An oncogenic function of retinoic acid receptor‑α in the development of laryngeal squamous cell carcinoma

  • Authors:
    • Cheng‑Fu Cai
    • Cun‑Shan Liu
    • Han‑Jing Shang‑Guan
    • Cai‑Hong Yang
    • Xian‑Yang Luo
    • Dong‑Yan Shen
    • Shu‑Yu Yang
  • View Affiliations

  • Published online on: October 16, 2017     https://doi.org/10.3892/ol.2017.7194
  • Pages: 7896-7902
Metrics: HTML 0 views | PDF 0 views     Cited By (CrossRef): 0 citations

Abstract

The aberrant expression of retinoic acid receptor‑α (RARα) has been reported in various types of cancer. However, its association with the prognosis and development of laryngeal squamous cell carcinoma (LSCC) has not yet been determined. Therefore, the present study aimed to examine the expression and function of RARα in patients with LSCC. The expression of RARα in LSCC tissues was investigated using immunostaining. An MTT assay and flow cytometry analysis were also performed to investigate the function of RARα in the proliferation and cell cycle of LSCC cells. The expression of RARα was significantly elevated in LSCC tissues compared with adjacent noncancerous tissues (78.1 vs. 6.3%, P<0.05). The overexpression of RARα was associated with poorly differentiated features of LSCC (P<0.05). Furthermore, the downregulation of RARα inhibited the proliferation of LSCC cells, and arrested the cell cycle at the G1 phase via upregulation of cyclin dependent kinase inhibitor 1A, which may be associated with inhibition of the protein kinase B signaling pathway. Therefore, the overexpression of RARα may contribute to the development of LSCC through the regulation of the cell cycle. The results of the present study provide evidence that RARα serves an important function in LSCC development and may be a potential therapeutic target or prognostic predictor for LSCC.

Introduction

Laryngeal carcinoma, of which >95% of cases are laryngeal squamous cell carcinoma (LSCC), is a prevalent malignancy of the head and neck, with an incidence of 3.5–5.5/100,000 people and a mortality rate of 2.1–2.4 per 100,000 people worldwide in 2008 (1,2). Although there have been significant improvements in terms of diagnosis and treatment, the clinical outcome of therapy for patients with LSCC, particularly those with advanced stages of the disease, remains poor (3). Therefore, it is necessary to explore the molecular mechanisms of LSCC, which will contribute to increasing survival rates and improving prognosis.

Previous studies have revealed that retinoic acid receptors (RARs) serve important functions in various types of cancer (4). The RAR family contains three different subtypes (namely, RARα, RARβ and RARγ). As RARs are important members of the nuclear receptor superfamily, the three subtypes function as transcription factors that are essential in embryonic development, the maintenance of differentiated cellular phenotypes, metabolism and cell death (5). The three RAR subtypes are encoded by different genes and they differ in terms of structure and distribution as well as possessing unique functions. Increasingly, the evidence has indicated that the aberrant expression of RARα is present in various types of cancer. RARα was revealed to regulate the cell differentiation of neurocytoma through the activation of the transcription of associated target genes (6). The activation of RARα competed with the fusion protein promyelocytic leukemia gene-RARα, induced by a mutation to combine with the Fas cell surface death receptor domain structure, promoting the apoptosis of myeloid leukemia (7). The activation of RARα also promoted cell cycle arrest and the apoptotic process in lymphoma cells through the upregulation of reactive oxygen species (8). The protein stability of RARα, enhanced by ubiquitin, inhibited the proliferation of gastric cancer cells (9). The contribution of RARα to the development of hepatocellular carcinoma was associated with its regulation of cytochrome P450 family 1 subfamily A member 1 expression (10,11). RARα is also involved in the development of breast cancer and prostate carcinoma (1214). However, little is known about the expression and function of RARα in human LSCC.

In the present study, the function and mechanisms of RARα in primary LSCC tissues and adjacent normal tissues were investigated. It was revealed that the overexpression of RARα in LSCC tissues promoted the proliferation of leukocyte common antigen (LCA) cells through the regulation of the cell cycle, with definitive clinical significance. The results of the present study may provide a reference to gain additional insight into the potential function of RARα in the development of LCA, suggesting a potential target for LSCC therapy.

Materials and methods

Patients and tissue samples

Fresh human laryngeal carcinoma and adjacent noncancerous tissues were obtained from 32 patients who underwent surgery at the First Affiliated Hospital of Xiamen University (Xiamen, China). Tumor tissues and adjacent non-tumor tissues were sampled and immediately soaked in formalin overnight, and then paraffin embedded. The pathological characteristics were confirmed by pathological examination. The present study was approved by the ethics committee of the First Affiliated Hospital of Xiamen University, and all patients provided written informed consent prior to participation. None of the patients with LSCC were treated with radiotherapy, chemotherapy or other types of therapy prior to surgery. Metastatic tumors from other tissues were excluded from the study. The clinicopathological characteristics are presented in Table I.

Table I.

Associations between RARα and clinical features of laryngeal squamous cell carcinoma.

Table I.

Associations between RARα and clinical features of laryngeal squamous cell carcinoma.

RARα

FeaturesNLowHighχ2P-value
Age, years 0.01850.8918
  <5913310
  >6019415
Sex 0.02610.8716
  Male28622
  Female  41  3
Pathologic differentiation 6.81830.0331a
  High146  8
  Middle  81  7
  Low10010
T stage 0.47800.9237
  T1  71  6
  T213310
  T3  92  7
  T4  31  2
Lymph node metastasis 1.01350.3141
  N019316
  N+134  9
Distant metastasis 0.98740.3204
  M030624
  M+  21  1
Clinical stage 0.56440.9045
  1  61  5
  214311
  3113  8
  4  10  1

a P<0.05 was considered to indicate a statistically significant difference. RAR, retinoic acid receptors.

Cell culture

The LSCC cell line AMC-HN-8 purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Science (Shanghai, China). Cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) and antibiotics (100 U/ml penicillin and 100 mg/ml streptomycin) at 37°C in a humidified atmosphere of 5% CO2.

Cell transfection

RARα-specific small interfering (si)RNA (siRARα), 5′-AUCUCUUCAGAACUGCUGCUCUGGG-3′ and the Stealth RNAi™ siRNA negative control (siCtrl), 5′-UAUCCUUACGAGUACCUUGCGGCUG-3′ were designed and obtained from Invitrogen; Thermo Fisher Scientific, Inc. LSCC cells were seeded in 6 well plates at a density of 0.5×106 cells per well. siRARα and siCtrl were transfected into cells using the LipoRNAiMAX transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Following transfection at 37°C in a humidified atmosphere with 5% CO2 for 24 h, cells were collected for subsequent experiments.

Cell proliferation assay

Cell proliferation was analyzed using an MTT assay (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). The cells were seeded at a density of 5×103 cells per well into 96-well plates overnight. Following the transfection of cells with siRARα and siCtrl, 20 µl MTT (5 mg/ml) was added to each well, and the cells were cultured for a further 4 h at 37°C. Then the formazan crystals formed were dissolved in DMSO. The absorbance was measured at 490 nm using an ELISA microplate reader. All experiments were performed in triplicate.

Colony formation

A total of 600 AMC-HN-8 cells were cultured in 6-well plates for 14 days and then fixed and stained with 0.005% crystal violet for 30 min at room temperature. Colonies >100 µm in diameter were counted under a light microscope (Olympus BH-2, Olympus Corporation, Tokyo, Japan).

Reverse transcription quantitative RT-(q)PCR

Total RNA was extracted from cells using an RNA Extraction kit (cat. no. DP405-02; Tiangen, Beijing, China) according to manufacturer's protocol. Reverse transcription was carried out using the SuperScript III First-Strand Synthesis system (Invitrogen; Thermo Fisher Scientific, Inc.) for qPCR. The qPCR was carried out by ABI 7500 Fast Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) with SYBR-Green (Promega Corporation, Madison, WI, USA) as a fluorophore. GAPDH was used as a control. The primer sequences are listed in Table II. All experiments were performed in triplicate, and the data were relatively calculated using the 2−ΔΔCq method (15).

Table II.

Primer sequences for reverse transcription-quantitative polymerase chain reaction analysis.

Table II.

Primer sequences for reverse transcription-quantitative polymerase chain reaction analysis.

GeneSense (5′-3′)Antisense (5′-3′)
RARα AATACACTACGAACAACAGC CGAACTCCACAGTCTTAATG
P21 CTAGTTCTACCTCAGGCAGCT GTCGCTGGACGATTTGAGG
P27 GTTAGCGGAGCAATGCGC CAGGCTTCTTGGGCGTCTG
Cyclin A AAGCACTCCCTGACTGTGG ACTGATGTTTCTTGGTGAC
Cyclin B CCTCAACCATCCTGGCTGCG CTGTTCTTGGCCTCAGTCC
Cyclin D CCGAGTCACCAGGAACTCGA AGGACAGACTCCGCTGTGC
Cyclin E AATGTCAAGACGAAGTAGCC ATTTCCTCAAGTTTGGCTGCA

[i] RARα, retinoic acid receptor-α; P21, cyclin dependent kinase inhibitor 1A; P27, cycin dependent kinase inhibitor 1B.

Western blotting

Whole-cell lysates were prepared in lysis buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 50 mM NaF, 1 mM Na3VO4, 30 mM sodium pyrophosphate, 0.5% NP-40 and 0.5 mM PMSF (Sigma-Aldrich; Merck KGaA) supplemented with EDTA-free protease inhibitor cocktail (Roche Diagnostics, Basel, Switzerland), and insoluble debris was pelleted by centrifugation for 20 min at 4°C and 13,000 × g and removed. Protein concentration was determined by Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA), and lysate proteins denatured by boiling for 5 min in reducing SDS-sample buffer. Lysate proteins (15 µg total protein/lane) were separated by 12% SDS-PAGE and transferred to polyvinylidene fluoride membranes (PVDF, Millipore, Billerica, MA, USA). Membranes were blocked in 7% bovine serum albumin in TBS and Tween-20 (TBST) for 1 h at room temperature, and probed overnight at 4°C in primary antibody solutions (RARα, RARβ and RARγ; Abcam, Cambridge, UK; dilution, 1:1,000) [cyclin-dependent kinase inhibitor 1A (p21), proliferating cell nuclear antigen (PCNA), protein kinase B (AKT), phosphorylated (p)-AKT and GAPDH (dilution, 1:500; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) in TBST. They were then washed in TBST 3 times for 5 min, and incubated in TBST solution containing 25% (v/v) non-fat dry milk powder and goat anti-rabbit (cat. no., 31430) and goat anti-mouse (cat. no. 31460) secondary antibodies (1:300) conjugated to horseradish peroxidase (Invitrogen; Thermo Fisher Scientific, Inc.) for 1 h at room temperature. Finally, the membranes were washed in TBST 3 time for 5 min, and bands imaged using Western Lightning Plus-ECL (PerkinElmer, Inc., Waltham, MA, USA) and HyBlot ES autoradiography film (Denville Scientific Inc.). The band intensities for western blot analysis were quantified using ImageJ 1.48 software (National Institutes of Health, Bethesda, MD, USA) and normalized to GAPDH. All experiments were performed in triplicate.

Hematoxylin and eosin staining (H&E) and immunohistochemistry (IHC)

LSCC and the adjacent noncancerous specimens were fixed in 10% formalin for 24 h at room temperature, paraffin embedded and cut into 3-µm thick sections for H&E or IHC. The H&E staining were performed according to manufacturer's protocol of H&E Staining kit (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). IHC staining using anti-RARα antibody (1:300; cat. no. ab117728; Abcam) was detected using the EliVisionTM Plus kit (Fuzhou Maixin Biotech Co., Ltd., Fuzhou, China) according to the manufacturer's protocol. PBS without primary antibody was used as the negative control. The IHC staining result was evaluated based on the proportion of stained tumor cells. RARα-positive tumor cells were counted in 10 randomly selected high power fields under a light microscope (Olympus BH-2; Olympus Corporation) at a magnification of ×400 and was evaluated according to the following criteria: <5% was defined as -; 5–25% as +; 25–50% as ++; >50% as +++. Expression of RARα protein was categorized as low (− to +) or high (++ to +++).

Cell cycle analysis

To detect the cell cycle distribution, cells were collected following transfection with siRARα or siCtrl at 37°C for 48 h and washed twice with ice cold PBS, and then fixed in ice-cold 70% ethanol at 4°C overnight. Following centrifugation for 5 min at 4°C and 2,000 × g, the cells were resuspended in 100 µg/ml RNase A at 37°C for 30 min and subsequently stained with 50 µg/ml propidium iodide (Sangon Biotech Co., Ltd., Shanghai, China) at 4°C for 30 min in the dark. The cells were analyzed using a FACScan flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) at 488 nm and the data was analyzed using ModFit 3.3 (Verity Software House, Topsham, ME, USA) software.

Statistical analysis

Data analysis was conducted using SPSS software (version 16.0; SPSS, Inc., Chicago, IL, USA). Continuous data was expressed as the mean ± the standard error of the mean and analyzed using one-way analysis of variance with a Tukey's post hoc test, whilst χ2 or Fisher's exact tests were used to examine the association between RARα and the clinicopathological parameters of LSCC. P<0.05 was considered to indicate a statistically significant difference.

Results

RARα was elevated in laryngeal carcinoma tissues

IHC was performed to detect the expression levels of RARα in LSCC tissues and the adjacent noncancerous tissues. As presented in Fig. 1, the expression of RARα in the paired adjacent paratumor tissues was weak or negative, but was strong in the LSCC tissues. In addition, RARα exhibited high expression levels in the cytoplasm of cancer cells, with comparatively low expression levels in the nucleus. Furthermore, in order to compare the expression level of RARα protein in LSCC tissues and the adjacent noncancerous tissues, the expression level was classified into two groups (low expression, - to +; high expression, ++ to +++), which were presented in Table III. The rate of high expression in LSCC tissues was 78.1%, and the rate of high expression in paired adjacent paratumor tissues was 6.3%. The χ2 test statistics demonstrated that the expression of RARα was significantly higher in LSCC tissues compared with adjacent tissues (P<0.05).

Table III.

Expression of RARα in LSCC and paired adjacent paratumor tissues.

Table III.

Expression of RARα in LSCC and paired adjacent paratumor tissues.

RARα expression

TissuesLowHighP-value
Paratumor (N=32)30  2<0.0001
LSCC (N=32)  725

[i] RARα, retinoic acid receptor-α; LSCC, laryngeal squamous cell carcinoma.

The clinical significance of RARα overexpression in laryngeal carcinoma

The association between RARα and the clinicopathological characteristics of LSCC was further analyzed. There was no significant association between RARα expression and age, sex, TNM stage or clinical stage (P>0.05). However, high RARα expression was significantly associated with advanced pathological differentiation (P<0.05). As presented in Fig. 2, the expression levels of RAR protein in poorly differentiated LSCC tissues was visibly higher than that in moderately differentiated and highly differentiated LSCC tissues. The results of the present study indicate that RARα may be involved in the regulation of the differentiation of LSCC cells.

Downregulation of RARα inhibited laryngeal carcinoma cell proliferation in vitro

To assess the effect of downregulating RARα on the proliferation of LSCC cells, the expression of RARα was knocked down using siRARα, and the control group siCtrl was transfected with non-specific fragments. The specificity of siRNA was confirmed by the observation that the expression of RARα, but not RARβ or RARγ, was downregulated using siRARα (Fig. 3A). The results from the MTT assay revealed that the proliferation of siRARα-AMC-HN-8 cells were significantly inhibited from 48 h following transfection, compared with the siCtrl-AMC-HN-8 cells (Fig. 3B). Furthermore, the downregulation of RARα significantly decreased the forming foci of AMC-HN-8 cells (Fig. 3C). This data indicated that the downregulation of RARα inhibited the growth of LSCC cells.

Downregulation of RARα induced laryngeal carcinoma cell cycle arrest via inhibition of the protein kinase B (AKT) signaling pathway

The development of LSCC is associated with disorder of the cell cycle (16). Therefore, flow cytometry was performed to evaluate the effect of RARα downregulation on the cell cycle distribution of LSCC cells. The results demonstrated that the down-regulation of RARα in AMC-HN-8 cells reduced the proportion of cells in the S and G2/M phases, and a higher number of cells were arrested in the G0/G1 phase compared with cells in the control group (Fig. 4A). Furthermore, RT-qPCR was performed to detect the mRNA expression of cell cycle associated genes. As presented in Fig. 4B, the expression levels of P21 mRNA in the siRARα-AMC-HN-8 cells were >2× higher than those of the siCtrl cells, but the mRNA expression of p27, cyclin A, cyclin B, cyclin D, cyclin E was not significantly altered. Furthermore, the results from the western blot analysis confirmed the upregulation of the P21 protein in siRARα-AMC-HN-8 cells (Fig. 4C), which may be associated with the inhibition of the AKT signaling pathway. Thus, this data indicated that the downregulation of RARα resulted in P21 upregulation and induced G1 phase arrest via inhibition of the AKT signaling pathway.

Discussion

Laryngeal carcinoma is one of the most aggressive malignant tumors out of all head and neck squamous cell carcinoma, and generally has a poor prognosis (2). The survival time of laryngeal cancer has not increased, despite substantial progress in the developments of surgery and radiotherapy (3,17). Revealing the molecular mechanism underlying the development of LSCC is important for early diagnosis and targeted therapy. The development of LSCC is a complex process which is associated with changeable expression of multiple genes (18). Here, it was revealed that RARα was elevated in the LSCC tissues and was associated with poor pathological differentiation. Knockdown of RARα significantly inhibited the proliferation of LSCC cells through the induction of cell cycle arrest.

RARα, regarded as an important member of the retinoic acid receptor family, is involved in the regulation of cell differentiation, proliferation, apoptosis and metabolism. Accumulating evidence has indicated that RARα serves an important function in the development of malignant tumors. Notably, the functions of RARα in the development of tumors is dependent on the origin and the microenvironment of tumor cells. RARα served as a tumor suppressor gene in the development of gastric cancer, non-small cell lung cancer, melanoma tumor and prostate cancer. However, RARα may also serve as an oncogene in the development of hepatocellular carcinoma, leukemia and breast cancer. In the present study, it was identified that the expression of RARα in LSCC tissues was significantly higher than that in adjacent noncancerous tissues, suggesting that RARα may serve as an oncogene, participating in the process of the development of LSCC. Further analysis revealed that overexpression of RARα was associated with poor pathologic differentiation. Despite the small sample size of the present study, it was indicated that RARα may be involved in the regulation of LSCC cell differentiation.

Rapid proliferation, resistance to apoptosis, indefinite reproduction, angiogenesis, invasion and metastasis are the main features in the development of a tumor (19). These are also the biological functions of various types of tumor oncogenes and suppressor genes involved in the development of malignant tumors. In the present study, the downregulation of RARα significantly inhibited the proliferation of AMC-HN-8 cells through inducing cell cycle arrest. It was indicated that the overexpression of RARα served an important function in the development of LSCC. Consistent with the present study, previous studies have reported that RARα was also involved in the regulation of the cell cycle in breast cancer (13). Retinoic acid, a ligand of RARα, inhibited the growth of breast cancer cells through the induction of cell cycle arrest at the G1 phase and cell apoptosis (13). The mechanism of RARα in the regulation of the development of LSCC is the focus of a number of studies; it has been reported that there are genomic and non-genomic influences (20). During genomic regulation, the conformation of RARα changes and recruits a coactivator protein once it is combined with its ligand. The complex forms the retinoic acid response element in the promoter region of the target gene, and then activates the transcription of target genes, resulting in the promotion of cell differentiation, apoptosis and other biological processes (20). In previous years, there was a greater focus on the non-genomic regulation of RARα. Previous studies have identified that RARα may regulate the phosphoinositide 3-kinase, AKT, c-Jun N-terminal kinase, mitogen-activated protein kinase 14 and protein kinase C signaling pathways following abnormal translocation into the cytoplasm (10,2123). The present study identified that the overexpression of RARα was mainly located in the cytoplasm of LSCC cells and its downregulation significantly inhibited the activation of the AKT signaling pathway. Therefore, it was speculated that RARα promoted the development of LSCC through non-genomic transcriptional regulation.

Altogether, the present study has demonstrated that RARα expression was significantly elevated in patients with LSCC, and the downregulation of RARα induced cell cycle arrest and inhibited the proliferation of LSCC cells via the inhibition of the AKT signaling pathway. The present study may offer a potential molecular basis for the further development of RARα as a novel therapeutic target for patients with LSCC.

Acknowledgements

The present study was supported by the Youth Foundation of the Fujian Health Department, Fujian, China (grant no. 2013-2-83), the Project of Young and Middle-Aged Backbone Talent Cultivation, Fujian, China (grant no. 2013-ZQN-JC-32) and the Science and Technology Bureau of Xiamen, China (grant no. 3502Z20144004). The present study was also supported by the National Nature Science Foundation of China (grant no. 81572394).

References

1 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Marur S and Forastiere AA: Head and neck squamous cell carcinoma: Update on epidemiology, diagnosis, and treatment. Mayo Clin Proc. 91:386–396. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Belcher R, Hayes K, Fedewa S and Chen AY: Current treatment of head and neck squamous cell cancer. J Surg Oncol. 110:551–574. 2014. View Article : Google Scholar : PubMed/NCBI

4 

di Masi A, Leboffe L, De Marinis E, Pagano F, Cicconi L, Rochette-Egly C, Lo-Coco F, Ascenzi P and Nervi C: Retinoic acid receptors: From molecular mechanisms to cancer therapy. Mol Aspects Med. 41:1–115. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Altucci L, Leibowitz MD, Ogilvie KM, de Lera AR and Gronemeyer H: RAR and RXR modulation in cancer and metabolic disease. Nat Rev Drug Discov. 6:793–810. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Shiohira H, Kitaoka A, Shirasawa H, Enjoji M and Nakashima M: Am80 induces neuronal differentiation in a human neuroblastoma NH-12 cell line. Int J Mol Med. 26:393–399. 2010.PubMed/NCBI

7 

Casey NP and Woods GM: Anti-PML-RARα shRNA sensitises promyelocytic leukaemia cells to all-trans retinoic acid. J RNAi Gene Silencing. 8:464–469. 2012.PubMed/NCBI

8 

Singh AT, Evens AM, Anderson RJ, Beckstead JA, Sankar N, Sassano A, Bhalla S, Yang S, Platanias LC, Forte TM, et al: All trans retinoic acid nanodisks enhance retinoic acid receptor mediated apoptosis and cell cycle arrest in mantle cell lymphoma. Br J Haematol. 150:158–169. 2010.PubMed/NCBI

9 

Wu Q, Lin XF, Ye XF, Zhang B, Xie Z and Su WJ: Ubiquitinated or sumoylated retinoic acid receptor alpha determines its characteristic and interacting model with retinoid X receptor alpha in gastric and breast cancer cells. J Mol Endocrinol. 32:595–613. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Hoshikawa Y, Kanki K, Ashla AA, Arakaki Y, Azumi J, Yasui T, Tezuka Y, Matsumi Y, Tsuchiya H, Kurimasa A, et al: c-Jun N-terminal kinase activation by oxidative stress suppresses retinoid signaling through proteasomal degradation of retinoic acid receptor α protein in hepatic cells. Cancer Sci. 102:934–941. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Sano K, Takayama T, Murakami K, Saiki I and Makuuchi M: Overexpression of retinoic acid receptor alpha in hepatocellular carcinoma. Clin Cancer Res. 9:3679–3683. 2003.PubMed/NCBI

12 

Schneider SM, Offterdinger M, Huber H and Grunt TW: Activation of retinoic acid receptor alpha is sufficient for full induction of retinoid responses in SK-BR-3 and T47D human breast cancer cells. Cancer Res. 60:5479–5487. 2000.PubMed/NCBI

13 

Lu M, Mira-y-Lopez R, Nakajo S, Nakaya K and Jing Y: Expression of estrogen receptor alpha, retinoic acid receptor alpha and cellular retinoic acid binding protein II genes is coordinately regulated in human breast cancer cells. Oncogene. 24:4362–4369. 2005. View Article : Google Scholar : PubMed/NCBI

14 

Gyftopoulos K, Perimenis P, Sotiropoulou-Bonikou G, Sakellaropoulos G, Varakis I and Barbalias GA: Immuno-histochemical detection of retinoic acid receptor-alpha in prostate carcinoma: Correlation with proliferative activity and tumor grade. Int Urol Nephrol. 32:263–269. 2000. View Article : Google Scholar : PubMed/NCBI

15 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Pignataro L, Sambataro G, Pagani D and Pruneri G: Clinico-prognostic value of D-type cyclins and p27 in laryngeal cancer patients: A review. Acta Otorhinolaryngol Ital. 25:75–85. 2005.PubMed/NCBI

17 

Li P, Hu W, Zhu Y and Liu J: Treatment and predictive factors in patients with recurrent laryngeal carcinoma: A retrospective study. Oncol Lett. 10:3145–3152. 2015.PubMed/NCBI

18 

Ni RS, Shen X, Qian X, Yu C, Wu H and Gao X: Detection of differentially expressed genes and association with clinicopathological features in laryngeal squamous cell carcinoma. Oncol Lett. 4:1354–1360. 2012.PubMed/NCBI

19 

Hanahan D and Weinberg RA: Hallmarks of cancer: The next generation. Cell. 144:646–674. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Hart SM: Modulation of nuclear receptor dependent transcription. Biol Res. 35:295–303. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Srinivas H, Xia D, Moore NL, Uray IP, Kim H, Ma L, Weigel NL, Brown PH and Kurie JM: Akt phosphorylates and suppresses the transactivation of retinoic acid receptor alpha. Biochem J. 395:653–662. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Boskovic G, Desai D and Niles RM: Regulation of retinoic acid receptor alpha by protein kinase C in B16 mouse melanoma cells. J Biol Chem. 277:26113–26119. 2002. View Article : Google Scholar : PubMed/NCBI

23 

Piskunov A and Rochette-Egly C: A retinoic acid receptor RARα pool present in membrane lipid rafts forms complexes with G protein αQ to activate p38MAPK. Oncogene. 31:3333–3345. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

December 2017
Volume 14 Issue 6

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Cai, C., Liu, C., Shang‑Guan, H., Yang, C., Luo, X., Shen, D., & Yang, S. (2017). An oncogenic function of retinoic acid receptor‑α in the development of laryngeal squamous cell carcinoma. Oncology Letters, 14, 7896-7902. https://doi.org/10.3892/ol.2017.7194
MLA
Cai, C., Liu, C., Shang‑Guan, H., Yang, C., Luo, X., Shen, D., Yang, S."An oncogenic function of retinoic acid receptor‑α in the development of laryngeal squamous cell carcinoma". Oncology Letters 14.6 (2017): 7896-7902.
Chicago
Cai, C., Liu, C., Shang‑Guan, H., Yang, C., Luo, X., Shen, D., Yang, S."An oncogenic function of retinoic acid receptor‑α in the development of laryngeal squamous cell carcinoma". Oncology Letters 14, no. 6 (2017): 7896-7902. https://doi.org/10.3892/ol.2017.7194