Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
July-2018 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2018 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

miR‑202 acts as a potential tumor suppressor in breast cancer

  • Authors:
    • Shanshan Gao
    • Chunfang Cao
    • Qingfu Dai
    • Jian Chen
    • Jiancheng Tu
  • View Affiliations / Copyright

    Affiliations: Department of Laboratory Medicine, Clinical Laboratory Medicine and Center for Gene Diagnosis, Zhongnan Hospital of Wuhan University, Wuhan, Hubei 430071, P.R. China, Central Laboratory, Longyan First Hospital Affiliated to Fujian Medical University, Longyan, Fujian 364000, P.R. China
  • Pages: 1155-1162
    |
    Published online on: May 16, 2018
       https://doi.org/10.3892/ol.2018.8726
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Breast cancer affects ~10% of women worldwide and is responsible for ~12% of all cancer‑associated mortalities. Breast cancer is more prone to metastasis compared with other types of cancer. Up to 5% of patients with breast cancer present with incurable metastasis and an additional 10‑15% of patients develop metastases within 3 years of their initial diagnosis. MicroRNAs (miRNAs) are short RNAs, 21‑25 nucleotides in length, that have been shown to significantly affect gene expression. In total >2,000 miRNAs have been identified and specific miRNAs have been revealed to be associated with cancer. In the present study, we observed that the majority of breast cancer specimens collected expressed low levels of miR‑202 compared with adjacent tissues and normal cell lines. Mechanistic investigations identified KRAS as a potential target gene of miR‑202 and it was demonstrated that miR‑202 exerted its tumor‑suppressive effects by regulating the expression of KRAS in breast cancer cells. Functional assays revealed that miR‑202 significantly reduced cell proliferation, migration and invasion in vitro. In summary, these results indicate the function of miR‑202 in breast cancer progression and suggest that its use within breast cancer therapy is promising.

Introduction

Breast cancer is one of the most common malignant tumors in women. In many areas, breast cancer is the most common malignancy in females. In China, the incidence of breast cancer is increasing annually. Because the development and progression of breast cancer are complex processes involving many genes, the underlying mechanism of breast cancer remains unclear (1,2).

Single-stranded RNAs consisting of 19 to 25 nucleotides are known as microRNAs (miRNAs). These RNAs are regulatory molecules that modulate the expression of functional genes, play an important role in many biological processes, and are expressed in a tissue- and time-specific manner. miRNAs regulate gene expression at the post-transcriptional level mainly via completely complementary or partially complementary binding to the 3′ UTR of the target gene, resulting in degradation or translational repression of the target gene (2–4). Studies have shown that a variety of miRNAs are involved in malignant transformation processes, such as malignant proliferation, metastasis and recurrence, and apoptosis inhibition. Studies have reported that miRNA inhibitors can reduce the high miR-21 expression in breast cancer cells, inhibiting proliferation and migration; that miR-373 can promote the metastasis of breast cancer cells; that miR-520 plays a role in promoting the development of breast cancer; and that miR-126 and miR-335 are able to inhibit breast cancer to a certain extent (5–7). Recent studies have demonstrated that miR-202 is associated with several types of cancer, miR-202 has a lower expression in several of cancers, and however, the expression and function of miR-202 have not been investigated in breast cancer (8).

KRAS belongs to the RAS family; it is located on the short arm of chromosome 12 and is 35 kb long. KRAS is a downstream molecule of the EGF receptor. It possesses four exons and one 5′ end non-coding exon, encoding a 189-aa RAS protein. This gene mainly functions in signaling pathways involving membrane receptors and cAMP. KRAS has the strongest influence on malignant cancer in the RAS family (9–12).

In our study, we found abnormal expression of miR-202 and KRAS in breast cancer. We also found that miR-202 may affect the proliferation and metastasis of breast cancer cells by regulating KRAS. Our results provide a new target for the diagnosis and treatment of breast cancer.

Materials and methods

Samples

Samples were collected from 30 patients (women aged 49–68 years) from May 2011 to 2013 at Zhongnan Hospital of Wuhan University (Wuhan, China). All patients reviewed the methods and significance of the study and provided written informed consent. The project was approved by the ethics committee for medical science research of Zhongnan Hospital of Wuhan University. All cancer tissues were pathologically confirmed to be breast cancer.

MicroRNA microarray analysis

A total of 500 ng of RNA was subjected to Agilent miRNA microarray analysis (Guangzhou RiboBio Co., Ltd., Guangzhou, China). Differences between groups were examined for statistical significance with an unpaired Student's t test.

Cell culture

293, MCF7 and `-MB-231 cells were cultured in DMEM supplemented with 10% FCS (both Invitrogen; Thermo Fisher Scientific Inc., Waltham, MA, USA), 100 IU/ml penicillin and 100 mg/ml streptomycin (Shanghai Shenggong Biology Engineering Technology Service, Ltd., Shanghai, China) at 37°C in a humidified atmosphere containing 5% CO2.

MTT assays

Cells were plated in 96-well plates at a density of 1×104 cells per well; 24 h later, the cells were transfected or treated as indicated. At the end of the incubation, cellular proliferation was measured by MTT assays. The optical density at 490 nm was measured using a microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Metastasis assay

A total of 1×105 cells were seeded onto the upper part of a transwell chamber (BD Bioscience, Franklin Lakes, NJ, USA) containing a gelatin-coated polycarbonate membrane filter (pore size: 8 mm) for migration and invasion assays. Serum-free medium was added to the upper well, and medium containing 10% FBS was added to the lower well. After 24 h of incubation at 37°C with 5% CO2, the filters were stained with crystal violet (Amresco, LLC., Solon, OH, USA). Five random fields were counted per chamber by using an inverted microscope.

Real-time PCR

Total RNA was isolated with TRIzol (Invitrogen; Thermo Fisher Scientific Inc.) according to the manufacturer's protocol. Complementary DNA was synthesized by reverse transcription of total RNA using an RT reaction kit (Promega Corp., Madison, WI, USA). Real-time PCR was performed according to the manufacturer's instructions. SYBR Premix Ex Taq (TaKaRa Bio, Inc., Otsu, Japan) was used as a DNA-specific fluorescent dye. The primer sequences in Table I were synthesized.

Table I.

Primer sequences.

Table I.

Primer sequences.

NameForward primer (5′-3′)Reverse primer (5′-3′)
KRAS TACCAFCAACTCCAACGG GAACCCAAGGCATCTCCA
GAPDH AGAAGGCTGGGGCTCATTTG AGGGGCCATCCACAGTCTTC
microRNA-202 CTCCAGAGAGAUAGUAGAGCCT CTCAACCAATCACCTGGCACAGA
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT

All reactions were repeated at least three times. Gene expression levels were calculated relative to GAPDH or U6 with Stratagene Mx 3000P software.

Western blot analysis

Total proteins were extracted using radioimmunoprecipitation (RIPA) assay buffer (Wlaterson, Barcelona, Spain) and were quantified using a bicinchoninic acid (BCA) protein assay kit (Wlaterson). Equal amounts of protein (60 µg) were boiled at 100°C for 5 min, separated on 12% sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE), and electrotransferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA, USA). The membranes were blocked with 10% skim milk (w/v) at room temperature for 2 h. Target proteins were probed with specific antibodies against KRAS and GAPDH (Santa Cruz, Biotechnology, Inc., Dallas, TX, USA). The membranes were stripped and re-probed with an antibody against GAPDH to verify equal loading.

Construction of stable siRNA-expressing cell lines

To stably silence KRAS, cells were transfected with the pRS-si-KRAS plasmid (Shanghai GeneChem Co., Ltd., Shanghai, China) and were selected with G418 (400 µg/ml). After 3 weeks, stable cells were selected, cultured and amplified.

Statistical analysis

All experiments were repeated at least three times. A log-rank test was used to evaluate the correlation between possible prognostic factors. Statistical significance between two groups of data was evaluated by Student's t test (two-tailed). One-way ANOVA and Dunnett's post hoc test were used for comparisons among multiple groups. Statistical analysis was performed using GraphPad Prism software (GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered to indicate statistically significant difference.

Results

The expression of miR-202 and KRAS in breast cancer

Many miRNAs were abnormally expressed in breast cancer tissue. We found that the difference in expression of miR-202 between breast cancer and normal tissues was the largest of the miRNAs identified in our study (Table II). To determine the significance of miR-202 and KRAS expression in breast cancer, the expression of miR-202 was detected using real-time PCR in both breast cancer tissues and in human cell lines, including 293, MCF7 and MDA-MB-231 cells. miR-202 expression was significantly lower in breast cancer tissues than in adjacent tissues (Fig. 1A). We found the expression of miR-202 in MCF7 cells and MDA-MB-231 cells was significantly lower than in normal 293 cells (Fig. 1B). Meanwhile, KRAS expression was obviously up regulated in the 30 breast cancer samples analyzed. Similar results were also observed MCF7 and MDA-MB-231 cells (Fig. 1C, D).

Figure 1.

The expression of miR-202 and KRAS in breast cancer. (A) Relative miR-202 expression in 30 pairs of breast cancer tissues and adjacent normal counterpart tissues was detected using real-time PCR. (B) Relative miR-202 expression in 293, MCF7 and MDA-MB-231 cell lines. (C) Relative KRAS expression in 30 pairs of breast cancer tissues and adjacent normal counterpart tissues was detected using real-time PCR. (D) Relative KRAS expression in 293, MCF7 and MDA-MB-231 cell lines. *P<0.05 and **P<0.01 vs. 293 cells or adjacent normal tissue. miR, micro RNA; PCR, polymerase chain reaction.

Table II.

Differentially expressed miRNAs in breast cancer.

Table II.

Differentially expressed miRNAs in breast cancer.

miRNAFold changeTrend
miR-20238.92Down
miR-3411.02Down
miR-298.43Down
miR-3422.98Down
miR-2117.98Up
miR-26912.20Up

[i] miR, microRNA.

miR-202 inhibits KRAS expression in breast cancer cells

A correlation analysis showed that miR-202 expression was negatively correlated with KRAS expression in breast cancer (Fig. 2A). The miRDB tool indicated that miR-202 could bind to the 3′ UTR of KRAS (Fig. 2B). A luciferase reporter assay was used to determine whether KRAS was a potential target gene of miR-202 (Fig. 2C). Co-transfection of KRAS-WT and miR-202 resulted in lower luciferase activity in 293 cells, while co-expression studies with either KRAS-DEL or miR-202 AS (antisense) showed no change in luciferase activity. Further, upon transfection of a miR-202 mimic, downregulation of KRAS expression was observed at both the protein and mRNA levels. Inhibiting miR-202 by transfecting cells with a miR-202 inhibitor resulted in upregulation of KRAS (Fig. 2D-G).

Figure 2.

miR-202 inhibits the expression of KRAS in breast cells. (A) Correlation analysis between miR-202 and KRAS expression. The correlation formula is y=−0.4345×+0.8545. (B) The mirDB tool predicted that miR-202 may target KRAS. (C) A luciferase reporter gene assay confirmed that miR-202 was able to target KRAS. (D) The protein and (E) mRNA expression in KRAS was measured in MCF7 cells treated with an miR-202 mimic using western blot and RT-qPCR, respectively. (F) The protein and (G) mRNA expression in KRAS was measured in MCF7 cells treated with an miR-202 inhibitor using western blot and RT-qPCR, respectively. GAPDH was used as an internal loading control. Each bar represents the mean ± standard deviation of three independent experiments; **P<0.05 vs. the control. miR, micro RNA; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

miR-202 inhibits the proliferation of breast cancer cells

An MTT assay was used to examine the effect of miR-202 on cell proliferation. Overexpression of miR-202 significantly blocked the proliferation of both MCF7 and MDA-MB-231 cells (Fig. 3A). By contrast, a lower miR-202 expression level promoted cell proliferation (Fig. 3B).

Figure 3.

miR-202 inhibits the proliferation of breast cancer cells. (A) Cell proliferation was measured using an MTT assay after 24 h of transfection. MCF7 and MDA-MB-231 cells were transfected with a miR-202 mimic or a scramble control miRNA. (B) Cell proliferation was measured using an MTT assay after 24 h of transfection. MCF7 and MDA-MB-231 cells were transfected with a miR-202 inhibitor or control miRNA. **P<0.05 vs. the control. miR, microRNA; OD, optical density.

miR-202 inhibits the metastasis of breast cancer cells

To study the effect of miR-202 on the metastasis of breast cancer cells, transwell assays (with or without Matrigel) were performed. miR-202 significantly suppressed the migration and invasion potential of breast cancer cells (Fig. 4A-D). The above results indicated that miR-202 could inhibit the growth and metastasis of breast cells, possibly by targeting KRAS.

Figure 4.

miR-202 inhibits the metastasis of breast cancer cells. (A) The migration capacity of MCF7 cells was measured by a Transwell migration assay after the cells were transfected with a miR-202 mimic or a scramble control miR for 24 h. Overexpression of miR-202 inhibited the migration and invasion of MCF7 cells. (B) The migration capacity of MCF7 cells was measured by a Transwell migration assay after the cells were transfected with a miR-202 inhibitor or scramble control miR for 24 h. Downregulation of miR-202 promoted the migration and invasion of MCF7 cells. (C) The migration capacity of MDA-MB-231 cells was measured by a Transwell migration assay after the cells were transfected with a miR-202 mimic or scramble control miR for 24 h. Overexpression of miR-202 inhibited the migration and invasion of MCF7 cells. (D) The migration capacity of MDA-MB-231 cells was measured by a Transwell migration assay after the cells were transfected with a miR-202 inhibitor or scramble control miR for 24 h. Downregulation of miR-202 promoted the migration and invasion of MCF7 cells. The relative ratio of invasive cells per field is shown. Magnification, ×400. **P<0.05, vs. the control. miR, microRNA.

miR-202 inhibits the proliferation and migration of breast cancer cells by targeting KRAS

After generating stable si-KRAS-expressing cells, the cells were transfected with a miR-202 inhibitor or a control inhibitor. The effect of miR-202 inhibition on cell proliferation and migration was detected by MTT and transwell assays (Fig. 5A-C). The results indicated that miR-202 inhibition restored the cell proliferation and migration that were blocked by si-KRAS. Western blot and real time PCR showed that miR-202 inhibition resulted in re-expression of the silenced KRAS (Fig. 5D-E).

Figure 5.

miR-202 inhibits the proliferation and migration of breast cancer cells by targeting KRAS. (A) Cell proliferation was measured using an MTT assay after 24 h of transfection. After transfection with si-KRAS, MCF7 and MDA-MB-231 cells were transfected with a miR-202 inhibitor or control miR. Cell migration was measured using a Transwell assay after 24 h of transfection. After transfection with si-KRAS, (B) MCF7 and (C) MDA-MB-231 cells were transfected with a miR-202 inhibitor or control miR. After transfection with si-KRAS MCF7 cells were transfected with a miR-202 inhibitor or control miR. Magnification, ×400. The (D) protein and (E) mRNA levels of KRAS were measured in MCF7 cells using western blot and reverse transcription-quantitative polymerase chain reaction, respectively. GAPDH was used as an internal loading control. Each bar represents the mean ± standard deviation of three independent experiments. **P<0.05, vs. the control. Si, small interfering; miR, microRNA.

The above results indicated that miR-202 could inhibit the growth and metastasis of breast cancer cells by targeting KRAS.

Discussion

Breast cancer is one of the most common malignant tumors in the world and seriously affects women's physical and mental health. The incidence of breast cancer has been rising since the 1970s (13). Despite marked improvement in the prognosis of breast cancer patients after surgery and adjuvant therapy, breast cancer still has a high rate of recurrence and mortality. In recent years, with the development of targeted therapies for breast cancer, mortality has declined; however, the mortality rate of breast cancer remains high, and breast cancer is still a major threat to women's health. Therefore, it is important to elucidate the pathogenesis of breast cancer and develop new treatment strategies (14,15).

miRNAs are a group of non-protein coding, short, single-stranded RNAs that are considered to be promising molecular markers and therapeutic targets in several cancers. miR-202 has been identified as a potential tumor suppressor in various cancers. A previous study revealed that miR-202 upregulation induced novel anticancer effects upregulation in NSCLC and indicated that STAT3 may be a molecular target of miR-202. In human ESCCs, miR-202 regulated apoptosis by targeting HSF2 via mechanism involving caspase-3. A study also identified that miR-202 plays an important role in regulating cell proliferation, migration and invasion of cervical cancer (CC) by directly targeting cyclin D1, and miR-202 may represent a potential therapeutic target for patients with CC (16–22). In addition, a previous study showed that an increased serum concentration of miR-202 may be a strong independent prognostic factor for breast cancer patients (20). Mutations in KRAS lead to sustained activation of the RAS protein, independent of EGFR/HER receptor activation, and eventually cause abnormalities in the RAS signaling pathway. KRAS gene mutations can affect cell growth, proliferation, migration and differentiation and lead to malignant transformation of cells (23–25).

In our study, we found lower expression of miR-202 in breast cancer cells and tissues, indicating that miR-202 may have an inhibitory effect on breast cancer. We identified several potential reasons why miR-202 may have an inhibitory effect on breast cancer. First, we found that miR-202 is negatively correlated with KRAS and can regulate the activity of KRAS to some extent. We also found that overexpression of miR-202 inhibited the proliferation of breast cancer cells. Conversely, when the expression of miR-202 was upregulated, the proliferative capacity of breast cancer cells decreased. Afterwards, we demonstrated that overexpression of miR-202 inhibited the migration and invasion of breast cancer cells. Via a recovery experiment, we also found that miR-202 inhibition could restore cell proliferation and migration blocked by KRAS silencing. In follow-up experiments, the authors intend to further study the effect of miR-202 on breast cancer in vivo.

In summary, our data clarified that miR-202 could inhibit the growth and metastasis of breast cancer cells by targeting KRAS. Although further in vivo tests are needed to confirm our results, our data provide an experimental basis for the treatment of breast cancer.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JT conceived and designed the study, acquired the specimens and data, directed the drafting of manuscript and revised it, and provided the financial support. SG designed the study and took responsibility for the experiments. CC performed the metastasis assay, QD performed the statistical analysis. JC performed the western blot analysis.

Ethics approval and consent to participate

All patients provided written informed consent. The project was approved by the Ethics Committee for Medical Science Research of Zhongnan Hospital of Wuhan University.

Consent for publication

All patients provided written informed consent for the publication of their data.

Competing interests

The authors confirm that they have no competing interests.

References

1 

Rizzo S, Cangemi A, Galvano A, Fanale D, Buscemi S, Ciaccio M, Russo A, Castorina S and Bazan V: Analysis of miRNA expression profile induced by short term starvation in breast cancer cells treated with doxorubicin. Oncotarget. 8:71924–71932. 2017. View Article : Google Scholar : PubMed/NCBI

2 

Mandujano-Tinoco EA, Garcia-Venzor A, Muñoz-Galindo L, Lizarraga-Sanchez F, Favela-Orozco A, Chavez-Gutierrez E, Krötzsch E, Salgado RM, Melendez-Zajgla J and Maldonado V: miRNA expression profile in multicellular breast cancer spheroids. Biochim Biophys Acta. 1864:1642–1655. 2017. View Article : Google Scholar : PubMed/NCBI

3 

Li P, Xu T, Zhou X, Liao L, Pang G, Luo W, Han L, Zhang J, Luo X, Xie X and Zhu K: Downregulation of miRNA-141 in breast cancer cells is associated with cell migration and invasion: Involvement of ANP32E targeting. Cancer Med. 6:662–672. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Lykov AP, Kabakov AV, Kazakov OV, Bondarenko NA, Poveshchenko OV, Raiter TV, Poveshchenko AF, Strunkin DN and Konenkov VI: Levels of miRNA and hormones in thoracic duct lymph in rats with experimental breast cancer induced by N-methyl-N-nitrosourea. Bull Exp Biol Med. 162:387–390. 2017. View Article : Google Scholar : PubMed/NCBI

5 

Bhardwaj A, Singh H, Rajapakshe K, Tachibana K, Ganesan N, Pan Y, Gunaratne PH, Coarfa C and Bedrosian I: Regulation of miRNA-29c and its downstream pathways in preneoplastic progression of triple-negative breast cancer. Oncotarget. 8:19645–19660. 2017. View Article : Google Scholar : PubMed/NCBI

6 

Danza K, Summa S, Pinto R, Pilato B, Palumbo O, Carella M, Popescu O, Digennaro M, Lacalamita R and Tommasi S: TGFbeta and miRNA regulation in familial and sporadic breast cancer. Oncotarget. 8:50715–50723. 2017. View Article : Google Scholar : PubMed/NCBI

7 

Fang H, Xie J, Zhang M, Zhao Z, Wan Y and Yao Y: miRNA-21 promotes proliferation and invasion of triple-negative breast cancer cells through targeting PTEN. Am J Transl Res. 9:953–961. 2017.PubMed/NCBI

8 

Zhang L, Xu J, Yang G, Li H and Guo X: miR-202 inhibits cell proliferation, migration, and invasion by targeting EGFR in human bladder cancer. Oncol Res. Jan 3–2018.(Epub ahead of print). View Article : Google Scholar

9 

Kim RK, Suh Y, Yoo KC, Cui YH, Kim H, Kim MJ, Kim Gyu I and Lee SJ: Activation of KRAS promotes the mesenchymal features of basal-type breast cancer. Exp Mol Med. 47:e1372015. View Article : Google Scholar : PubMed/NCBI

10 

Kim Y, Kim J, Lee HD, Jeong J, Lee W and Lee KA: Spectrum of EGFR gene copy number changes and KRAS gene mutation status in Korean triple negative breast cancer patients. PLoS One. 8:e790142013. View Article : Google Scholar : PubMed/NCBI

11 

McVeigh TP, Jung SY, Kerin MJ, Salzman DW, Nallur S, Nemec AA, Dookwah M, Sadofsky J, Paranjape T, Kelly O, et al: Estrogen withdrawal, increased breast cancer risk and the KRAS-variant. Cell Cycle. 14:2091–2099. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Su X, Zhang L, Li H, Cheng P, Zhu Y, Liu Z, Zhao Y, Xu H, Li D, Gao H and Zhang T: MicroRNA-134 targets KRAS to suppress breast cancer cell proliferation, migration and invasion. Oncol Lett. 13:1932–1938. 2017. View Article : Google Scholar : PubMed/NCBI

13 

Zeng Y, Zhou Z, Fan M, Gong T, Zhang Z and Sun X: PEGylated cationic vectors containing a protease-sensitive peptide as a miRNA delivery system for treating breast cancer. Mol Pharm. 14:81–92. 2017. View Article : Google Scholar : PubMed/NCBI

14 

Zhang J, Le TD, Liu L and Li J: Inferring miRNA sponge co-regulation of protein-protein interactions in human breast cancer. BMC Bioinformatics. 18:2432017. View Article : Google Scholar : PubMed/NCBI

15 

Zhang L, Yang X, Lv Y, Xin X, Qin C, Han X, Yang L, He W and Yin L: Cytosolic co-delivery of miRNA-34a and docetaxel with core-shell nanocarriers via caveolae-mediated pathway for the treatment of metastatic breast cancer. Sci Rep. 7:461862017. View Article : Google Scholar : PubMed/NCBI

16 

Zhao Z, Lv B, Zhang L, Zhao N and Lv Y: miR-202 functions as a tumor suppressor in non-small cell lung cancer by targeting STAT3. Mol Med Rep. 16:2281–2289. 2017. View Article : Google Scholar : PubMed/NCBI

17 

Mody HR, Hung SW, Pathak RK, Griffin J, Cruz-Monserrate Z and Govindarajan R: miR-202 diminishes TGFβ receptors and attenuates TGFβ1-Induced EMT in pancreatic cancer. Mol Cancer Res. 15:1029–1039. 2017. View Article : Google Scholar : PubMed/NCBI

18 

Zhang Y, Chen Z, Li MJ, Guo HY and Jing NC: Long non-coding RNA metastasis-associated lung adenocarcinoma transcript 1 regulates the expression of Gli2 by miR-202 to strengthen gastric cancer progression. Biomed Pharmacother. 85:264–271. 2017. View Article : Google Scholar : PubMed/NCBI

19 

Yi Y, Li H, Lv Q, Wu K and Zhang W, Zhang J, Zhu D, Liu Q and Zhang W: miR-202 inhibits the progression of human cervical cancer through inhibition of cyclin D1. Oncotarget. 7:72067–72075. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Farhana L, Dawson MI and Fontana JA: Down regulation of miR-202 modulates Mxd1 and Sin3A repressor complexes to induce apoptosis of pancreatic cancer cells. Cancer Biol Ther. 16:115–124. 2016. View Article : Google Scholar

21 

Joosse SA, Müller V, Steinbach B, Pantel K and Schwarzenbach H: Circulating cell-free cancer-testis MAGE-A RNA, BORIS RNA, let-7b and miR-202 in the blood of patients with breast cancer and benign breast diseases. Br J Cancer. 111:909–917. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Zhao Y, Li C, Wang M, Su L, Qu Y, Li J, Yu B, Yan M, Yu Y, Liu B and Zhu Z: Decrease of miR-202-3p expression, a novel tumor suppressor, in gastric cancer. PLoS One. 8:e697562013. View Article : Google Scholar : PubMed/NCBI

23 

Cejalvo JM, Pérez-Fidalgo JA, Ribas G, Burgués O, Mongort C, Alonso E, Ibarrola-Villava M, Bermejo B, Martínez MT, Cervantes A and Lluch A: Clinical implications of routine genomic mutation sequencing in PIK3CA/AKT1 and KRAS/NRAS/BRAF in metastatic breast cancer. Breast Cancer Res Treat. 160:69–77. 2016. View Article : Google Scholar : PubMed/NCBI

24 

Ustinova M, Daneberga Z, Bērziņa D, Nakazawa-Miklaševiča M, Maksimenko J, Gardovskis J and Miklaševičs E: Impact of KRAS variant rs61764370 on breast cancer morbidity. Exp Oncol. 37:292–294. 2015.PubMed/NCBI

25 

Huang X, Yang Y, Guo Y, Cao ZL, Cui ZW, Hu TC and Gao LB: Association of a let-7 KRAS rs712 polymorphism with the risk of breast cancer. Genet Mol Res. 14:16913–16920. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gao S, Cao C, Dai Q, Chen J and Tu J: miR‑202 acts as a potential tumor suppressor in breast cancer. Oncol Lett 16: 1155-1162, 2018.
APA
Gao, S., Cao, C., Dai, Q., Chen, J., & Tu, J. (2018). miR‑202 acts as a potential tumor suppressor in breast cancer. Oncology Letters, 16, 1155-1162. https://doi.org/10.3892/ol.2018.8726
MLA
Gao, S., Cao, C., Dai, Q., Chen, J., Tu, J."miR‑202 acts as a potential tumor suppressor in breast cancer". Oncology Letters 16.1 (2018): 1155-1162.
Chicago
Gao, S., Cao, C., Dai, Q., Chen, J., Tu, J."miR‑202 acts as a potential tumor suppressor in breast cancer". Oncology Letters 16, no. 1 (2018): 1155-1162. https://doi.org/10.3892/ol.2018.8726
Copy and paste a formatted citation
x
Spandidos Publications style
Gao S, Cao C, Dai Q, Chen J and Tu J: miR‑202 acts as a potential tumor suppressor in breast cancer. Oncol Lett 16: 1155-1162, 2018.
APA
Gao, S., Cao, C., Dai, Q., Chen, J., & Tu, J. (2018). miR‑202 acts as a potential tumor suppressor in breast cancer. Oncology Letters, 16, 1155-1162. https://doi.org/10.3892/ol.2018.8726
MLA
Gao, S., Cao, C., Dai, Q., Chen, J., Tu, J."miR‑202 acts as a potential tumor suppressor in breast cancer". Oncology Letters 16.1 (2018): 1155-1162.
Chicago
Gao, S., Cao, C., Dai, Q., Chen, J., Tu, J."miR‑202 acts as a potential tumor suppressor in breast cancer". Oncology Letters 16, no. 1 (2018): 1155-1162. https://doi.org/10.3892/ol.2018.8726
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team