Open Access

Expression of inositol‑requiring enzyme 1β is downregulated in colorectal cancer

  • Authors:
    • Yalin Jiang
    • Yunfeng Zhou
    • Yufeng Zheng
    • Hong Guo
    • Lei Gao
    • Pan Chen
    • Dandan Feng
    • Ran Qi
    • Xiaozhen Li
    • Yongchao Chang
    • Fong‑Fong Chu
    • Qiang Gao
  • View Affiliations

  • Published online on: January 11, 2017     https://doi.org/10.3892/ol.2017.5590
  • Pages: 1109-1118
  • Copyright: © Jiang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The endoplasmic reticulum stress inositol-requiring enzyme (IRE) 1α/X‑box binding protein (XBP) 1 signaling pathway is involved in the tumorigenesis of breast and prostate cancer. Mucin 2 (MUC2) protects colon tissues from the formation of tumors. In human colorectal cancer (CRC) the role of IRE1α, and its analogue, IRE1β, has yet to be elucidated. In the present study, the expression levels of IRE1α, IRE1β, un‑spliced XBP1u, spliced XBP1s and MUC2 in surgically resected cancerous and adjacent non‑cancerous tissues from patients with CRC were investigated. The IRE1α, IRE1β, XBP1u, XBP1s and MUC2 mRNA expression levels were determined using reverse transcription‑quantitative polymerase chain reaction, and the protein expression levels were detected using immunohistochemistry and western blotting. The association between the expression levels of IRE1α, IRE1β and MUC2 and the clinicopathological features of patients with CRC was subsequently analyzed. The mRNA expression levels of IRE1β and MUC2 were decreased by ~2.1 and ~4.5‑fold in CRC tissues, respectively, as compared with the adjacent normal tissues. The protein expression levels of IRE1β and MUC2 were decreased by ~8.0 and ~2.0‑fold in the CRC tissues, respectively. IRE1β mRNA expression levels were positively correlated with MUC2 mRNA expression levels. IRE1β expression levels were revealed to be significantly associated with lymph node metastasis, tumor stage and histological differentiation. However, IRE1α, XBP1u and XBP1s mRNA and IRE1α protein expression levels were not observed to significantly differ between cancerous tissues and the adjacent normal tissues. The results indicated that the expression of IRE1β, but not IRE1α, may protect colon tissue from developing CRC by inducing MUC2 expression. Therefore, decreased IRE1β expression levels may be associated with the development of CRC through the inhibition of MUC2 expression.

Introduction

Colorectal cancer (CRC) is the third most commonly diagnosed cancer and the second leading cause of cancer-associated mortality in the United States (1). In China, CRC is the fifth leading cause of cancer-associated mortality, following lung, liver, gastric and esophageal cancer (2). The incidence of CRC in China has increased in recent decades and is predicted to continue rising due to changes in lifestyle and diet (3,4). Although novel treatments have been developed, the five-year survival rate of patients with CRC and distant metastases remains poor at ~13% (57). CRC develops from the accumulation of genetic and epigenetic alterations, leading to gene amplifications, the activation of certain oncogenes or the loss of tumor suppressor genes (6).

Previous studies have demonstrated that the activation of endoplasmic reticulum (ER) stress in cancer cells may facilitate their survival and tumor growth; however, certain studies have revealed that ER stress may inhibit cancer progression (8,9). During ER stress, various pathological changes occur to induce ER calcium depletion and the accumulation of misfolded proteins in the ER lumen (10). Mammalian cells have three classes of ER stress sensors, including protein-kinase-RNA-like-ER kinase (PERK), activating transcription factor 6 (ATF6) and inositol-requiring enzyme-1α (IRE1α) (1012). These sensors are resident ER transmembrane proteins, which regulate the unfolded protein response (UPR) to manage ER stress (11). The UPR includes the alteration of protein folding, assembly and degradation programs in order to reestablish homeostasis and normal ER functioning (11,13).

IRE1α has a dual enzyme activity, as it is a kinase and a site-specific RNA endonuclease (8,14). IRE1α is frequently mutated in various types of human cancer (15). One manner in which IRE1α maintains ER homeostasis is by processing the mRNA encoding X-box binding protein 1 (XBP1) (16). IRE1α activates XBP1 protein expression by excising a 26-nucleotide-intron sequence from the un-spliced XBP1 mRNA (XBP1u) and creating the spliced XBP1 mRNA (XBP1s). The subsequent frame shift mutation eliminates a stop codon for protein translation (17,18). XBP1 is a transcription factor that is involved in tumor growth and survival (9,17). XBP1 expression levels are increased in numerous types of cancer, including breast cancer (19), hepatocellular carcinoma (20), pancreatic cancer (17), and CRC, as determined in a study of five patients (21); however, XBP1 expression levels may be decreased in prostate cancer (22). IRE1α may also induce UPR through the post-transcriptional modifications of specific ER membrane proteins via regulated IRE1-dependent decay (RIDD) (8). RIDD is the process by which IRE1α promotes the degradation of mRNAs primarily encoding ER-targeted proteins, in order to reduce the influx of proteins during ER stress (23,24). In the present study, IRE1α and XBP1 mRNA expression levels in CRC tissues were analyzed to determine whether they are increased, compared with the paired control samples.

IRE1β is an analog of IRE1α (25). Whereas IRE1α is expressed ubiquitously, the expression of IRE1β is restricted to the epithelium of the gastrointestinal and respiratory tracts (26,27). Although previous studies have demonstrated that IRE1α and IRE1β are each able to sense ER stress and protect mice from dextran sulfate sodium-induced colitis (26,28), they have differing functions. The two IRE1 proteins have various substrate specificities; the RNase activity of IRE1α with regard to XBP1u mRNA is markedly high, compared with IRE1β (27). IRE1α directs cell survival through the induction of XBP1 mRNA cleavage and the promotion of RIDD (28). IRE1α signaling terminates in the event of cell apoptosis induced by irremediable ER stress (2931). IRE1β is more efficient than IRE1α at degrading 28 s rRNA (16). The cleavage of 28s rRNA may induce apoptosis, as previously demonstrated in IRE1β-overexpressing HeLa cells (32). The RNase activity of IRE1β appears to have broad substrate specificity; it regulates the stability of the mRNA that encodes certain ER proteins and maintains ER homeostasis in highly differentiated secretory cells (16). Thus, IRE1β, but not IRE1α, degrades the mRNA encoding specific secretory proteins, including mucin 2 (MUC2) in the intestinal goblet cells (16,33). MUC2 is a macromolecular glycoprotein secreted by goblet cells (34). MUC2 is crucial to host immune system and protects colon tissues from developing colitis or CRC; MUC2-deficient mice have been observed to develop spontaneous colitis and colon cancer (3538). The differences between the substrates of IRE1α and IRE1β suggest their divergent functions in ER stress, and may also reflect their various roles in the tumorigenesis of CRC (29). Therefore, IRE1β and MUC2 gene expression profiles in CRC tissue samples were analyzed in the current study.

In the present study, the expression levels of the signaling pathways IRE1α-XBP1, IRE1β and MUC2 in colon cancer tissues were investigated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR), western blotting and immunohistochemistry, and their associations with the clinical features of CRC patients were explored. This study may identify potential important targets for cancer therapies.

Materials and methods

Patients and tissue samples

The CRC tissue samples were obtained from surgically resected tumor tissues from patients with colorectal adenocarcinoma at the First Affiliated Hospital of Henan University of Science and Technology, between September 1st, 2013 and February 31st, 2014. The clinicopathological features of the patients recruited for the current study are listed in Table I. Tumor tissues and adjacent non-cancerous tissues (serving as controls) were analyzed. The control non-cancerous tissues were taken from an area ~5 cm from the lesion. Patients with colorectal adenocarcinoma were selected, while those patients with mucinous, signet-ring cell carcinoma, squamous carcinoma, adenosquamous carcinoma or undifferentiated carcinoma forms of CRC were excluded. Mucinous CRC was excluded due to its high level of MUC2 expression compared with that in normal colon tissues (36,39,40).

Table I.

Clinicopathological characteristics of the included patients with colorectal carcinoma (n=42).

Table I.

Clinicopathological characteristics of the included patients with colorectal carcinoma (n=42).

VariableNumber of cases (%)
Gender
  Male18 (42.9)
  Female24 (57.1)
Age (years)
  <6018 (42.9)
  ≥6024 (57.1)
Tumor size (cm)
  <511 (26.2)
  ≥528 (66.7)
  Data incomplete3 (7.1)
Differentiation
  WMDC11 (26.2)
  MDC27 (77.1)
  PMDC4 (9.5)
Lymphatic node metastasis
  Negative15 (35.7)
  Positive27 (64.3)
TNM stage
  I–II24 (57.1)
  III–IV18 (42.9)

[i] WMDC, well-moderately differentiated carcinoma; MDC, moderately differentiated carcinoma; PMDC, poor-moderately differentiated carcinoma; TNM, tumor node metastasis.

Two staff pathologists confirmed the diagnosis of CRC. A section of each tissue sample was fixed in 4% paraformaldehyde and embedded in paraffin wax for hematoxylin and eosin staining and immunohistochemistry (IHC). The remaining section of the tissue sample was stored at −80°C for RNA extraction and western blot analysis. RNAlater (Qiagen GmbH, Hilden, Germany; cat. no. 76106) was added immediately following the tissue sample collection in order to prevent RNA degradation. The tumor stages were classified according to the 7th edition of the tumor-node-metastasis (TNM) classification criteria of the American Joint Committee on Cancer (41). Informed consent was obtained from all patients and the Clinical Research Ethics Committee of The First Affiliated Hospital of Henan University of Science and Technology approved the current study.

RT-qPCR

Total RNA was extracted using TRIzol® Reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. A total of 2 µg total RNA was used for cDNA synthesis using PrimeScript™ RT Master Mix (Takara Bio, Inc., Otsu, Japan) in a 40 µl reaction mixture (8 µl 5X RT Master Mix; total RNA; diethylpyrocarbonate), as follows: 37°C for 15 min, 85°C for 5 sec and 4°C for 10 min. The primer sequences for IRE1α, XBP1u, XBP1s, IRE1β, MUC2 and β-actin were designed using Primer3.0 software (42) and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China; Table II). RT-qPCR was conducted using a CFX96™ Real-Time PCR system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The reaction mixture (25 µl total volume per well) included 2 µl cDNA, 12.5 µl 2xSYBR Premix Ex Taq II (Takara Bio, Inc.), 8.5 µl H2O and 2 µl 0.4 µM primers. A two-step method was used due to the 60°C annealing temperature. The reaction consisted of the following: 95°C for 30 sec, 40 cycles of 95°C for 5 sec and 60°C for 30 sec. Each tissue sample was assayed in triplicate. The efficiency of the PCR amplification process was 97–105%. A melting curve analysis was performed for the PCR products of the target genes in order to evaluate primer specificity. Relative quantification of the target gene mRNA expression was conducted using quantification cycle (Cq) with the formula log102−ΔΔCq (43) and normalized to β-actin. The difference in mRNA expression was presented as the relative fold between the groups. A Cq value of >35 was considered to indicate that a specific gene was not expressed.

Table II.

Primers sequences for reverse transcription-quantitative polymerase chain reaction.

Table II.

Primers sequences for reverse transcription-quantitative polymerase chain reaction.

mRNAGenePrimer sequence (5′-3′)Amplicon (bp)
NM-001433IRE1αForward CTCCGAGCCATGAGAAATAAG113
Reverse GGGAAGCGAGATGTGAAGTAG
NM-001079539XBP1sForward AAGTGGTAGATTTAGAAGAAGAGAA200
Reverse ACCTGCTGCGGACTCAG
NM-005080XBP1uForward AGTCCGCAGCACTCAG150
Reverse GGGTCCAAGTTGTCCAGA
NM-033266IRE1βForward TCCCCTTATAGGACCGGAAC147
Reverse GTGACTGGCTGGAGAAGGAG
NM-002457MUC2Forward GACACCATCTACCTCACCCG103
Reverse TGTAGGCATCGCTCTTCTCA
NM-00110β-actinForward AGCACTGTGTTGGCGTACAG116
Reverse CTCTTCCAGCCTTCCTTCCT

[i] IRE1, inositol-requiring enzyme 1; MUC2, mucin 2; XBP1, X-box binding protein 1; s, spliced; u, unspliced; bp, base pairs.

Immunohistological staining for IRE1α, IRE1β and MUC2

Sections (4 µm) of paraffin-embedded tissue samples were mounted on poly-L-lysine-coated slides. IHC was performed using an indirect peroxidase-labelled antibody method as previously described (44). Briefly, the tissue sections were dewaxed in xylene, rehydrated with graded alcohol and antigen retrieval was conducted by microwave-boiling the slides for 10 min in 0.01 mol/l sodium citrate buffer, pH 6.0. Endogenous peroxidase was blocked by incubation in 3% hydrogen peroxide for 10 min. Following washing in distilled water, non-specific binding was blocked by 5% bovine serum albumin (Sigma-Aldrich: Merck Millipore, Darmstadt, Germany) for 20 min at 37°C. The tissue sections were then incubated overnight at 4°C with rabbit polyclonal antibodies against IRE1α (Abcam, Cambridge, UK; dilution, 1:200; cat. no. ab37073) and IRE1β (Abcam; dilution 1:50; cat. no. ab135795), and an anti-MUC2 mouse monoclonal antibody (Abcam; dilution, 1:500; cat. no. ab11197). The antigen-antibody complex was then detected with a biotinylated goat anti-rabbit antibody (Boster Biological Technology Co., Ltd., Wuhan, China; cat. no. BA1101) and an anti-mouse antibody (Boster Biological Technology Co., Ltd.; cat. no. SA1020), subsequently conjugated with streptoavidin-horseradish peroxidase (HRP) (Boster Biological Technology Co., Ltd.; cat. no. SA1022) and visualized by reacting with nickel-enhanced 3,3-diaminobenzidine tetrahydrochloride (Solarbio Science and Technology Co., Ltd.; cat. no. D8230) for color detection. The tissue sections were then counterstained with hematoxylin. The negative control sections were obtained by omitting the primary antibody or by using an unrelated rabbit polyclonal antibody.

The antigen levels in the IHC stained tissue samples were evaluated in 10 random fields (400x magnification) for each section. A total of 100 cells/field were categorized as follows: 0, 0–5 cells were stained; 1, 6–25 cells were stained; 2, 26–50 cells stained; 3, 51–75 cells stained; and 4, 76–100 cells stained. In addition, the staining intensity was scored as follows: 0, no staining; 1, weak staining; 2, moderate staining; 3, intense staining. The intensity score was multiplied by the frequency score, in order to obtain the final score. A final score of ≥6 indicated high expression levels, whereas a score of <6 indicated low expression levels (45).

Western blotting analysis of IRE1β

Protein lysates were prepared from collected tissue samples in radioimmunoprecipitation assay lysis buffer (Solarbio Science and Technology Co., Ltd.) on ice by homogenization with a grinder. The supernatant was obtained following centrifugation at 10,800 × g for 15 min at 4°C. A bicinchoninic acid assay (Solarbio Science and Technology Co., Ltd.,) method was used to determine the protein concentrations. Protein (30 µg) from each tissue sample was denatured and resolved by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis, and then transferred onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA). Following blocking for 1 h at 37°C in 5% skim milk, the membranes were incubated with the anti-IRE1β antibody (Abcam; dilution 1:200; cat. no. ab135795) for 3 h at 37°C, then washed four times in 1X TBST. The membranes were subsequently incubated with HRP-conjugated anti-IgG secondary antibody (Boster Biological Technology Co., Ltd.; dilution, 1:1,000; cat. no. BA1054) and then washed four times in 1X TBST. The proteins were visualized using an enhanced chemiluminescence reagent (Pierce; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. An anti-β-actin mouse monoclonal antibody (Abcam; dilution, 1:3,000; cat. no. ab8226) was used to normalize for the protein loading. The secondary antibody for β-actin was a HRP-conjugated goat anti-mouse IgG (Boster Biological Technology Co., Ltd.; dilution, 1:1,000; cat. no. BA1050). ChemiDoc XRS (Bio-Rad Laboratories, Inc.) was used to capture the images, and the intensity of the images was quantified using ImageJ software v1.48 (National Institutes of Health, Bethesda, MD, USA).

Statistical analysis

A Student's t-test and a Mann-Whitney U-test were used to determined significant differences between the groups. A Wilcoxon signed-rank test was used for non-parametric data. Spearman's bivariate analysis was used to determine the correlation between IRE1β and MUC2 mRNA expression levels. The data are presented as the mean ± standard deviation. All statistical analysis was performed using using the SPSS 19.0 statistical package (SPSS Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant result.

Results

Clinical characteristics

A total of 42 patients were recruited for the current study and the clinical features are summarized in Table I. The ages of the patients ranged from 44–82 years (average, 61.3 years). A total of 18 patients were male and 24 were female. The discrepancy in gender ratio of this study from the China colorectal report may be due to the gender ratio in the local area (4,46).

Expression levels of IRE1α, XBP1, IRE1β and MUC2 mRNA in CRC tissues

XBP1 expression levels are increased in numerous types of cancer, including CRC (8,17,18). During UPR, IRE1α initiates the splicing of XBP1u mRNA to XBP1s, generating an XBP1 transcription factor that regulates a subset of UPR genes to constitute the IRE1α-XBP1 signaling pathway (8,16). RT-qPCR was used to analyze the mRNA expression levels of IRE1α, XBP1u and XBP1s in tissue samples from patients with CRC. The paired colon tissue samples were analyzed in 31 patients for IRE1α mRNA and 12 patients for XBP1u and XBP1 s mRNAs. It was identified that IRE1α, XBP1u and XBP1s mRNAs were expressed at similar levels in the CRC and non-cancerous tissues (Fig. 1A and Table III).

Table III.

XBP1u and XBP1s mRNA expression levels in patients with colorectal cancer.

Table III.

XBP1u and XBP1s mRNA expression levels in patients with colorectal cancer.

Ratio (C/N)

No.PatientGenderAge (years) DifferentiationXBP1uXBP1s
  1C58m44PDC2.50.8
  2C57f65MDC1.01.0
  3C24f53MDC0.80.8
  4C29m64MDC1.11.0
  5C31m61MDC0.90.8
  6C33m61MDC2.02.5
  7C52f61MDC1.10.8
  8C53f60MDC0.50.4
  9C54f52WMDC1.42.5
10C55f68WDC1.11.3
11C56f47WDC5.05.0
12C59f47WDC1.01.4
Mean ± standard deviation 1.1±0.51.0±0.6

[i] XBP1, X-box binding protein 1; s, spliced; u, unspliced; f, female; m, male; PDC, poorly differentiated carcinoma; MDC, moderately differentiated carcinoma; WMDC, well-moderately differentiated carcinoma; WDC, well-differentiated carcinoma; C/N, cancerous tissue/noncancerous tissue.

IRE1β, an analog of IRE1α, is specifically expressed in the epithelium of the gastrointestinal and respiratory tracts; MUC2 expression in the intestine is regulated by IRE1β, but not by IRE1α (27,47). IRE1β and MUC2 mRNA expression levels were evaluated in 35 patients with CRC. The mRNA expression levels of IRE1β and MUC2 in the cancerous tissues were 2.1 and 4.5-fold lower, respectively, compared with in the adjacent non-cancerous colon mucosa (Fig. 1B and 1C). It was identified that MUC2 mRNA expression levels were positively correlated with IRE1β mRNA expression levels (r=0.45; P=0.01; Fig. 1D).

mRNA expression levels of IRE1β, but not IRE1α or MUC2, were associated with lower clinical stages, metastasis and poor differentiation in CRC

To evaluate the clinical significance of changes in the mRNA expression levels of IRE1β, IRE1α and MUC2 in CRC tissues, the association between the mRNA expression levels of these genes and the clinicopathological features of the patients with CRC, were analyzed. It was identified that IRE1β mRNA expression levels were significantly associated with tumor differentiation (P=0.049), lymph node metastasis (P=0.043) and TNM stage (P=0.018) (Table IV), but not with gender (P=0.709), age (P=0.558) and T-stage classification (P=0.384) (48,49) (data not presented). Although the mRNA expression levels of IRE1β in the tumor tissues were low compared with the adjacent normal tissues, in poor-moderately differentiated CRC tissues the IRE1β mRNA expression levels were high as compared with in well-differentiated CRC tissues. Furthermore, those patients with lymphatic metastasis or stage III–IV CRC, had high IRE1β mRNA expression levels, as compared with those patients without lymphatic metastasis or stage I–II CRC. IRE1α and MUC2 mRNA expression levels were not observed to be significantly associated with patient clinicopathological features (Table IV).

Table IV.

IRE1α, IRE1β and MUC2 mRNA expression levels in patients with CRC.

Table IV.

IRE1α, IRE1β and MUC2 mRNA expression levels in patients with CRC.

IRE1α mRNAIRE1β mRNAMUC2 mRNA



VariablesnRatio of C/NP-valuenRatio of C/NP-valuenRatio of C/NP-value
Total patients31 35 35
Clinical stage 0.328 0.018a 0.355
  I+II171.0±0.1 213.7±0.6 201.0±0.4
  III+IV141.3±0.2 141.0±0.3 152.4±1.2
LN metastasis 0.135 0.043 0.692
  Yes121.5±0.1 113.3±0.5 131.5±0.7
  No191.0±0.1 241.0±0.3 221.0±0.4
Differentiation 0.605 0.049a 0.519
  Well91.1±0.1 81.0±0.3 101.0±0.5
  Moderate or Poor221.0±0.1 274.9±0.9 252.0±0.9

a Data showed heterogeneity of variance. Student's t-tests and Mann-Whitney U tests were used to determine the significance of differences between groups. LN, lymph node; C/N, cancerous tissue/non-cancerous tissue; IRE1, inositol-requiring enzyme 1; MUC2, mucin 2. The data are presented as the mean ± standard deviation.

Immunohistochemistry of IRE1α, IRE1β and MUC2 in CRC tissues

ER stress is emerging as an important factor in tumor pathogenesis (8,9). However, to the best of our knowledge, there are no previous reports on the role of IRE1α in the tumorigenesis of CRC. Although it was demonstrated in the current study that the mRNA expression levels of IRE1α are similar in CRC and adjacent normal tissues, as IRE1α regulates ER stress at the protein level, the IRE1α protein expression levels were also evaluated using IHC (Fig. 2A and B). IRE1α was expressed in the plasma membrane of non-cancerous colon epithelium and IRE1α was stained at apical surface of cancerous epithelial cells in the colon. In submucosa, certain unidentified cells also had positive nuclei staining for IRE1α. Again, there was no significant difference in IRE1α protein expression levels between CRC and non-cancerous tissue (Fig. 2C).

Aberrant mucin accumulation in the goblet cells of mouse colons was observed when the IRE1β gene was deleted (33), and IRE1β was revealed to be required for airway mucin excretion (27). In the current study, it was also identified that the IRE1β protein was expressed in colon epithelial cells, including in goblet cells. However, by contrast with a prior animal study (33), the results did not demonstrate a predominant IRE1β-positive staining in human colon goblet cells. Above the nuclei of the epithelial cells, a strong positive staining was observed in non-cancerous tissue samples (Fig. 2D). In the cytoplasm of CRC tissues, IRE1β positive staining was comparatively low (Fig. 2E and F); in normal and cancerous tissues, there were unidentified cells that were weakly stained in the submucosa. Similar to the mRNA expression of IRE1β, the downregulation of IRE1β was significantly associated with tumor differentiation (P=0.047), lymph node metastasis (P=0.009) and TNM stage (P=0.001) (Table V). No significant association was identified between IRE1β expression levels and other clinicopathological factors, including gender (P=0.998), age (P=0.115) and tumor size (P=0.742) (data not presented).

Table V.

Association between the immunohistochemical staining of IRE1β and the clinical characteristics of patients with colorectal carcinoma (n=35).

Table V.

Association between the immunohistochemical staining of IRE1β and the clinical characteristics of patients with colorectal carcinoma (n=35).

IRE1β

VariablePatients, nLow, nHigh, nP-value
Clinical stage 0.001
  I+II21174
  III+IV14212
Lymph node metastasis 0.009
  Yes1129
  No124177
Pathologic differentiation 0.047
  Well871
  Moderate or Poor271215

[i] Differences were analyzed by χ2 test. IRE1, inositol-requiring enzyme 1.

MUC2 protein is present in the goblet cells of the colon epithelium (34,50). It has been reported that the IHC staining of MUC2 in goblet cells exhibits whole-cell filled or peri-nuclear staining patterns (51,52). In the present study, the MUC2 staining pattern was half-filled in the goblet cells, and MUC2 expression levels were significantly decreased in these CRC tissues (P<0.001; Fig. 2G-I). Similar to MUC2 mRNA expression levels, the MUC2 protein expression levels, as quantified by IHC staining, were not significantly associated with the clinicopathological factors of patients with CRC (data not presented).

Western blot analysis of IRE1β expression in CRC tissues

The protein expression levels of IRE1β in 13 paired CRC and adjacent normal tissue samples were evaluated using western blotting. Similar to the expression levels of IRE1β in the mRNA and IHC results, a significant difference was identified in the IRE1β protein expression levels, which were 8-fold lower in cancerous tissues, compared with the adjacent normal control tissues (Fig. 3A and B; P<0.001), which indicated that the expression level was decreased in CRC tissues at the transcriptional and translational levels.

Discussion

ER stress affects tumorigenesis and elevation of the XBP1 transcription factor has previously been reported in numerous types of cancer, including CRC (9,19,21). As XBP1 mRNA is processed by IRE1α, the IRE1α, XBP1u and XBP1s mRNA expression levels, and IRE1α protein expression levels, were analysed in cancerous and adjacent normal colon tissue samples; however, no significant difference was observed between the two tissues. Although Fujimoto et al (21) identified that XBP1 gene and protein expression levels were increased in 4/5 CRC tissues, the sample size in their study was small. In the current study, XBP1u and XBP1s gene expression levels were analyzed in 12 cases of CRC. Additionally, the IRE1α mRNA and protein expression levels were evaluated and no significant changes were observed in CRC tissues, compared with the adjacent non-cancerous tissues. Therefore, the results suggest that the IRE1α-XBP1 signaling pathway does not have an important role in the progression of CRC.

Colon epithelial cells also express IRE1β, an analog of the ubiquitous IRE1α, which has differing functions to IRE1β with regard to cell survival and apoptosis (2932,47). IRE1β is inefficient at cleaving XBP1 mRNA and directly interacts with unfolded proteins in the ER by association with glucose-regulated protein 78, which is crucial regulator of ER stress (26). Therefore, the IRE1β expression levels in patients with CRC were also analyzed. The present study demonstrated that the mRNA and protein expression levels of IRE1β were significantly decreased in CRC tissues. It is possible that the decreased expression levels reflect the transition of normal epithelial cells to cancerous cells. The IHC results revealed positive IRE1β staining in all epithelial cells, suggesting that IRE1β affects not only goblet cells, but also epithelial cells. A previous study reported that IRE1β regulates lipid absorption by mediating the transcription of microsomal triacylglycerol transfer protein expression in the colon epithelium (53). However, the association between the change in lipid absorption and the tumorigenesis of CRC requires further study for elucidation. It was hypothesized that decreased IRE1β expression levels may be associated with tumorigenesis, as IRE1β is a protective factor for colitis and is involved in cell apoptosis (26,32). Intestinal inflammation and cell apoptosis are putatively associated with occurrence of CRC (54). Analysis of the mRNA expression levels of IRE1β in tumor tissues revealed that higher IRE1β mRNA expression levels were significantly associated with poor tumor differentiation, lymph node metastasis and later TNM stage. The results suggest that IRE1β may be involved in the development of CRC. The results of the present study are concordant with the in vitro study conducted by Dai et al (55), who identified that the mRNA expression levels of IRE1β were high in undifferentiated Caco-2 cells, and were correspondingly decreased following the differentiation of these cells (55).

Two previous studies have reported that IRE1β is an important regulator of MUC2 secretion (28,33). In animal model studies, IRE1β/ mice were more susceptible to dextran sodium sulfate (DSS) -induced colitis, compared with wild type mice (26). The loss of intestinal mucin also increases the sensitivity of mice to DSS-induced colitis (56). IRE1β is essential for UPR in goblet cells, and MUC2 is its target protein (27,33). In the current study, MUC2 expression levels were revealed to be decreased in colorectal adenocarcinomas. The results are concordant with previous studies, in which nonmucinous CRC tissues were negative for MUC2 expression (57,58). This may be due to a decreased number of goblet cells in non-mucinous CRC tissues, as the expression of MUC2 was positively correlated with the mRNA expression levels of IRE1β. However, it has previously been revealed that the methylation of the MUC2 promoter and the loss of functional tumor protein 53 may decrease MUC2 expression levels in CRC tissues (59,60). Correlation analysis in the present study indicated that the expression levels of MUC2 were positively associated with the mRNA expression levels of IRE1β. IRE1β and MUC2 act as protective factors to maintain the intestinal physiological homeostasis, and the suppression of the two proteins may be associated with the tumorigenesis of CRC.

In conclusion, the results of the current study revealed that the decreased expression levels of IRE1β in CRC tissues were associated with clinical features of patients with CRC. IRE1β gene expression levels were positively correlated with those of MUC2, indicating that IRE1β and MUC2 may be involved in the tumorigenesis of CRC. The association of IRE1β and MUC2, as well as the significance of IRE1β in CRC, require further studies in order to identify novel therapeutic targets for this type of cancer.

Acknowledgements

The authors would like to thank Dr Yonggan Fan, Dr Xianli Liu and Dr Wenchao Zhao for their help with patient recruitment and pathological consultation in the present study. This study was supported by a grant (grant no. 81370487 to Q.Gao) from The National Natural Science Foundation of China.

Glossary

Abbreviations

Abbreviations:

ATF6

activating transcription factor 6

CRC

colorectal cancer

ER

endoplasmic reticulum

IRE1

inositol-requiring enzyme 1

MUC

mucin

PERK

protein-kinase-RNA-like-ER kinase

RIDD

regulated IRE1-dependent decay

UPR

unfolded protein response

XBP1

X-box binding protein 1

References

1 

Fleming M, Ravula S, Tatishchev SF and Wang HL: Colorectal carcinoma: Pathologic aspects. J Gastrointest Oncol. 3:153–173. 2012.PubMed/NCBI

2 

Zhao P, Dai M, Chen W and Li N: Cancer trends in China. Jpn J Clin Oncol. 40:281–285. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Li L and Ma BB: Colorectal cancer in Chinese patients: Current and emerging treatment options. Onco Targets Ther. 7:1817–1828. 2014.PubMed/NCBI

4 

Dai Z, Zheng RS, Zou XN, Zhang SW, Zeng HM, Li N and Chen WQ: Analysis and prediction of colorectal cancer incidence trend in China. Zhonghua Yu Fang Yi Xue Za Zhi. 46:598–603. 2012.(In Chinese). PubMed/NCBI

5 

Stintzing S: Management of colorectal cancer. F1000Prime Rep. 6:1082014. View Article : Google Scholar : PubMed/NCBI

6 

Kim ER and Kim YH: Clinical application of genetics in management of colorectal cancer. Intest Res. 12:184–193. 2014. View Article : Google Scholar : PubMed/NCBI

7 

SEER Stat Fact Sheets: Colon and Rectum Cancer). National Cancer Institute; Bethesda, MD: https://seer.cancer.gov/statfacts/html/colorect.htmlSeptember 1–2015

8 

Manié SN, Lebeau J and Chevet E: Cellular mechanisms of endoplasmic reticulum stress signaling in health and disease. 3. Orchestrating the unfolded protein response in oncogenesis: An update. Am J Physiol Cell Physiol. 307:C901–C907. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Dicks N, Gutierrez K, Michalak M, Bordignon V and Agellon LB: Endoplasmic reticulum stress, genome damage, and cancer. Front Oncol. 5:112015. View Article : Google Scholar : PubMed/NCBI

10 

Parmar VM and Schröder M: Sensing endoplasmic reticulum stress. Adv Exp Med Biol. 738:153–168. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Gardner BM, Pincus D, Gotthardt K, Gallagher CM and Walter P: Endoplasmic reticulum stress sensing in the unfolded protein response. Cold Spring Harb Perspect Biol. 5:a0131692013. View Article : Google Scholar : PubMed/NCBI

12 

Gao Q, Esworthy RS, Kim BW, Synold TW, Smith DD and Chu FF: Atherogenic diets exacerbate colitis in mice deficient in glutathione peroxidase. Inflamm Bowel Dis. 16:2043–2054. 2010. View Article : Google Scholar : PubMed/NCBI

13 

McMillan DR, Gething MJ and Sambrook J: The cellular response to unfolded proteins: Intercompartmental signaling. Curr Opin Biotechnol. 5:540–545. 1994. View Article : Google Scholar : PubMed/NCBI

14 

Papandreou I, Denko NC, Olson M, Van Melckebeke H, Lust S, Tam A, Solow-Cordero DE, Bouley DM, Offner F, Niwa M and Koong AC: Identification of an Ire1alpha endonuclease specific inhibitor with cytotoxic activity against human multiple myeloma. Blood. 117:1311–1314. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Greenman C, Stephens P, Smith R, Dalgliesh GL, Hunter C, Bignell G, Davies H, Teague J, Butler A, Stevens C, et al: Patterns of somatic mutation in human cancer genomes. Nature. 446:153–158. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Nakamura D, Tsuru A, Ikegami K, Imagawa Y, Fujimoto N and Kohno K: Mammalian ER stress sensor IRE1β specifically down-regulates the synthesis of secretory pathway proteins. FEBS Lett. 585:133–138. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Koong AC, Chauhan V and Romero-Ramirez L: Targeting XBP-1 as a novel anti-cancer strategy. Cancer Biol Ther. 5:756–759. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Yoshida H, Oku M, Suzuki M and Mori K: pXBP1(U) encoded in XBP1 pre-mRNA negatively regulates unfolded protein response activator pXBP1(S) in mammalian ER stress response. J Cell Biol. 172:565–575. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Fujimoto T, Onda M, Nagai H, Nagahata T, Ogawa K and Emi M: Upregulation and overexpression of human X-box binding protein 1 (hXBP-1) gene in primary breast cancers. Breast Cancer. 10:301–306. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Shuda M, Kondoh N, Imazeki N, Tanaka K, Okada T, Mori K, Hada A, Arai M, Wakatsuki T, Matsubara O, et al: Activation of the ATF6, XBP1 and grp78 genes in human hepatocellular carcinoma: A possible involvement of the ER stress pathway in hepatocarcinogenesis. J Hepatol. 38:605–614. 2003. View Article : Google Scholar : PubMed/NCBI

21 

Fujimoto T, Yoshimatsu K, Watanabe K, Yokomizo H, Otani T, Matsumoto A, Osawa G, Onda M and Ogawa K: Overexpression of human X-box binding protein 1 (XBP-1) in colorectal adenomas and adenocarcinomas. Anticancer Res. 27:127–131. 2007.PubMed/NCBI

22 

Takahashi S, Suzuki S, Inaguma S, Ikeda Y, Cho YM, Nishiyama N, Fujita T, Inoue T, Hioki T, Sugimura Y, et al: Down-regulation of human X-box binding protein 1 (hXBP-1) expression correlates with tumor progression in human prostate cancers. Prostate. 50:154–161. 2002. View Article : Google Scholar : PubMed/NCBI

23 

Chen Y and Brandizzi F: IRE1: ER stress sensor and cell fate executor. Trends Cell Biol. 23:547–555. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Coelho DS and Domingos PM: Physiological roles of regulated Ire1 dependent decay. Front Genet. 5:762014. View Article : Google Scholar : PubMed/NCBI

25 

Welihinda AA, Tirasophon W and Kaufman RJ: The cellular response to protein misfolding in the endoplasmic reticulum. Gene Expr. 7:293–300. 1999.PubMed/NCBI

26 

Bertolotti A, Wang X, Novoa I, Jungreis R, Schlessinger K, Cho JH, West AB and Ron D: Increased sensitivity to dextran sodium sulfate colitis in IRE1beta-deficient mice. J Clin Invest. 107:585–593. 2001. View Article : Google Scholar : PubMed/NCBI

27 

Martino MB, Jones L, Brighton B, Ehre C, Abdulah L, Davis CW, Ron D, O'Neal WK and Ribeiro CM: The ER stress transducer IRE1β is required for airway epithelial mucin production. Mucosal Immunol. 6:639–654. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Zhang HS, Chen Y, Fan L, Xi QL, Wu GH, Li XX, Yuan TL, He SQ, Yu Y, Shao ML, et al: The Endoplasmic Reticulum Stress Sensor IRE1α in Intestinal Epithelial Cells Is Essential for Protecting against Colitis. J Biol Chem. 290:15327–15336. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Lin JH, Li H, Yasumura D, Cohen HR, Zhang C, Panning B, Shokat KM, Lavail MM and Walter P: IRE1 signaling affects cell fate during the unfolded protein response. Science. 318:944–949. 2007. View Article : Google Scholar : PubMed/NCBI

30 

Hetz C: The unfolded protein response: Controlling cell fate decisions under ER stress and beyond. Nat Rev Mol Cell Biol. 13:89–1026. 2012.PubMed/NCBI

31 

Hetz C and Glimcher LH: Fine-tuning of the unfolded protein response: Assembling the IRE1alpha interactome. Mol Cell. 35:551–561. 2009. View Article : Google Scholar : PubMed/NCBI

32 

Iwawaki T, Hosoda A, Okuda T, Kamigori Y, Nomura-Furuwatari C, Kimata Y, Tsuru A and Kohno K: Translational control by the ER transmembrane kinase/ribonuclease IRE1 under ER stress. Nat Cell Biol. 3:158–164. 2001. View Article : Google Scholar : PubMed/NCBI

33 

Tsuru A, Fujimoto N, Takahashi S, Saito M, Nakamura D, Iwano M, Iwawaki T, Kadokura H, Ron D and Kohno K: Negative feedback by IRE1β optimizes mucin production in goblet cells. Proc Natl Acad Sci USA. 110:2864–2869. 2013. View Article : Google Scholar : PubMed/NCBI

34 

Johansson ME and Hansson GC: Mucus and the goblet cell. Dig Dis. 31:305–309. 2013. View Article : Google Scholar : PubMed/NCBI

35 

Johansson ME, Phillipson M, Petersson J, Velcich A, Holm L and Hansson GC: The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria. Proc Natl Acad Sci USA. 105:15064–15069. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Kawashima H: Roles of the gel-forming MUC2 mucin and its O-glycosylation in the protection against colitis and colorectal cancer. Biol Pharm Bull. 35:1637–1641. 2012. View Article : Google Scholar : PubMed/NCBI

37 

Van der Sluis M, De Koning BA, De Bruijn AC, Velcich A, Meijerink JP, Van Goudoever JB, Büller HA, Dekker J, Van Seuningen I, Renes IB and Einerhand AW: Muc2-deficient mice spontaneously develop colitis, indicating that MUC2 is critical for colonic protection. Gastroenterology. 131:117–129. 2006. View Article : Google Scholar : PubMed/NCBI

38 

Velcich A, Yang W, Heyer J, Fragale A, Nicholas C, Viani S, Kucherlapati R, Lipkin M, Yang K and Augenlicht L: Colorectal cancer in mice genetically deficient in the mucin Muc2. Science. 295:1726–1729. 2002. View Article : Google Scholar : PubMed/NCBI

39 

Imai Y, Yamagishi H, Fukuda K, Ono Y, Inoue T and Ueda Y: Differential mucin phenotypes and their significance in a variation of colorectal carcinoma. World J Gastroenterol. 19:3957–3968. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Debunne H and Ceelen W: Mucinous differentiation in colorectal cancer: Molecular, histological and clinical aspects. Acta Chir Belg. 113:385–390. 2013.PubMed/NCBI

41 

Edge SB and Compton CC: The American Joint Committee on Cancer: The 7th edition of the AJCC cancer staging manual and the future of TNM. Ann Surg Oncol. 17:1471–1474. 2010. View Article : Google Scholar : PubMed/NCBI

42 

Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M and Rozen SG: Primer3-new capabilities and interfaces. Nucleic Acids Res. 40:e1152012. View Article : Google Scholar : PubMed/NCBI

43 

Xu FX, Su YL, Zhang H, Kong JY, Yu H and Qian BY: Prognostic implications for high expression of MiR-25 in lung adenocarcinomas of female non-smokers. Asian Pac J Cancer Prev. 15:1197–1203. 2014. View Article : Google Scholar : PubMed/NCBI

44 

Gao Q, Meijer MJ, Kubben FJ, Sier CF, Kruidenier L, van Duijn W, van den Berg M, van Hogezand RA, Lamers CB and Verspaget HW: Expression of matrix metalloproteinases-2 and −9 in intestinal tissue of patients with inflammatory bowel diseases. Dig Liver Dis. 37:584–592. 2005. View Article : Google Scholar : PubMed/NCBI

45 

Liu C, Huang Z, Jiang H and Shi F: The sirtuin 3 expression profile is associated with pathological and clinical outcomes in colon cancer patients. Biomed Res Int. 2014:8712632014.PubMed/NCBI

46 

Liu S, Zheng R, Zhang M, Zhang S, Sun X and Chen W: Incidence and mortality of colorectal cancer in China, 2011. Chin J Cancer Res. 27:22–28. 2015.PubMed/NCBI

47 

Imagawa Y, Hosoda A, Sasaka S, Tsuru A and Kohno K: RNase domains determine the functional difference between IRE1alpha and IRE1beta. FEBS Lett. 582:656–660. 2008. View Article : Google Scholar : PubMed/NCBI

48 

Piemonte M: [TNM - classification of malignant tumors (VI edition - 2002). Innovations in the classification of head and neck neoplasms]. Acta Otorhinolaryngol Ital. 23:132–135. 2003.(In Italian). PubMed/NCBI

49 

Wei Q, Huang X, Fu B, Liu J, Zhong L, Yang Q and Zhao T: IMP3 expression in biopsy specimens of colorectal cancer predicts lymph node metastasis and TNM stage. Int J Clin Exp Pathol. 8:11024–3213. 2015.PubMed/NCBI

50 

Kesari MV, Gaopande VL, Joshi AR, Babanagare SV, Gogate BP and Khadilkar AV: Immunohistochemical study of MUC1, MUC2 and MUC5AC in colorectal carcinoma and review of literature. Indian J Gastroenterol. 34:63–67. 2015. View Article : Google Scholar : PubMed/NCBI

51 

Walsh MD, Clendenning M, Williamson E, Pearson SA, Walters RJ, Nagler B, Packenas D, Win AK, Hopper JL, Jenkins MA, et al: Expression of MUC2, MUC5AC, MUC5B, and MUC6 mucins in colorectal cancers and their association with the CpG island methylator phenotype. Mod Pathol. 26:1642–1656. 2013. View Article : Google Scholar : PubMed/NCBI

52 

Okudaira K, Kakar S, Cun L, Choi E, Wu Decamillis R, Miura S, Sleisenger MH, Kim YS and Deng G: MUC2 gene promoter methylation in mucinous and non-mucinous colorectal cancer tissues. Int J Oncol. 36:765–775. 2010.PubMed/NCBI

53 

Iqbal J, Dai K, Seimon T, Jungreis R, Oyadomari M, Kuriakose G, Ron D, Tabas I and Hussain MM: IRE1beta inhibits chylomicron production by selectively degrading MTP mRNA. Cell Metab. 7:445–455. 2008. View Article : Google Scholar : PubMed/NCBI

54 

Terzić J, Grivennikov S, Karin E and Karin M: Inflammation and colon cancer. Gastroenterology. 138:2101–2114.e5. 2010. View Article : Google Scholar : PubMed/NCBI

55 

Dai K, Khatun I and Hussain MM: NR2F1 and IRE1beta suppress microsomal triglyceride transfer protein expression and lipoprotein assembly in undifferentiated intestinal epithelial cells. Arterioscler Thromb Vasc Biol. 30:568–574. 2010. View Article : Google Scholar : PubMed/NCBI

56 

Heazlewood CK, Cook MC, Eri R, Price GR, Tauro SB, Taupin D, Thornton DJ, Png CW, Crockford TL, Cornall RJ, et al: Aberrant mucin assembly in mice causes endoplasmic reticulum stress and spontaneous inflammation resembling ulcerative colitis. PLoS Med. 5:e542008. View Article : Google Scholar : PubMed/NCBI

57 

Manne U, Weiss HL and Grizzle WE: Racial differences in the prognostic usefulness of MUC1 and MUC2 in colorectal adenocarcinomas. Clin Cancer Res. 6:4017–4025. 2000.PubMed/NCBI

58 

Matsuda K, Masaki T, Watanabe T, Kitayama J, Nagawa H, Muto T and Ajioka Y: Clinical significance of MUC1 and MUC2 mucin and p53 protein expression in colorectal carcinoma. Jpn J Clin Oncol. 30:89–94. 2000. View Article : Google Scholar : PubMed/NCBI

59 

Gratchev A, Siedow A, Bumke-Vogt C, Hummel M, Foss HD, Hanski ML, Kobalz U, Mann B, Lammert H, Mansmann U, et al: Regulation of the intestinal mucin MUC2 gene expression in vivo: Evidence for the role of promoter methylation. Cancer Lett. 168:71–80. 2001. View Article : Google Scholar : PubMed/NCBI

60 

Ookawa K, Kudo T, Aizawa S, Saito H and Tsuchida S: Transcriptional activation of the MUC2 gene by p53. J Biol Chem. 277:48270–48275. 2002. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

March-2017
Volume 13 Issue 3

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Jiang Y, Zhou Y, Zheng Y, Guo H, Gao L, Chen P, Feng D, Qi R, Li X, Chang Y, Chang Y, et al: Expression of inositol‑requiring enzyme 1β is downregulated in colorectal cancer. Oncol Lett 13: 1109-1118, 2017.
APA
Jiang, Y., Zhou, Y., Zheng, Y., Guo, H., Gao, L., Chen, P. ... Gao, Q. (2017). Expression of inositol‑requiring enzyme 1β is downregulated in colorectal cancer. Oncology Letters, 13, 1109-1118. https://doi.org/10.3892/ol.2017.5590
MLA
Jiang, Y., Zhou, Y., Zheng, Y., Guo, H., Gao, L., Chen, P., Feng, D., Qi, R., Li, X., Chang, Y., Chu, F., Gao, Q."Expression of inositol‑requiring enzyme 1β is downregulated in colorectal cancer". Oncology Letters 13.3 (2017): 1109-1118.
Chicago
Jiang, Y., Zhou, Y., Zheng, Y., Guo, H., Gao, L., Chen, P., Feng, D., Qi, R., Li, X., Chang, Y., Chu, F., Gao, Q."Expression of inositol‑requiring enzyme 1β is downregulated in colorectal cancer". Oncology Letters 13, no. 3 (2017): 1109-1118. https://doi.org/10.3892/ol.2017.5590