol. 13:877–883. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Yu T, Bachman J and Lai ZC: Evidence for a tumor suppressor role for the large tumor suppressor genes LATS1 and LATS2 in human cancer. Genetics. 195:1193–1196. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Visser-Grieve S, Zhou Z, She YM, Huang H, Cyr TD, Xu T and Yang X: LATS1 tumor suppressor is a novel actin-binding protein and negative regulator of actin polymerization. Cell Res. 21:1513–1516. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Yabuta N, Mukai S, Okamoto A, et al: N-terminal truncation of Lats1 causes abnormal cell growth control and chromosomal instability. J Cell Sci. 126:508–520. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Visser S and Yang X: Identification of LATS transcriptional targets in HeLa cells using whole human genome oligonucleotide microarray. Gene. 449:22–29. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Zhou GX, Li XY, Zhang Q, et al: Effects of the hippo signaling pathway in human gastric cancer. Asian Pac J Cancer Prev. 14:5199–5205. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Nishio M, Hamada K, Kawahara K, et al: Cancer susceptibility and embryonic lethality in Mob1a/1b double-mutant mice. J Clin Invest. 122:4505–4518. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Zhao B, Li L, Wang L, Wang CY, Yu J and Guan KL: Cell detachment activates the Hippo pathway via cytoskeleton re organization to induce anoikis. Genes Dev. 26:54–68. 2012. View Article : Google Scholar : PubMed/NCBI

24 

St John MA, Tao W, Fei X, et al: Mice deficient of Lats1 develop soft-tissue sarcomas, ovarian tumours and pituitary dysfunction. Nat Genet. 21:182–186. 1999.PubMed/NCBI

25 

Yu FX and Guan KL: The Hippo pathway: regulators and regulations. Genes Dev. 27:355–371. 2013. View Article : Google Scholar : PubMed/NCBI

26 

Wierzbicki PM, Adrych K, Kartanowicz D, et al: Underexpression of LATS1 TSG in colorectal cancer is associated with promoter hypermethylation. World J Gastroenterol. 19:4363–4373. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Steinmann K, Sandner A, Schagdarsurengin U and Dammann RH: Frequent promoter hypermethylation of tumor-related genes in head and neck squamous cell carcinoma. Oncol Rep. 22:1519–1526. 2009.PubMed/NCBI

28 

Seidel C, Schagdarsurengin U, Blümke K, et al: Frequent hypermethylation of MST1 and MST2 in soft tissue sarcoma. Mol Carcinog. 46:865–871. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Jiang Z, Li X, Hu J, Zhou W, Jiang Y, Li G and Lu D: Promoter hypermethylation-mediated down-regulation of LATS1 and LATS2 in human astrocytoma. Neurosci Res. 56:450–458. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Takahashi Y, Miyoshi Y, Takahata C, Irahara N, Taguchi T, Tamaki Y and Noguchi S: Down-regulation of LATS1 and LATS2 mRNA expression by promoter hypermethylation and its association with biologically aggressive phenotype in human breast cancers. Clin Cancer Res. 11:1380–1385. 2005. View Article : Google Scholar : PubMed/NCBI

31 

Tao Q, Huang H, Geiman TM, Lim CY, Fu L, Qiu GH and Robertson KD: Defective de novo methylation of viral and cellular DNA sequences in ICF syndrome cells. Hum Mol Genet. 11:2091–2102. 2002. View Article : Google Scholar : PubMed/NCBI

32 

Hisaoka M, Tanaka A and Hashimoto H: Molecular alterations of h-warts/LATS1 tumor suppressor in human soft tissue sarcoma. Lab Invest. 82:1427–1435. 2002. View Article : Google Scholar : PubMed/NCBI

33 

Nishio M, Otsubo K, Maehama T, Mimori K and Suzuki A: Capturing the mammalian Hippo: elucidating its role in cancer. Cancer Sci. 104:1271–1277. 2013. View Article : Google Scholar : PubMed/NCBI

34 

Bao Y, Hata Y, Ikeda M and Withanage K: Mammalian Hippo pathway: from development to cancer and beyond. J Biochem. 149:361–379. 2011. View Article : Google Scholar : PubMed/NCBI

35 

Schlegelmilch K, Mohseni M, Kirak O, et al: Yap1 acts downstream of α-catenin to control epidermal proliferation. Cell. 144:782–795. 2011.

36 

Moleirinho S, Chang N, Sims AH, et al: KIBRA exhibits MST-independent functional regulation of the Hippo signaling pathway in mammals. Oncogene. 32:1821–1830. 2013. View Article : Google Scholar : PubMed/NCBI

37 

Angus L, Moleirinho S, Herron L, et al: Willin/FRMD6 expression activates the Hippo signaling pathway kinases in mammals and antagonizes oncogenic YAP. Oncogene. 31:238–250. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Badouel C and McNeill H: SnapShot: the hippo signaling pathway. Cell. 145:484. 2011. View Article : Google Scholar : PubMed/NCBI

39 

Visser S and Yang X: LATS tumor suppressor. a new governor of cellular homeostasis. Cell Cycle. 9:3892–3903. 2010. View Article : Google Scholar : PubMed/NCBI

40 

Salah Z, Cohen S, Itzhaki E and Aqeilan RI: NEDD4 E3 ligase inhibits the activity of the Hippo pathway by targeting LATS1 for degradation. Cell Cycle. 12:3817–3823. 2013. View Article : Google Scholar : PubMed/NCBI

41 

Serrano I, McDonald PC, Lock F, Muller WJ and Dedhar S: Inactivation of the Hippo tumour suppressor pathway by integrin-linked kinase. Nat Commun. 4:29762013. View Article : Google Scholar

42 

Mo JS, Yu FX, Gong R, Brown JH and Guan KL: Regulation of the Hippo-YAP pathway by protease-activated receptors (PARs). Genes Dev. 26:2138–2143. 2012. View Article : Google Scholar : PubMed/NCBI

43 

Yu FX, Zhao B, Panupinthu N, et al: Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell. 150:780–791. 2012. View Article : Google Scholar : PubMed/NCBI

44 

Noviello C, Courjal F and Theillet C: Loss of heterozygosity on the long arm of chromosome 6 in breast cancer: possibly four regions of deletion. Clin Cancer Res. 2:1601–1606. 1996.PubMed/NCBI

45 

Lee EY, To H, Shew JY, Bookstein R, Scully P and Lee WH: Inactivation of the retinoblastoma susceptibility gene in human breast cancers. Science. 241:218–221. 1988. View Article : Google Scholar : PubMed/NCBI

46 

Morinaga N, Shitara Y, Yanagita Y, et al: Molecular analysis of the h-warts/LATS1 gene in human breast cancer. Int J Oncol. 17:1125–1129. 2000.

47 

Hong W and Guan KL: The YAP and TAZ transcription co-activators: key downstream effectors of the mammalian Hippo pathway. Semin Cell Dev Biol. 23:785–793. 2012. View Article : Google Scholar : PubMed/NCBI

48 

Hergovich A: Regulation and functions of mammalian LATS/NDR kinases: looking beyond canonical Hippo signalling. Cell Biosci. 3:322013. View Article : Google Scholar : PubMed/NCBI

49 

Valis K, Prochazka L, Boura E, et al: Hippo/Mst1 stimulates transcription of the proapoptotic mediator NOXA in a FoxO1-dependent manner. Cancer Res. 71:946–954. 2011. View Article : Google Scholar : PubMed/NCBI

50 

Yang X, Li DM, Chen W and Xu T: Human homologue of Drosophila lats, LATS1, negatively regulate growth by inducing G(2)/M arrest or apoptosis. Oncogene. 20:6516–6523. 2001.PubMed/NCBI

51 

Matallanas D, Romano D, Al-Mulla F, et al: Mutant K-Ras activation of the proapoptotic MST2 pathway is antagonized by wild-type K-Ras. Mol Cell. 44:893–906. 2011. View Article : Google Scholar : PubMed/NCBI

52 

Hori T, Takaori-Kondo A, Kamikubo Y and Uchiyama T: Molecular cloning of a novel human protein kinase, kpm, that is homologous to warts/lats, a Drosophila tumor suppressor. Oncogene. 19:3101–3109. 2000. View Article : Google Scholar : PubMed/NCBI

53 

Li XJ, Park ES, Park MH and Kim SM: 3,3′-Diindolylmethane suppresses the growth of gastric cancer cells via activation of the Hippo signaling pathway. Oncol Rep. 30:2419–2426. 2013.

54 

Xia H, Qi H, Li Y, et al: LATS1 tumor suppressor regulates G2/M transition and apoptosis. Oncogene. 21:1233–1241. 2002. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen KH, He J, Wang DL, Cao JJ, Li MC, Zhao XM, Sheng X, Li WB and Liu WJ: Methylation‑associated inactivation of LATS1 and its effect on demethylation or overexpression on YAP and cell biological function in human renal cell carcinoma. Int J Oncol 45: 2511-2521, 2014.
APA
Chen, K., He, J., Wang, D., Cao, J., Li, M., Zhao, X. ... Liu, W. (2014). Methylation‑associated inactivation of LATS1 and its effect on demethylation or overexpression on YAP and cell biological function in human renal cell carcinoma. International Journal of Oncology, 45, 2511-2521. https://doi.org/10.3892/ijo.2014.2687
MLA
Chen, K., He, J., Wang, D., Cao, J., Li, M., Zhao, X., Sheng, X., Li, W., Liu, W."Methylation‑associated inactivation of LATS1 and its effect on demethylation or overexpression on YAP and cell biological function in human renal cell carcinoma". International Journal of Oncology 45.6 (2014): 2511-2521.
Chicago
Chen, K., He, J., Wang, D., Cao, J., Li, M., Zhao, X., Sheng, X., Li, W., Liu, W."Methylation‑associated inactivation of LATS1 and its effect on demethylation or overexpression on YAP and cell biological function in human renal cell carcinoma". International Journal of Oncology 45, no. 6 (2014): 2511-2521. https://doi.org/10.3892/ijo.2014.2687
Copy and paste a formatted citation
x
Spandidos Publications style
Chen KH, He J, Wang DL, Cao JJ, Li MC, Zhao XM, Sheng X, Li WB and Liu WJ: Methylation‑associated inactivation of LATS1 and its effect on demethylation or overexpression on YAP and cell biological function in human renal cell carcinoma. Int J Oncol 45: 2511-2521, 2014.
APA
Chen, K., He, J., Wang, D., Cao, J., Li, M., Zhao, X. ... Liu, W. (2014). Methylation‑associated inactivation of LATS1 and its effect on demethylation or overexpression on YAP and cell biological function in human renal cell carcinoma. International Journal of Oncology, 45, 2511-2521. https://doi.org/10.3892/ijo.2014.2687
MLA
Chen, K., He, J., Wang, D., Cao, J., Li, M., Zhao, X., Sheng, X., Li, W., Liu, W."Methylation‑associated inactivation of LATS1 and its effect on demethylation or overexpression on YAP and cell biological function in human renal cell carcinoma". International Journal of Oncology 45.6 (2014): 2511-2521.
Chicago
Chen, K., He, J., Wang, D., Cao, J., Li, M., Zhao, X., Sheng, X., Li, W., Liu, W."Methylation‑associated inactivation of LATS1 and its effect on demethylation or overexpression on YAP and cell biological function in human renal cell carcinoma". International Journal of Oncology 45, no. 6 (2014): 2511-2521. https://doi.org/10.3892/ijo.2014.2687
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team