Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular and Clinical Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9450 Online ISSN: 2049-9469
Journal Cover
June-2019 Volume 10 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2019 Volume 10 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Analysis of genes encoding epigenetic regulators in myeloproliferative neoplasms: Coexistence of a novel SETBP1 mutation in a patient with a p.V617F JAK2 positive myelofibrosis

  • Authors:
    • Laura Eder‑Azanza
    • Cristina Hurtado
    • David Navarro‑Herrera
    • Diego Calavia
    • Francisco Javier Novo
    • José Luis Vizmanos
  • View Affiliations / Copyright

    Affiliations: Department of Biochemistry and Genetics, School of Sciences, University of Navarra, E‑31008 Pamplona, Spain
  • Pages: 639-643
    |
    Published online on: April 8, 2019
       https://doi.org/10.3892/mco.2019.1840
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

In recent years it has been shown that the causes of chronic myeloproliferative neoplasms (MPNs) are more complex than a simple signaling aberration and many other mutated genes affecting different cell processes have been described. For instance, mutations in genes encoding epigenetic regulators are more frequent than expected. One of the latest genes described as mutated is SET binding protein 1 (SETBP1). In silico tools have revealed that there are several human SETBP1 paralogous to nuclear receptor binding SET domain protein 1 (NSD1), NSD2 and NSD3, for example, which are also involved in the development of other hematological malignancies. Therefore, the present study analyzed the mutational status of NSD1, NSD2, NSD3 and SETBP1 in BCR-ABL1 negative MPNs with or without Janus kinase 2 (JAK2) p.V617F mutation. The present study revealed that the NSD genes are not frequently mutated in MPNs. However, a novel SETBP1 mutation was identified in a patient with p.V617F JAK2 positive primary myelofibrosis. These results provide further insight into the genetic complexity of MPNs.

Introduction

Chronic myeloproliferative neoplasms (MPNs) have been considered diseases caused by aberrations in signaling, mainly affecting the JAK-STAT pathway. However, mutations in other genes that affect different cell processes have been described, suggesting that they are diseases with more complex causes. Recent findings suggest that MPNs are likely the result of combined genetic dysregulation and can present mutations in epigenetic associated-genes such as TET2, ASXL1, EZH2, IDH1/2 and DNMT3A (1–3) described also in the related myelodysplastic/myeloproliferative neoplasms (MDS/MPN).

SETBP1 encodes the SET binding protein 1, one component of the multi-functional SET complex in the nucleus that plays a role in histone modifications. In 2013, whole exome sequencing identified recurrent SETBP1 mutations in approximately 25% patients with atypical chronic myeloid leukemia (aCML) and in a small proportion of patients with chronic myelomonocytic leukemia (CMML) and chronic neutrophilic leukemia (CNL) (4). SETBP1 was the first gene recurrently mutated in aCML, a disease previously diagnosed by exclusion. All of the mutations described were located in a small region of 14 amino acids (858–871) in the highly-conserved SKI homologous region encoded by exon 4 of the gene.

SETBP1 seems to interact with SET protein, leading to the inhibition of the activity of PP2A and promoting the proliferation of leukemic cells (5). Overexpression of SETBP1 increases the expression of other genes such as HOXA9 and HOXA10 leading to immortalization of murine myeloid progenitors (6), and mutant SETBP1 forms could drive the disease through similar mechanisms (7).

There are three SETBP1 paralogous genes (NSD1, NSD2 and NSD3) that encode proteins with similar functions, so that they could also be mutated in MPNs. Indeed, NSD1 and NSD3 are involved in fusions with NUP98 in myeloid malignancies. Nuclear receptor binding SET domain protein 1 (NSD1) encodes a H3K36 and H4K20 methyltransferase that activates or represses transcription depending on the cellular context. Some rare cases of acute myeloid leukemia (AML) with poor prognosis have a t(5;11)(q35;p15) that fuses NUP98 with NSD1, and show abnormally high levels of H3K36 methylation and activation of transcription of oncogenes such as HOXA9 (8–10). On the other hand, nuclear receptor binding SET domain protein 3 (NSD3) encodes a H3K4 and H3K27 methyltransferase, marks of activation or repression of transcription, respectively. This gene has also been found fused with NUP98 in patients with AML (11) and therapy-related myelodysplastic syndrome (t-MDS) with poor prognosis (12). Finally, nuclear receptor binding SET domain protein 2 (NSD2) encodes an H3K36 histone methyltransferase that has also been implicated in gene fusions in multiple myeloma (13) and is mutated in pediatric acute lymphoblastic leukemia (ALL) (14). The p.E1099K mutation affects the SET domain and increases H3K36 dimethylation, which may lead to the transforming activity of NSD2 (14).

To date, little is known about the role of individual histone modifications in MPNs, and current research is focusing mainly on changes related to polycomb group proteins (3). These proteins can remodel chromatin; for example, polycomb repressive complex 2 (PRC2) catalyzes di- and trimethylation of H3K27 leading to gene silencing. Addition of sex combs like protein 1 (ASXL1) encodes an important mediator of PRC2 function, and mutations in this gene have been described in MDS/AML (15) and in MPNs (16). Thus, we asked whether SETBP1 related genes could also be mutated in these diseases.

With this aim in mind, we analyzed the mutational profile of NSD1, NSD2 and NSD3 in a selected group of patients with MPNs.

Materials and methods

We performed denaturing high performance liquid chromatography (dHPLC) to analyze exon 13 of NSD1, NSD2 and NSD3, which are homologous to SETBP1 exon 4 in which mutations had been previously described. This SETBP1 exon was also included in the analysis. In addition, we also analyzed exon 19 of NSD1 and NSD2 and exon 20 of NSD3, homologous to the NSD2-mutated exon in ALL (p.E1099K) (primers and conditions are shown in Table I).

Table I.

Polymerase chain reaction primers used for the mutational analysis of NSD1, NSD2, NSD3 and SETBP1 by dHPLC.

Table I.

Polymerase chain reaction primers used for the mutational analysis of NSD1, NSD2, NSD3 and SETBP1 by dHPLC.

PrimerTm (°C)% GCSequence (5′→3′)PCR product (bp)dHPLC conditions (°C)
NSD1-e13L61.029.17 AATTTATCTTCTTTTGGCTTCTCA28557.3; 59.2; 61
NSD1-e13R62.840.91 TCTGTTGCCAATTAAACTGAGG
NSD1-e13Lm63.733.33 AATTTATCTTCGTTTGGCTTCTCA
NSD1_e19L66.254.55 TGCTGCTGACAGTGGTAGGAGT35053.1; 56.8; 55.8
NSD1_e19R65.839.13 CAGTGAAAACAGCATTTCCCATT
NSD1_e19Lm70.359.10 TGCTGCTGACGGTGGTAGGAGT
NSD2_e13L65.454.55 ACCTCTCTCTCCACCCCTTCTT32957.8; 58.7; 62.7
NSD2_e13R70,154.55 ACAATCCCAACAGCCCACCTTC
NSD2_e13Rm73.759.10 ACAATCCCAACGGCCCACCTTC
NSD2_e19L69.654.55 TCATGATGGGGAGTCTTGAGCC28561.2; 61.8
NSD2_e19R68.554.55 CCACAGGGCAAAGTCCAGTTCT
NSD2_e19Rm64.350.00 CCACAGGTCAAAGTCCAGTTCT
NSD3_e13L64.647.83 GCTGTTTGATGTCTGTAGCTGCT30857.3; 59.4; 60.6
NSD3_e13R66,741.67 TCTTTGTCTCCTTCTTCAGCTGTT
NSD3_e13Lm64,352.17 GCTGTTTGGTGTCTGTAGCTGCT
NSD3_e20L61.937.50 ACCATTTCTTTCTAGGGTTGAAGT37253.8; 56; 60
NSD3_e20R62.841.67 TCTTTGTCTCCTTCTTCAGCTGTT
NSD3_e20Lm64,341.67 ACCATTTCTGTCTAGGGTTGAAGT
SETBP1-e4F9L65.840.91 CTCTTCCAACCAAAACCCAAAA39460.7; 62
SETBP1-e4F9R65.445.45 CTTTTCCGTTTCCTCTTGTGCT
SETBP1-e4F9Rm61.240.91 CTTTTCCGTTTACTCTTGTGCT

[i] Forward and reverse primers used to amplify the DNA sequences of interest. The mutations designed to create a control mutant product are underlined. The length of the PCR product is shown in the fifth column. Finally, melting temperature conditions (dHPLC) for each exon are also shown. NSD, nuclear receptor binding SET domain protein 1; SETBP1, SET binding protein 1; dHPLC, denaturing high performance liquid chromatography; PCR, polymerase chain reaction.

We included samples from patients with different types of MPNs (PV, ET, PMF) and MDS/MPNs with and without the p.V617F mutation in Janus kinase 2 (JAK2). Ninety-two samples (34 ET, 37 PMF and 21 MDS/MPNs) were from patients without p.V617F JAK2 mutation, while 50 samples (8 ET, 8 PV, 4 PMF and 30 with an unspecified MPN type) harbored the p.V617F mutation. Finally, we also analyzed samples from 25 different cancer cell lines (Table II), most of them from hematological malignancies. As a control group, we included samples from 13 patients with B-ALL, the disease in which the p.E1099K NSD2 mutation had been described (14). Informed consent was obtained from all patients and procedures were approved by the Ethical Committee on Clinical Research of University of Navarra.

Table II.

Human cancer cell lines tested.

Table II.

Human cancer cell lines tested.

Cell line nameRepository (number)Origin
A-549DSMZ (ACC-107)Lung carcinoma
BK-006ECACCp.V617F JAK2 positive PV
BK-013ECACC (98100924)p.V617F JAK2 negative ET
BK015ECACC (99092421)p.V617F JAK2 negative ET
DAUDIDSMZ (ACC-78)Burkitt lymphoma
EOL-1DSMZ (ACC-386)Acute myeloid eosinophilic leukemia
F-36PDSMZ (ACC-543)Acute myeloid leukemia secondary to myelodysplastic syndrome (MDS)
HCC-1937DSMZ (ACC-513)Breast carcinoma
HELDSMZ ACC-11 Erythroleukemia
HL60DSMZ ACC-3Acute myeloid leukemia (AML)
HU3Dr Morgan, USAAcute megakaryoblastic leukemia
K-562DSMZ ACC-10BCR-ABL1 positive chronic myeloid leukemia (CML) in blast crisis
KARPAS-299DSMZ ACC-31T cell lymphoma
KARPAS-422DSMZ ACC-32B cell lymphoma
M-07eDSMZ ACC-104Acute megakaryoblastic leukemia
MG-63ATCC: CRL-1427Osteosarcoma
MOLM-13DSMZ ACC-554Acute myeloid leukemia (AML)
MOLT-16DSMZ ACC-29T cell acute lymphoid leukemia (T-ALL)
MOLT-4DSMZ ACC-362Acute lymphoid leukemia (ALL)
MV-411DSMZ ACC-102Acute monoblastic/monocytic leukemia
RAJIDSMZ ACC-319Burkitt lymphoma
REHDSMZ ACC-22B-ALL (t(12;21) (p13;q22) (fusion ETV6-RUNX1))
SET2DSMZ ACC-608p.V617F JAK2 positive ET
TF-1DSMZ ACC-334 Erythroleukemia
UKE-1Dr W. Fiedelr, Hamburg, Germanyp.V617F JAK2 positive ET transformed to AML

[i] ECACC, European Collection of Cell Culture; DSMZ, Deutsche Sammlung von Mikroorganismen und Zellkulturen.

Results

Most of the nucleotide changes that we detected were SNPs already described (data not shown). No mis-sense changes were found in NSD1 and NSD3 so they do not seem to be frequently mutated in these diseases. With regard to NSD2, we did not detect any mis-sense mutations in samples from MPN and MDS/MPN patients, except for the previously described p.E1099K mutation that we observed in one patient with B-precursor ALL.

The analysis of SETBP1 found the mis-sense mutation p.S867G (c.2599A>G according the first nucleotide of the translation start codon of the CDS from NM_015559) (Fig. 1) in the sample from one patient with a p.V617F JAK2 PMF This change is located in a residue that is highly conserved between different species in the SKI homologous region, the mutational hotspot described previously In silico analysis by several bioinformatics tools like PolyPhen-2, MutPred2, SIFT and FATHMM showed that it is probably damaging (data not shown). No additional material was available to determine the somatic status of this change. This mutation has not been described as a polymorphism or a cancer-related mutation in other databases. In fact, in COSMIC (Catalogue of Somatic Mutations in Cancer, cancer.sanger.ac.uk/cosmic) there are other variants affecting the same codon but not this specific nucleotide. These mutations are p.S867N (c.2600G>A) a somatic change predicted as pathogenic and found in an intestinal adenocarcinoma, p.S867R (c.2601C>A) a non-confirmed somatic change predicted as neutral and found in four samples from MDS and AML associated with MDS and the silent p.S867S (c.2601C>T), a somatic change predicted also as neutral and found in two samples from stomach and intestine with adenocarcinoma but described as a SNP in dbSNP (rs376371660). This is also the only change in ExAC database (Exome Aggregation Consortium, http://exac.broadinstitute.org) affecting this codon, found in 7 of 120746 alleles with a frequency of 0.00005797. This is the only variant also described in 1000 Genomes Phase 3 database (www.internationalgenome.org/category/phase-3) with a frequency of 0.00039936 and in the ESP database (Exome Sequencing Project, evs.gs.washington.edu) with a frequency of 0.00007688, in both cases with only one allele T found. In gnomAD (Genome Aggregation Database, gnomad.broadinstitute.org), that spans 125,748 exome sequences and 15,708 whole-genome sequences from unrelated individuals the mutation p.S867G is also not described.

Figure 1.

Electropherograms of the sequence surrounding the mutation c.2599A>G (p.S867G). Up, wild-type sequence; down, sequence from the patient. SETBP1, SET binding protein 1.

Discussion

SETBP1 mutations can coexist with aberrations in other genes frequently mutated in myeloid neoplasms such as CBL, ASXL1, U2AF1 or RUNX1 (3,17,18) thus cooperating in the progression of the disease. However, the coexistence of mutations in SETBP1 and JAK2 in MPNs has not been described to date. In the case of ASXL1 and SETBP1 mutations, the former may initially inhibit cell differentiation while mutations in SETBP1 would provide a proliferative advantage (18). Although a direct physical interaction between CBL and SETBP1 has not been demonstrated, it seems plausible that both mutations could cooperate indirectly by reducing cytokine dependence of leukemia cells (17).

Furthermore, it is well established that mutations in genes related to epigenetic regulation of gene expression can coexist with mutations in JAK2 and could modulate the progression of the disease (3,19). For instance, TET2 encodes the Tet methylcytosine dioxygenase 2 which catalyzes the conversion of the 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) and plays a key role in active DNA demethylation and it is frequently mutated in patients with MPNs (20). TET2 mutations have been found in 17% of patients with p.V617F JAK2 (20). Although both mutations are present in different clones, data published to date show that TET2 somatic mutations might be associated with increased aggressiveness and higher frequency of organomegaly in ET patients, but not in PV or PMF patients (19). Although SETBP1 mutations have not been associated with mutations in JAK2 in MPNs to date, our finding suggests the possibility of a similar interplay of mutational mechanisms.

Recently two cases have been reported with Schinzel-Giedion syndrome (SGS, MIM 269150) and a milder phenotype with the mutation at this residue p.S867R (21,22). SGS is a rare dominant developmental disorder characterized by multiple malformations including midface hypoplasia, cardiac defects, hydronephrosis and skeletal abnormalities. It seems caused by germline de novo mutations in SETBP1 in a hotspot of 12 bp coding for residues 868 to 871 of the protein, that overlaps to the somatic mutations reported in myeloid malignancies and support a gain-of-function effect. This dual role in cancer and development is not new, there are other genes such as HRAS, ASXL1, EZH2 and FGFR2 in which germline mutations cause developmental disorders and the overlapping somatic mutations drive cancer. The recurrently mutated region (868–871) in SETBP1 is highly conserved and it has been identified as important to initiate degradation by ubiquitination so the mutations could increase protein stability (4,21,22). The milder phenotype shown by both patients with SGS and the p.S867R would point to a less activating gain-of-function of this mutant protein.

The sample available in our case did not allow us to determine whether SETBP1 and JAK2 mutations coexist in the same clone. Lack of access to clinical data of this patient prevents us from drawing definitive conclusions about the putative effects of their presence in the progression of the disease. SETBP1 mutations usually have poor prognosis and are frequently acquired as secondary events in other myeloid neoplasms (PMF can arise on its own or as a progression of PV or ET) (18), so the p.S867G mutation in SETBP1 could be relevant for the progression of the disease. In addition, additional experiments would be required to demonstrate the pathogenicity of the p.S867G mutation. These experiments should be performed on cell lines that stably express p.S867G SETBP1 and this mutation in combination with the p.V617F JAK2 to test their possible cooperation for the transformation of the disease.

In this study we show that NSD1, NSD2 and NSD3 genes, that are paralogous to SETBP1 and encode also epigenetic regulators, are not frequently mutated in MPNs in the SETBP1 homologous region. However, we show that the p.V617F JAK2 can coexist with mutations in SETBP1, a gene mutated in some myeloid neoplasms. This fact adds support to the notion that these diseases are genetically complex and shows the need to identify additional oncogenic mechanisms that could promote progression or phenotypic diversity, in order to design new targeted therapies.

Acknowledgements

Not applicable.

Funding

The present study was funded by the PIUNA Program of the University of Navarra. LE and DN have PhD Studentships granted by the Ministry of Education, Culture and Sports of Spain (grant nos. FPU14/03669 and FPU13/00424 respectively) within the University Faculty Training (FPU) program.

Availability of data and materials

The datasets used and/or analyzed during this study are available from the corresponding author on reasonable request.

Authors' contributions

LEA, FJN and JLV designed the study. LEA and CH performed the experiments. LEA, DNH, DC and JLV analyzed the data. LEA, FJN and JLV wrote the manuscript. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

Written informed consent was obtained from all of the patients and the procedures were approved by the Ethical Committee on Clinical Research of University of Navarra (Pamplona, Spain).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Murati A, Brecqueville M, Devillier R, Mozziconacci MJ, Gelsi-Boyer V and Birnbaum D: Myeloid malignancies: Mutations, models and management. BMC Cancer. 12:3042012. View Article : Google Scholar : PubMed/NCBI

2 

Shih AH, Abdel-Wahab O, Patel JP and Levine RL: The role of mutations in epigenetic regulators in myeloid malignancies. Nat Rev Cancer. 12:599–612. 2012. View Article : Google Scholar : PubMed/NCBI

3 

McPherson S, McMullin MF and Mills K: Epigenetics in myeloproliferative neoplasms. J Cell Mol Med. 21:1660–1667. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Piazza R, Valletta S, Winkelmann N, Redaelli S, Spinelli R, Pirola A, Antolini L, Mologni L, Donadoni C, Papaemmanuil E, et al: Recurrent SETBP1 mutations in atypical chronic myeloid leukemia. Nat Genet. 45:18–24. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Cristóbal I, Blanco FJ, Garcia-Orti L, Marcotegui N, Vicente C, Rifon J, Novo FJ, Bandres E, Calasanz MJ, Bernabeu C and Odero MD: SETBP1 overexpression is a novel leukemogenic mechanism that predicts adverse outcome in elderly patients with acute myeloid leukemia. Blood. 115:615–625. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Oakley K, Han Y, Vishwakarma BA, Chu S, Bhatia R, Gudmundsson KO, Keller J, Chen X, Vasko V, Jenkins NA, et al: Setbp1 promotes the self-renewal of murine myeloid progenitors via activation of Hoxa9 and Hoxa10. Blood. 119:6099–6108. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Trimarchi T, Ntziachristos P and Aifantis I: A new player SETs in myeloid malignancy. Nat Genet. 45:846–847. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Akiki S, Dyer SA, Grimwade D, Ivey A, Abou-Zeid N, Borrow J, Jeffries S, Caddick J, Newell H, Begum S, et al: NUP98-NSD1 fusion in association with FLT3-ITD mutation identifies a prognostically relevant subgroup of pediatric acute myeloid leukemia patients suitable for monitoring by real time quantitative PCR. Genes Chromosomes Cancer. 52:1053–1064. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Hollink IH, van den Heuvel-Eibrink MM, Arentsen-Peters ST, Pratcorona M, Abbas S, Kuipers JE, van Galen JF, Beverloo HB, Sonneveld E, Kaspers GJ, et al: NUP98/NSD1 characterizes a novel poor prognostic group in acute myeloid leukemia with a distinct HOX gene expression pattern. Blood. 118:3645–3656. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Shiba N, Ichikawa H, Taki T, Park MJ, Jo A, Mitani S, Kobayashi T, Shimada A, Sotomatsu M, Arakawa H, et al: NUP98-NSD1 gene fusion and its related gene expression signature are strongly associated with a poor prognosis in pediatric acute myeloid leukemia. Genes Chromosomes Cancer. 52:683–693. 2013.PubMed/NCBI

11 

Rosati R, La Starza R, Veronese A, Aventin A, Schwienbacher C, Vallespi T, Negrini M, Martelli MF and Mecucci C: NUP98 is fused to the NSD3 gene in acute myeloid leukemia associated with t(8;11)(p11.2;p15). Blood. 99:3857–3860. 2002. View Article : Google Scholar : PubMed/NCBI

12 

Taketani T, Taki T, Nakamura H, Taniwaki M, Masuda J and Hayashi Y: NUP98-NSD3 fusion gene in radiation-associated myelodysplastic syndrome with t(8;11)(p11;p15) and expression pattern of NSD family genes. Cancer Genet Cytogenet. 190:108–112. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Chesi M, Nardini E, Lim RS, Smith KD, Kuehl WM and Bergsagel PL: The t(4;14) translocation in myeloma dysregulates both FGFR3 and a novel gene, MMSET, resulting in IgH/MMSET hybrid transcripts. Blood. 92:3025–3034. 1998.PubMed/NCBI

14 

Jaffe JD, Wang Y, Chan HM, Zhang J, Huether R, Kryukov GV, Bhang HE, Taylor JE, Hu M, Englund NP, et al: Global chromatin profiling reveals NSD2 mutations in pediatric acute lymphoblastic leukemia. Nat Genet. 45:1386–1391. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Gelsi-Boyer V, Trouplin V, Adélaïde J, Bonansea J, Cervera N, Carbuccia N, Lagarde A, Prebet T, Nezri M, Sainty D, et al: Mutations of polycomb-associated gene ASXL1 in myelodysplastic syndromes and chronic myelomonocytic leukaemia. Br J Haematol. 6:788–800. 2009. View Article : Google Scholar

16 

Abdel-Wahab O, Tefferi A and Levine RL: Role of TET2 and ASXL1 mutations in the pathogenesis of myeloproliferative neoplasms. Hematol Oncol Clin North Am. 5:1053–1064. 2012. View Article : Google Scholar

17 

Makishima H, Yoshida K, Nguyen N, Przychodzen B, Sanada M, Okuno Y, Ng KP, Gudmundsson KO, Vishwakarma BA, Jerez A, et al: Somatic SETBP1 mutations in myeloid malignancies. Nat Genet. 45:942–946. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Makishima H: Somatic SETBP1 mutations in myeloid neoplasms. Int J Hematol. 105:732–742. 2017. View Article : Google Scholar : PubMed/NCBI

19 

Saeidi K: Myeloproliferative neoplasms: Current molecular biology and genetics. Crit Rev Oncol Hematol. 98:375–389. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Tefferi A, Pardanani A, Lim KH, Abdel-Wahab O, Lasho TL, Patel J, Gangat N, Finke CM, Schwager S, Mullally A, et al: TET2 mutations and their clinical correlates in polycythemia vera, essential thrombocythemia and myelofibrosis. Leukemia. 23:905–911. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Carvalho E, Honjo R, Magalhães M, Yamamoto G, Rocha K, Naslavsky M, Zatz M, Passos-Bueno MR, Kim C and Bertola D: Schinzel-Giedion syndrome in two Brazilian patients: Report of a novel mutation in SETBP1 and literature review of the clinical features. Am J Med Genet 167A. 1039–1046. 2015. View Article : Google Scholar

22 

Acuna-Hidalgo R, Deriziotis P, Steehouwer M, Gilissen C, Graham SA, van Dam S, Hoover-Fong J, Telegrafi AB, Destree A, Smigiel R, et al: Overlapping SETBP1 gain-of-function mutations in Schinzel-Giedion syndrome and hematologic malignancies. PLoS Genet. 13:e10066832017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Eder‑Azanza L, Hurtado C, Navarro‑Herrera D, Calavia D, Novo FJ and Vizmanos JL: Analysis of genes encoding epigenetic regulators in myeloproliferative neoplasms: Coexistence of a novel SETBP1 mutation in a patient with a p.V617F JAK2 positive myelofibrosis. Mol Clin Oncol 10: 639-643, 2019.
APA
Eder‑Azanza, L., Hurtado, C., Navarro‑Herrera, D., Calavia, D., Novo, F.J., & Vizmanos, J.L. (2019). Analysis of genes encoding epigenetic regulators in myeloproliferative neoplasms: Coexistence of a novel SETBP1 mutation in a patient with a p.V617F JAK2 positive myelofibrosis. Molecular and Clinical Oncology, 10, 639-643. https://doi.org/10.3892/mco.2019.1840
MLA
Eder‑Azanza, L., Hurtado, C., Navarro‑Herrera, D., Calavia, D., Novo, F. J., Vizmanos, J. L."Analysis of genes encoding epigenetic regulators in myeloproliferative neoplasms: Coexistence of a novel SETBP1 mutation in a patient with a p.V617F JAK2 positive myelofibrosis". Molecular and Clinical Oncology 10.6 (2019): 639-643.
Chicago
Eder‑Azanza, L., Hurtado, C., Navarro‑Herrera, D., Calavia, D., Novo, F. J., Vizmanos, J. L."Analysis of genes encoding epigenetic regulators in myeloproliferative neoplasms: Coexistence of a novel SETBP1 mutation in a patient with a p.V617F JAK2 positive myelofibrosis". Molecular and Clinical Oncology 10, no. 6 (2019): 639-643. https://doi.org/10.3892/mco.2019.1840
Copy and paste a formatted citation
x
Spandidos Publications style
Eder‑Azanza L, Hurtado C, Navarro‑Herrera D, Calavia D, Novo FJ and Vizmanos JL: Analysis of genes encoding epigenetic regulators in myeloproliferative neoplasms: Coexistence of a novel SETBP1 mutation in a patient with a p.V617F JAK2 positive myelofibrosis. Mol Clin Oncol 10: 639-643, 2019.
APA
Eder‑Azanza, L., Hurtado, C., Navarro‑Herrera, D., Calavia, D., Novo, F.J., & Vizmanos, J.L. (2019). Analysis of genes encoding epigenetic regulators in myeloproliferative neoplasms: Coexistence of a novel SETBP1 mutation in a patient with a p.V617F JAK2 positive myelofibrosis. Molecular and Clinical Oncology, 10, 639-643. https://doi.org/10.3892/mco.2019.1840
MLA
Eder‑Azanza, L., Hurtado, C., Navarro‑Herrera, D., Calavia, D., Novo, F. J., Vizmanos, J. L."Analysis of genes encoding epigenetic regulators in myeloproliferative neoplasms: Coexistence of a novel SETBP1 mutation in a patient with a p.V617F JAK2 positive myelofibrosis". Molecular and Clinical Oncology 10.6 (2019): 639-643.
Chicago
Eder‑Azanza, L., Hurtado, C., Navarro‑Herrera, D., Calavia, D., Novo, F. J., Vizmanos, J. L."Analysis of genes encoding epigenetic regulators in myeloproliferative neoplasms: Coexistence of a novel SETBP1 mutation in a patient with a p.V617F JAK2 positive myelofibrosis". Molecular and Clinical Oncology 10, no. 6 (2019): 639-643. https://doi.org/10.3892/mco.2019.1840
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team