Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
May-2018 Volume 15 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2018 Volume 15 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Oncogene Lin28B increases chemosensitivity of colon cancer cells in a let-7-independent manner

  • Authors:
    • Lihong Ma
    • Qi Zhao
    • Wenhao Chen
    • Yanqiao Zhang
  • View Affiliations / Copyright

    Affiliations: Outpatient Department of Chemotherapy, Affiliated Tumor Hospital of Harbin Medical University, Harbin, Heilongjiang 150040, P.R. China, Institute of Mental Health, Peking University Sixth Hospital, Beijing 100191, P.R. China, Department of Gastrointestinal Medical Oncology, Affiliated Tumor Hospital of Harbin Medical University, Harbin, Heilongjiang 150040, P.R. China
    Copyright: © Ma et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 6975-6981
    |
    Published online on: March 13, 2018
       https://doi.org/10.3892/ol.2018.8250
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Lin-28 homolog B (Lin28B) is a RNA binding protein conserved between Caenorhabditis elegans and humans, and it has important roles in regulating development. The overexpression of Lin28B has been observed in various human malignant tumors and the upregulation of Lin28B predicts tumor progression and/or poor prognosis. The majority of studies suggested that Lin28B is an oncogene that promotes the proliferation and metastasis of cancer cells. However, few studies have focused on the function of Lin28B in chemotherapy. In the present study, the role of Lin28B in the chemosensitivity of colon cancer cells to 5‑fluorouracil (5‑FU) was detected by establishing a Lin28B over‑expressing HCT116 (EGFP‑Lin28B‑HCT116) cell line. In accordance with the immunohistochemistry results, Lin28B‑GFP expression was predominantly distributed in the cytoplasm, and the overexpression of Lin28B was confirmed using quantitative polymerase chain reaction and western blot analysis. The control EGFP‑HCT116 and Lin28B over‑expressing EGFP-Lin28B-HCT116 cells were then exposed to various concentrations of 5‑FU for 48 h. A luminescence‑based cell viability assay was used to detect the effect of Lin28B on the chemotherapeutic sensitivity of colon cancer cells. It was demonstrated that overexpression of Lin28B improved the chemotherapeutic sensitivity of colon cancer cells to 5‑FU. Additional investigation revealed that Lin28B enhanced the chemosensitivity of colon cancer cells by promoting cell apoptosis induced by 5‑FU; however, this effect was independent of Lin28B inhibiting the biogenesis of let‑7, the well‑known target of Lin28B. The mechanism of this effect of Lin28B on the chemosensitivity of cells requires additional investigation. The present study suggested that Lin28B may act as a biomarker for predicting chemotherapy sensitivity in patients with colon cancer.

Introduction

Colorectal cancer is one of the most common malignant tumors worldwide. However, the treatment of colon cancer remains unsatisfactory due to chemoresistance (1).

Lin-28 homolog B (Lin28B) is a conserved RNA-binding protein. It was originally identified in hepatocellular carcinoma, where the protein encoded by this gene is highly increased (2). This protein has been identified to majorly distribute in the cellular nucleus (3). Previously, in addition to hepatocellular carcinoma, numerous studies have indicated that Lin28B is frequently upregulated in various cancers, including colon cancer, and the elevated expression of the protein is associated with advanced tumor stage and poor prognosis (4–6). The mechanisms involved in the promotion of the development of human malignant tumors by upregulated Lin28B include promoting cellular proliferation, angiogenesis and metastasis, facilitating tumor-associated inflammation, reprogramming metabolism, acquiring immortality and evading immune destruction. This may occur by either repressing the generation of let-7, a well-studied miRNA with tumor suppressor function, or stabilizing the oncogenic transcripts, such as cell cycle proteins, cyclin-dependent kinases, growth factors and ribosomal proteins (7).

Although it has been reported that Lin28B promotes colon cancer growth, migration and recurrence (8,9), the function of Lin28B in colon cancer chemotherapy remains unknown. In the present study, the expression of Lin28B in colon cancer tissues and the effect of Lin28B on the chemosensitivity of colon cancer cells to 5-fluorouracil (5-FU) were detected. Additionally, the potential mechanism of Lin28B affecting chemotherapeutic sensitivity of colon cancer cells to 5-FU was also explored.

Materials and methods

Cell culture

The colon cancer HCT116 cell line and human embryonic nephral epithelia 293TN cell line, which was used for lentiviral vector packaging, were maintained in Dulbecco's modified Eagle medium (HyClone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 10% fetal bovine serum (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 37°C in a humidified atmosphere containing 5% CO2.

Human tissues and immunohistochemistry

A total of 103 formalin-fixed paraffin-embedded tissues, consisting of 92 colon cancer tissues and 11 adjacent mucosa tissues obtained from colon cancer patients that underwent resection of colon carcinoma at the Affiliated Tumor Hospital of Harbin Medical University between May 2011 and July 2012. The diagnoses for all samples were confirmed by two or more pathologists. The present study was approved by the Ethical Committee of Harbin Medical University (Harbin, China). All patients provided informed consent prior to surgery.

Immunohistochemistry was used to detect the expression of Lin28B in colon cancer tissues or adjacent colon tissues. Briefly, 5-µm-thick sections were prepared from paraffin-embedded tissues. Sections were rehydrated using a gradient alcohol series, as follows: 100% ethanol for 10 min twice; 95% ethanol for 5 min; 80% ethanol for 5 min; and 70% ethanol for 5 min at room temperature. Next, the sections were placed in citrate buffer (pH 6.0) and heated in a microwave oven for antigen retrieval (95°C for 3 min). Endogenous peroxidase activity was inhibited by incubation in 3% hydrogen peroxide for 15 min. Following blocking with 5% bovine serum albumin (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 1 h at room temperature, sections were incubated with primary antibodies against Lin28B (1:1,000; cat. no. ab115698; Abcam, Cambridge, MA, USA), overnight at 4°C. Subsequently, the sections were incubated with the secondary streptavidin-biotin peroxidase-conjugated antibody (1:1,000; cat. no. ab6721; Abcam) for 1 h at room temperature, and 3,3′-diaminobenzidine (Origene Technologies, Inc., Beijing, China) was used to stain the sections. The evaluation of Lin28B expression was performed by a pathologist under light microscopic observation (magnification, ×400), as previously described (10).

Pseudo lentivirus packaging and transduction into cells

Lin28B over-expressed lentiviral vectors were constructed and the pseudo lentivirus was packaged as described previously (11). To generate Lin28B overexpression of lentiviral vectors, the open reading frame of Lin28B was amplified by 2X EasyTaq PCR SuperMix for PAGE (Beijing Transgen Biotech Co., Ltd., Beijing, China) from HCT116 cells. The polymerase chain reaction (PCR) assays using DNA from HCT116 cells were performed at 95°C for 5 min and then 40 cycles of denaturation at 95°C for 10 sec, amplification at 60°C for 30 sec and extension at 72°C for 1 min. The DNA polymerase was purchased from Beijing Transgen Biotech Co. Ltd. (2X EasyTaq PCR SuperMix; cat. no. AS111-11; Beijing, China). Primer sequences are summarized in Table I. Subsequent to sequencing and digestion with BamH1 and Mlu1, the vector was inserted into a pWPXL lentiviral construction plasmid (cat. no. 12257; Addgene, Inc., Cambridge, MA, USA). The recombinant plasmid and packaging plasmids psPAX2 (cat. no. 12260; Addgene) and PMD.2G (cat. no. 12259; Addgene) were co-transfected into 293TN cells. The transfection was mediated using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. At 48 h subsequent to transfection, the supernatant was collected and the lentivirus was condensed using polyethylene glycol reagent (System Biosciences, Palo Alto, CA, USA) according to the manufacturer's instructions. To generate cells with stable Lin28B overexpression, HCT116 cells were incubated with 10 MOI of control lentiviral particles or Lin28B overexpression lentiviral particles for at least 12 h at 37°C in a humidified atmosphere containing 5% CO2, subsequent to culturing for at least 72 h. GFP-positive cells were then identified by assessing the relative fluorescence intensities using the FACSAria II flow cytometer and analyzed with FACSDiva software 6.1.3 (BD Biosciences, Franklin Lakes, CA, USA).

Table I.

Primer sequences used in the present study.

Table I.

Primer sequences used in the present study.

Primer namePrimer sequence (5′-3′)
Let-7a RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACaactat
Let-7b RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACaaccac
Let-7c RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACaaccat
U6 RT AAAATATGGAACGCTTCACGAATTTG
Let-7a quantitative PCR
  ForwardTGAGGTAGTAGGTTG
  Reverse GTCGTATCCAGTGCAGGGTCCGAGGT
Let-7b quantitative PCR
  Forward TGAGGTAGTAGGTTGTGT
  Reverse GTCGTATCCAGTGCAGGGTCCGAGGT
U6
  Forward CTCGCTTCGGCAGCACATATACT
  Reverse ACGCTTCACGAATTTGCGTGTC
Let-7c quantitative PCR
  Forward TGAGGTAGTAGGTTGTATt
  Reverse GTCGTATCCAGTGCAGGGTCCGAGGT
GAPDH
  Forward ATGGGGAAGGTGAAGGTCG
  Reverse GGGGTCATTGATGGCAACAATA
Lin28B
  Forward GTCAATACGGGTAACAGGAC
  Reverse TTCTTTGGCTGAGGAGGTAG

[i] RT, reverse transcription; PCR, polymerase chain reaction; Lin28B, Lin-28 homolog B.

RNA isolation and quantitative PCR

Total RNA was extracted from HCT116 cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and cDNA was synthesized by using a high-capacity cDNA reverse transcriptase kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) as previously described (12), with random primers or specific miRNA reverse transcription primers. The relative RNA expression was detected using the SYBR Green quantitative PCR reagent (Beijing Transgen Biotech, Inc.). Gene expression was analyzed using the 2−ΔΔCq method (13). The PCR reactions consisted of the following conditions: 95°C for 5 min, followed by 40 cycles of amplification at 95°C for 10 sec and 60°C for 30 sec. The primer sequences used for reverse transcription and quantitative PCR are stated in Table I.

Transfection

A total of 50 nM of microRNA negative control (NC; sequence, ucaccuagaagcuaguuaacag) and let-7 mimic (sequence, ugagguaguagguuguauaguu) were synthesized by GE Dharmacon (GE Healthcare Life Sciences). Transfection was performed using GE Dharmacon DharmaFECT kb DNA transfection reagent (GE Healthcare Life Sciences), according to the manufacturer's protocol.

Cell viability assay

In total, 5×103 HCT116 cells were seeded onto a 96-well plate and treated with 80, 160, 320 and 640 µM 5-FU (Jinyao Amino Acid Co., Ltd, Tianjin, China) for 48 h. Cellular viability was measured using CellTiter-Glo reagent (Promega Corp., Madison, WI, USA), according to the manufacturer's instructions. Briefly, 100 µl CellTiter-Glo reagent was added to each well, and the plate was equilibrated at room temperature for 30 min. The contents were then mixed on an orbital shaker. Finally, the value of luminescence was measured at 460 nm, and the value was normalized to blank control.

Apoptosis analysis

Cell apoptosis was detected using the Phycoerythrin (PE)-Annexin V Apoptosis Detection kit (BD Biosciences), according to the manufacturer's instructions. Briefly, 1×106 cells were collected, and then washed with PBS and re-suspended in1mlbinding buffer. Subsequently, 100 µl solution (1×105 cells) was transferred to a 5-ml culture tube, and 5 µl PE-annexin V and 5 µl 7-ADD were then added to the tube. The cells were vortexed gently and incubated for 10 min in the dark at room temperature. Finally, 400 µl binding buffer was added to each tube before analyzing the tubes by flow cytometry.

Western blot analysis

The total proteins were extracted from cells using radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology, Shanghai, China), and subsequently quantified using the Bradford method (Bio-Rad Laboratories, Inc., Hercules, CA, USA). In total, 20 µg protein/well was loaded and separated by SDS-PAGE (10% gel) and then transferred to polyvinylidene difluoride membrane (Bio-Rad Laboratories, Inc.). Subsequent to blocking by 5% bovine serum albumin (Sigma-Aldrich; Merck KGaA), membranes were incubated with the following primary antibodies at 4°C overnight: Rabbit monoclonal Lin28B antibody diluted at 1:1,000 (Abcam) and polyclonal rabbit anti-GAPDH antibody diluted at 1:5,000 (ab115698; Abcam). The polyvinylidene fluoride membranes were then incubated with peroxidase-conjugated goat anti-rabbit secondary antibody (1:4,000; ab6721; Abcam) for 1 h after washing with PBST (Phosphate Buffered Saline containing 1% Tween-20). Finally, proteins were visualized using an enhanced chemiluminescence detection system (Thermo Fisher Scientific, Inc.).

Statistical analysis

All data are expressed as the mean ± standard deviation. Student's t-test was used to compare the significance of differences between two or more groups, as appropriate. P<0.05 was considered to indicate a statistically significant difference.

Results

High expression of Lin28B was detected in colon cancer tissues

The expression pattern of Lin28B was investigated in colon cancer. Using immunohistochemistry, the expression of Lin28B was detected in 92 colon cancer tissues and 11 adjacent colon tissues. The results indicated that the Lin28B protein was expressed in all colon cancer tissues, resulting in a positive rate of Lin28B expression of 100%, while only ~9.1% of adjacent colon tissues expressed Lin28B (1/11) (Fig. 1). As shown in Fig. 1, it was found that Lin28B was mainly expressed in the cytoplasm of cancer cells, which is contrary to previous observation (3). It was reported that Lin28B not only promotes the proliferation, but also facilitates the metastasis of cancer cells (4). The association between Lin28B expression and clinical parameters of patients with colon cancer was then analyzed. As shown in Table II, the expression level of Lin28B was not associated with any clinical parameter. Thus, Lin28B was not observed to have an impact on the proliferation and metastasis of colon cancer in the present study.

Figure 1.

Lin28B was upregulated in colon cancer tissues, as detected by immunohistochemical staining (magnification, ×100). The magnification in the top-right corner of the images is ×400. (A) Lin28B was not expressed in adjacent colon tissue. (B) Lin28B was expressed in colon cancer tissue. Lin28B, Lin-28 homolog B.

Table II.

Association between clinical characteristics and Lin-28 homolog B expression.

Table II.

Association between clinical characteristics and Lin-28 homolog B expression.

Clinical parametersPatients, nImmunohistochemistry scoreaP-value
Age (range, 39–75) >0.05
  ≤50 years395.3±1.4
  >50 years534.8±2.6
Sex >0.05
  Male635.7±3.4
  Female293.7±2.7
Morphology >0.05
  Ulcerated154.7±2.4
  Polypous733.8±2.3
  Infiltrating  44.3±1.8
Differentiation >0.05
  Well215.4±3.4
  Moderate494.3±1.7
  Poor225.1±2.7
Lymph node metastasis >0.05
  Yes335.7±4.4
  No594.3±2.3
Tumor size >0.05
  ≤5 cm434.9±2.5
  >5 cm495.2±3.7

a Data are presented as the mean ± standard deviation.

Overexpression of Lin28B increased chemotherapeutic sensitivity of colon cancer cells to 5-FU

Since no association was identified between Lin28B expression and tumor size or lymph node metastasis, the impact of Lin28B on the chemotherapeutic sensitivity of colon cancer cells was then detected. To identify the potential role of Lin28B in chemotherapy of colon cancer, a Lin28B over-expressing HCT116 (EGFP-Lin28B-HCT116) cell line was established. In accordance with the immunohistochemistry results, Lin28B-GFP expression was predominantly distributed in the cytoplasm (Fig. 2A), and the overexpression of Lin28B was confirmed using quantitative PCR (Fig. 2B) and western blot analysis (Fig. 2C). The control EGFP-HCT116 and Lin28B over-expressing EGFP-Lin28B-HCT116 cells were then exposed to various concentrations of 5-FU for 48 h. A luminescence-based cell viability assay was used to detect the effect of Lin28B on the chemotherapeutic sensitivity of colon cancer cells. The result showed that, compared with the control cells, the sensitivity of cells with Lin28B overexpression to 5-FU is significantly increased (P<0.01; Fig. 2D).

Figure 2.

Overexpression of Lin28B promotes the chemotherapeutic sensitivity of colon cancer cells to 5-FU. (A) Lin28B was predominantly located in the cytoplasm of HCT116 cells, as illustrated by GFP distribution, and the nucleus was stained by DAPI (magnification, ×200). (B) Overexpression of Lin28B was confirmed by quantitative polymerase chain reaction. (C) Overexpression of Lin28B was confirmed by western blot analysis. (D) The overexpression of Lin28B significantly increased the chemosensitivity of HCT116 cells treated with 5-FU (P<0.05). Lin28B, Lin-28 homolog B; 5-FU, 5-fluorouracil; GFP, green fluorescent protein.

Lin28B overexpression promoted the cell apoptosis induced by 5-FU

To detect the potential mechanism by which Lin28B enhances the chemosensitivity of colon cancer cells to 5-FU, the present study evaluated the effect of Lin28B overexpression on the apoptosis of HCT116 cells induced by 5-FU. The present results showed that the apoptosis rate of EGFP-Lin28B-HCT116 cells was significantly increased compared with the EGFP-HCT116 cells (student's t-test, P<0.05, Fig. 3). This result suggested that Lin28B may increase the chemosensitivity of colon cancer cells to 5-FU by enhancing cell apoptosis.

Figure 3.

Lin28B overexpression promoted the apoptosis of HCT116 cells induced by 5-FU. Lin28B, Lin-28 homolog B.

Lin28B increased the chemosensitivity of colon cancer cells to 5-FU in a let-7 independent manner

It is well known that let-7 is one of the most frequently studied targets of Lin28B. To identify the molecular mechanism by which Lin28B increases the chemosensitivity of colon cancer cells to 5-FU, the potential involvement of let-7 was then evaluated. As expected, the overexpression of Lin28B in HCT116 cells significantly inhibited the expression of let-7 (Fig. 4A), which is consistent with previous studies (14). Subsequently, the effect of let-7 on colon cancer chemotherapy was investigated. It was shown that the overexpression of let-7b in HCT116 cells significantly enhanced the chemosensitivity of colon cancer cells to 5-FU (P<0.01; Fig. 4B). This result is same as the effect of Lin28B on the chemotherapy of colon cancer treatment with 5-FU, even though the overexpression of Lin28B significantly inhibits the expression of let-7. Overall, these results indicated that Lin28B increased the chemosensitivity of colon cancer cells to 5-FU in a let-7 independent manner.

Figure 4.

Lin28B increased the chemosensitivity of HCT116 cells to 5-FU in a let-7-independent manner. (A) The overexpression of Lin28B in HCT116 cells repressed the expression of let-7a, let-7b and let-7c, as determined by quantitative polymerase chain reaction. (B) The overexpression of let-7 significantly enhanced the chemosensitivity of HCT116 cells to 5-FU (P<0.05). Lin28B, Lin-28 homolog B; 5-FU, 5-fluorouracil; GFP, green fluorescent protein.

Discussion

The RNA-binding Lin28 protein family consists of two members, Lin28A and Lin28B. Lin28A was initially known as a developmental timing regulator and functions as a stemness maintenance factor, whereas Lin28B was first identified in hepatocellular carcinoma (4,15,16). Both proteins have been demonstrated to block the biogenesis of microRNA let-7s by interacting with primary or precursor let-7s and preventing their maturation or inducing their degradation (3). Previous studies have demonstrated that Lin28A and Lin28B are each frequently upregulated in various malignancies, and the overexpression of Lin28A and Lin28B is associated with multiple biological behaviors of cancers and poor prognosis (6,17). However, few studies have focused on the role of Lin28A or Lin28B in cancer chemotherapy.

The present study showed that Lin28B was upregulated in all assessed colon cancer tissues. Differing from a previous study (3), it was found that Lin28B was mainly expressed in the cytoplasm instead of the nucleus of colon cancer cells. To the best of our knowledge, the present study is the first to report the cytoplasmic distribution of Lin28B in colon cancer cells. Since a previous study demonstrated that Lin28B expression is associated with an advanced stage of malignant tumors (18), the present study hypothesized that the elevated expression of Lin28B in colon cancer may also act as an oncogene. However, the association analysis between Lin28B expression and clinical characteristics indicated that Lin28B expression level is not associated with tumor growth and metastasis. The function of Lin28B in the chemosensitivity of colon cancer cells was then evaluated. Notably, it was identified that the overexpression of the Lin28B gene, which has oncogenic potential, enhanced the sensitivity of colon cancer HCT116 cells to 5-FU. Additional investigation showed that enforced expression of Lin28B promoted the apoptosis of colon cancer cells induced by 5-FU. The present results are consistent with a previous study by Teng et al (19), who revealed that Lin28B expression was significantly increased in gastric cancer patients with pathological response to neoadjuvant chemotherapy, which indicated that Lin28B expression is associated with the sensitivity of neoadjuvant chemotherapy in gastric cancer. However, the effect of Lin28 on chemotherapy in other types of cancer may vary. The promotion of resistance of breast cancer cells to paclitaxel by overexpression of Lin28 has been reported, and the induction of p21 and Rb expression and inhibition of let-7a miRNA generation contributes to Lin28-mediated resistance to chemotherapy in breast cancer (20). Additionally, Lin28B-inducedpromotion of chemoresistance to paclitaxel was also reported in hepatocellular carcinoma (21). Investigation of the mechanism revealed that inhibition of let-7 production and the consequent upregulation of its target B-cell lymphoma-extra large underlined the paclitaxel resistance in HCC cells (21). The role of Lin28B in the chemosensitivity of colon cancer cells in the present study differs from the observations in these previous studies. The mechanism of the opposing roles of Lin28B in chemotherapy in different cancer types requires additional experiments to evaluate.

Let-7 is a well-known target of Lin28B, and based on current studies, the majority of the reported functions of Lin28B are associated with the repression of let-7 production (6). By binding either pri-let-7 or pre-let-7 and blocking their processing by Drosha or Dicer, or by recruiting TUT4/TUT7 to oligo-uridylate the of pre-let-7, Lin28B negatively regulates the generation of let-7 miRNAs (22–27). In the present study, it was also shown that the over-expression of Lin28B in colon cancer cells significantly attenuated the let-7 level, which is consistent with previous studies (3,4,8,9). To detect the molecular mechanism of Lin28B in promoting chemosensitivity of colon cancer cells to 5-FU, the effect of let-7 in the chemosensitivity of colon cancer cell to 5-FU was also evaluated. The results showed that the overexpression of let-7b significantly increased the chemosensitivity of colon cancer cells to 5-FU, which indicated that the Lin28B-induced promotion of chemosensitivity of chemosensitivity of colon cancer cells to 5-FUis independent of let-7. The mechanism of this effect of Lin28B on the chemosensitivity of cells requires additional investigation.

In conclusion, the present study showed that overexpression of the oncogene Lin28B increased the chemosensitivity of colon cancer cells to 5-FU by promoting cell apoptosis. Additional investigation indicated that this effect of Lin28B-induced enhancement of chemosensitivity was let-7-independent. The present results indicated that Lin28B may act as a predictive biomarker for chemotherapy in patients with colon cancer.

Acknowledgments

Not applicable.

Funding

The present study was supported financially by the National Natural Science Foundation of China (grant no. 81672428).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

LM and YZ conceived and designed experiments. LM, QZ and WC conducted the experiments and collected data. LM and QZ analyzed data. LM wrote the manuscript and was responsible for manuscript revisions and YZ assisted with constructive discussions. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the ethics committee of Tumor Hospital Affiliated to Harbin Medical University. All participants provided written informed consent.

Consent for publication

All study participants provided informed consent for the publication of this data.

Competing interests

The authors declare no conflict of interest.

References

1 

Ferlay J, Shin HR, Bray F, Forman D, Mathers C and Parkin DM: Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 127:2893–2917. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Guo Y, Chen Y, Ito H, Watanabe A, Ge X, Kodama T and Aburatani H: Identification and characterization of lin-28 homolog B (LIN28B) in human hepatocellular carcinoma. Gene. 384:51–61. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Piskounova E, Polytarchou C, Thornton JE, LaPierre RJ, Pothoulakis C, Hagan JP, Iliopoulos D and Gregory RI: Lin28A and Lin28B inhibit let-7 microRNA biogenesis by distinct mechanisms. Cell. 147:1066–1079. 2011. View Article : Google Scholar : PubMed/NCBI

4 

King CE, Cuatrecasas M, Castells A, Sepulveda AR, Lee JS and Rustgi AK: LIN28B promotes colon cancer progression and metastasis. Cancer Res. 71:4260–4268. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Hamano R, Miyata H, Yamasaki M, Sugimura K, Tanaka K, Kurokawa Y, Nakajima K, Takiguchi S, Fujiwara Y, Mori M and Doki Y: High expression of Lin28 is associated with tumour aggressiveness and poor prognosis of patients in oesophagus cancer. Br J Cancer. 106:1415–1423. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Tummala R, Nadiminty N, Lou W, Zhu Y, Gandour-Edwards R, Chen HW, Evans CP and Gao AC: Lin28 promotes growth of prostate cancer cells and activates the androgen receptor. Am J Pathol. 183:288–295. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Wang T, Wang G, Hao D, Liu X, Wang D, Ning N and Li X: Aberrant regulation of the LIN28A/LIN28B and let-7 loop in human malignant tumors and its effects on the hallmarks of cancer. Mol Cancer. 14:1252015. View Article : Google Scholar : PubMed/NCBI

8 

Pang M, Wu G, Hou X, Hou N, Liang L, Jia G, Shuai P, Luo B, Wang K and Li G: LIN28B promotes colon cancer migration and recurrence. PLoS One. 9:e1091692014. View Article : Google Scholar : PubMed/NCBI

9 

King CE, Wang L, Winograd R, Madison BB, Mongroo PS, Johnstone CN and Rustgi AK: LIN28B fosters colon cancer migration, invasion and transformation through let-7-dependent and -independent mechanisms. Oncogene. 30:4185–4193. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Zhao R, Wu Y, Wang T, Zhang Y, Kong D, Zhang L, Li X, Wang G, Jin Y, Jin X and Zhang F: Elevated Src expression associated with hepatocellular carcinoma metastasis in northern Chinese patients. Oncol Lett. 10:3026–3034. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Li X, Zhang J, Gao L, McClellan S, Finan MA, Butler TW, Owen LB, Piazza GA and Xi Y: MiR-181 mediates cell differentiation by interrupting the Lin28 and let-7 feedback circuit. Cell Death Differ. 19:378–386. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Xi Y, Nakajima G, Gavin E, Morris CG, Kudo K, Hayashi K and Ju J: Systematic analysis of microRNA expression of RNA extracted from fresh frozen and formalin-fixed paraffin-embedded samples. RNA. 13:1668–1674. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Wang T, Han P, He Y, Zhao C, Wang G, Yang W, Shan M, Zhu Y, Yang C, Weng M, et al: Lin28A enhances chemosensitivity of colon cancer cells to 5-FU by promoting apoptosis in a let-7 independent manner. Tumour Biol. 37:7657–7665. 2016. View Article : Google Scholar : PubMed/NCBI

15 

Horvitz HR and Sulston JE: Isolation and genetic characterization of cell-lineage mutants of the nematode Caenorhabditis elegans. Genetics. 96:435–454. 1980.PubMed/NCBI

16 

Ambros V and Horvitz HR: Heterochronic mutants of the nematode Caenorhabditis elegans. Science. 226:409–416. 1984. View Article : Google Scholar : PubMed/NCBI

17 

Malik F, Korkaya H, Clouthier SG and Wicha MS: Lin28 and HER2: Two stem cell regulators conspire to drive aggressive breast cancer. Cell Cycle. 11:2780–2781. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Viswanathan SR, Powers JT, Einhorn W, Hoshida Y, Ng TL, Toffanin S, O'Sullivan M, Lu J, Phillips LA, Lockhart VL, et al: Lin28 promotes transformation and is associated with advanced human malignancies. Nat Genet. 41:843–848. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Teng RY, Zhou JC, Jiang ZN, Xu CY, Li ZD, Wang QC, Xu CP, Guo JF, Shen JG and Wang LB: The relationship between Lin28 and the chemotherapy response of gastric cancer. Onco Targets Ther. 6:1341–1345. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Lv K, Liu L, Wang L, Yu J, Liu X, Cheng Y, Dong M, Teng R, Wu L, Fu P, et al: Lin28 mediates paclitaxel resistance by modulating p21, Rb and Let-7a miRNA in breast cancer cells. PLoS One. 7:e400082012. View Article : Google Scholar : PubMed/NCBI

21 

Tian N, Han Z, Li Z, Zhou M and Fan C: Lin28/let-7/Bcl-xL pathway: The underlying mechanism of drug resistance in Hep3B cells. Oncol Rep. 32:1050–1056. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Piskounova E, Viswanathan SR, Janas M, LaPierre RJ, Daley GQ, Sliz P and Gregory RI: Determinants of microRNA processing inhibition by the developmentally regulated RNA-binding protein Lin28. J Biol Chem. 283:21310–21314. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Hagan JP, Piskounova E and Gregory RI: Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cells. Nat Struct Mol Biol. 16:1021–1025. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Heo I, Joo C, Kim YK, Ha M, Yoon MJ, Cho J, Yeom KH, Han J and Kim VN: TUT4 in concert with Lin28 suppresses microRNA biogenesis through pre-microRNA uridylation. Cell. 138:696–708. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Heo I, Joo C, Cho J, Ha M, Han J and Kim VN: Lin28 mediates the terminal uridylation of let-7 precursor MicroRNA. Mol Cell. 32:276–284. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Chang HM, Triboulet R, Thornton JE and Gregory RI: A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway. Nature. 497:244–248. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Mullen TE and Marzluff WF: Degradation of histone mRNA requires oligouridylation followed by decapping and simultaneous degradation of the mRNA both 5′ to 3′ and 3′ to 5′. Genes Dev. 22:50–65. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ma L, Zhao Q, Chen W and Zhang Y: Oncogene Lin28B increases chemosensitivity of colon cancer cells in a let-7-independent manner. Oncol Lett 15: 6975-6981, 2018.
APA
Ma, L., Zhao, Q., Chen, W., & Zhang, Y. (2018). Oncogene Lin28B increases chemosensitivity of colon cancer cells in a let-7-independent manner. Oncology Letters, 15, 6975-6981. https://doi.org/10.3892/ol.2018.8250
MLA
Ma, L., Zhao, Q., Chen, W., Zhang, Y."Oncogene Lin28B increases chemosensitivity of colon cancer cells in a let-7-independent manner". Oncology Letters 15.5 (2018): 6975-6981.
Chicago
Ma, L., Zhao, Q., Chen, W., Zhang, Y."Oncogene Lin28B increases chemosensitivity of colon cancer cells in a let-7-independent manner". Oncology Letters 15, no. 5 (2018): 6975-6981. https://doi.org/10.3892/ol.2018.8250
Copy and paste a formatted citation
x
Spandidos Publications style
Ma L, Zhao Q, Chen W and Zhang Y: Oncogene Lin28B increases chemosensitivity of colon cancer cells in a let-7-independent manner. Oncol Lett 15: 6975-6981, 2018.
APA
Ma, L., Zhao, Q., Chen, W., & Zhang, Y. (2018). Oncogene Lin28B increases chemosensitivity of colon cancer cells in a let-7-independent manner. Oncology Letters, 15, 6975-6981. https://doi.org/10.3892/ol.2018.8250
MLA
Ma, L., Zhao, Q., Chen, W., Zhang, Y."Oncogene Lin28B increases chemosensitivity of colon cancer cells in a let-7-independent manner". Oncology Letters 15.5 (2018): 6975-6981.
Chicago
Ma, L., Zhao, Q., Chen, W., Zhang, Y."Oncogene Lin28B increases chemosensitivity of colon cancer cells in a let-7-independent manner". Oncology Letters 15, no. 5 (2018): 6975-6981. https://doi.org/10.3892/ol.2018.8250
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team