Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
July-2018 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2018 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Wnt6 contributes tumorigenesis and development of colon cancer via its effects on cell proliferation, apoptosis, cell‑cycle and migration

  • Authors:
    • Xiao‑Li Zheng
    • Hong‑Gang Yu
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology, Renmin Hospital of Wuhan University, Wuhan, Hubei 430060, P.R. China
  • Pages: 1163-1172
    |
    Published online on: May 16, 2018
       https://doi.org/10.3892/ol.2018.8729
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Wnt proteins have been reported to contribute to the progression of various types of cancer. Wnt6 is a member of the Wnt family and may promote tumorigenesis in gastrointestinal cancer and cervical cancer. In the present study, the expression of Wnt6 in human colon cancer cell lines was evaluated, in order to investigate the role of Wnt6 in the development of colon cancer. Additionally, the effects of Wnt6 upregulation or downregulation on proliferation, apoptosis, cell cycle and cell migration of colon cancer cells have been investigated. Furthermore, western blot analysis was employed to evaluate the expression of Wnt6, B‑cell lymphoma 2‑associated X protein (Bax), caspase‑3 and matrix metalloproteinase (MMP)2. The results of the present study demonstrated that the expression of Wnt6 was increased in HCT116 and SW480 cells compared with the remaining colon cancer cell lines. Furthermore, overexpression Wnt6 resulting from transfection of pGPU6/GFP/Neo‑Wnt6‑Homo‑1 plasmid promoted the proliferation, cell cycle and migration of HCT116 and SW480 cells, but inhibited cell apoptosis in vitro. The expression of caspase‑3 and MMP2 was increased, whereas the expression of Bax was decreased in response to upregulation of Wnt6. These results suggested that Wnt6 may serve a vital function in the development of colon cancer.

Introduction

Colon cancer is a common malignant tumor of the gastrointestinal tract and is the fourth leading cause of cancer-associated mortality (1). The 5-year survival rate of patients with colon cancer is 50% (1,2). The onset of colon cancer is associated with genetic and environmental factors (e.g., exposure to carcinogens and smoking) (3). Inactivation of tumor suppressor genes and mutation of oncogenes lead to the development of malignant tumors (3). Previous studies investigated the effect of drugs on the proliferation, adhesion, invasion and migration of colon cancer cells, and the underlying molecular mechanisms of drug resistance in colon cancer (4–9).

The Wnt signaling pathway regulates diverse developmental processes, including cell adhesion, proliferation, differentiation, migration and apoptosis (10). Previous studies have demonstrated that numerous types of cancer, including melanoma, hepatocarcinoma, gastrointestinal, breast and ovarian cancer (11), are associated with abnormal Wnt signaling pathway. Abnormal activation of Wnt signaling pathway has been reported in colorectal cancer (12,13). Wnt family of proteins includes at least 19 secreted-type glycoproteins with conserved 22–24 cysteine residues, and serves vital functions in carcinogenesis and embryogenesis (14). Previous studies have reported that Wnt6 is upregulated in gastrointestinal cancer and cervical cancer, and overexpression of Wnt6 promotes physiological or pathological processes via activation of Wnt/β-catenin signaling pathway in various cancer cell lines (15–18). Wnt6 is highly expressed in colorectal adenoma and may be associated with increased risk of colorectal cancer (19). However, the role of Wnt6 in occurrence, progression and metastasis of colon cancer remains unclear.

In the present study, the expression of Wnt6 was evaluated in colon cancer cell lines (LoVo, SW480, HCT116, SW620 and HT29). The effects of overexpression and knockdown of Wnt6 on proliferation, cell cycle and apoptosis of colon cancer cells were investigated. The aim of the present study was to investigate the function of Wnt6 in tumorigenesis and progression of colon cancer and provide the basis for a novel therapeutic target in the treatment of colon cancer.

Materials and methods

Cell culture

Wnt6 high expression cell lines were selected from five human colon cancer cell lines (LoVo, SW480, HCT116, SW620 and HT29). Cells were maintained in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml of penicillin and 100 µg/ml of streptomycin, and were cultured at 37°C in a humidified atmosphere containing 5% CO2.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from cells using TRIzol reagent (Ambion; Thermo Fisher Scientific, Inc.). RNA was reverse-transcribed into cDNA using PrimeScript™ 1st Strand cDNA Synthesis kit (Takara Biotechnology Co., Ltd., Dalian, China), and qPCR was performed using a KAPA SYBR Green qPCR kit (Kapa Biosystems, Inc., Wilmington, MA, USA). The primer sequences for Wnt6 were as follows: 5′-CGGAAGTGGTGGCAGAG-3′ (forward) and 5′-CAGGATGCGTCCAAAGG-3′ (reverse). The primer sequences for β-actin were as follows: 5′-ACACTGTGCCCATCTACG-3′ (forward) and 5′-TGTCACGCACGATTTCC-3′ (reverse). Each reaction (20 µl total volume) contained 10 µl SYBR, 0.40 µmol/l each primer and 0.2±0.02 µg cDNA template. The thermocycling conditions were as follows: Pre-denaturation at 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 5 sec, annealing at 60°C for 20 sec and elongation at 72°C for 20 sec. The threshold cycle (Ct) was determined for each reaction by using the 2−ΔΔCq method, which generated Ct values for each gene of interest normalized to the endogenous control gene (β-actin) (20). For each group, three replicates of each measurement were performed.

Cell transfection

Cells (HTC116 or SW480) in 1×105 cells/ml were seeded in 6-well plates and cultured until cells reached confluency (70–80%). Cells were then transfected with 800 ng/well of plasmids using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The primers for Wnt6 were as follows: 5′-CACCCTGCCGCCCTTACCCTCC-3′ (forward) and 5′-GATCCGGGTCACAGGCAGAGGC-3′ (reverse). The corresponding cDNAs were inserted into the pGPU6/green fluorescent protein (GFP)/Neo vector to construct the recombinant pGPU6/GFP/Neo-Wnt6-Homo-1 plasmid, to overexpress Wnt6 (GenePharma Shanghai, China). An empty vector (EV) was used as a negative control. Additionally, specific short hairpin (sh)RNA-expressing vectors were employed to knockdown Wnt6. Negative control (NC) pGPU6/GFP/Neo-shNC (target sequence, GTTCTCCGAACGTGTCACGT) and pGPU6/GFP/Neo-Wnt6-Homo-A (target sequence, AAGTGGTGGCAGAGCTAGCTC) vectors were obtained from Shanghai GenePharma Co., Ltd. (Shanghai, China). Untransfected HCT116 or SW480 cells consider as control group.

MTT assay

Cell proliferation was evaluated using an MTT assay. HCT116 and SW480 cells were seeded in 96-well plates and transfected with expression or empty vector with 1×104 cells in each well. At indicated timepoints (24, 48 and 72 h), 20 µl MTT (5 mg/ml; Bioswamp, Wuhan, China) was added to each culture prior to incubation at 37°C for an additional 4 h. Then, DMEM medium was removed and 150 µl dimethylsulfoxide was added to each well and mixed for 10 min. Absorbance was read at a wavelength of 490 nm.

Flow cytometric analysis of apoptosis

Apoptosis was detected by double staining with Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) (BD Biosciences, Franklin Lakes, NJ, USA), according to the manufacturer's protocol. At 48 h post-transfection, HCT116 and SW480 cells (1×106 cells/ml) were washed three times with ice-cold PBS and incubated for 30 min at 4°C in the dark in 200 µl binding buffer containing 10 µl Annexin V-FITC and 10 µl PI. Apoptotic cells were analyzed using a flow cytometer (Beckman Coulter, Inc., Brea, CA, USA) and Cytomics FC 500 MCL with CXP software 5.0 network (Beckman Coulter, Inc.).

Analysis of cell cycle

Cell cycle was analyzed using flow cytometry. At 48 h post-transfection, HCT116 and SW480 cells in 1×106 cells/ml were washed with ice-cold PBS and then fixed with 70% ethanol at 4°C for 1 h. Following washing with PBS, cells were stained with PI [10 mM Tris (pH 7.0), 0.1% NP-40, 1 mM NaCl, 0.7 µg/ml ribonuclease A and 5 µg/ml PI] for 30 min in the dark. Cell cycle analysis was performed using a flow cytometer and Cytomics FC 500 MCL with CXP 5.0 software.

Cell migration assay

Cell migration were assessed using Transwell assays. HCT116 and SW480 cells (1×105 cells/ml) were starved in serum-free DMEM medium for 24 At 48 h, cells were fixed for 10 min using 4% paraformaldehyde (Bioswamp; Wuhan Beinglay Biological Technology Co., Wuhan, China) and incubated with 0.5% crystal violet (Bioswamp; Wuhan Beinglay Biological Technology Co.) for 30 min. A total of 100 µl cell suspension was seeded into transwell chambers with 8 µm prore polycarbonate membrane insert (Corning Incorporated, Corning, NY, USA). A total of 600 µl RPMI-1640 medium (Beijing Solarbio Science & Technology, Co., Ltd., Beijing, China) containing 20% FBS was added in lower chambers. Following incubation for 24 h in transwell chamber, cells remaining on the upper membrane were removed carefully with a cotton swab. Stained cells were counted in three fields using a light microscope (Nikon Corporation, Tokyo, Japan; magnification, ×200).

Western blot analysis

Western blot analysis was performed as previously described (21). Antibodies against Wnt6 (cat. no. ab50030, 1:500 dilution; Abcam, Cambridge, UK), B-cell lymphoma 2 (Bcl-2)-associated X protein (Bax) (cat. no. ab32503, 1:2,000 dilution; Abcam), caspase-3 (cat. no. ab32351, 1:2,000 dilution; Abcam), matrix metalloproteinase (MMP)2 (cat. no. ab37150, 1:1,000 dilution; Abcam) and β-actin (cat. no. 49675, 1:1,000 dilution; Cell Signaling Technology, Inc., Danvers, MA, USA) were used. HCT116 and SW480 cells were washed twice with PBS and homogenized in radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) containing protease inhibitor (cat. no. 58715; Cell Signaling Technology) and centrifuged at 12,000 × g for 15 min at 4°C. The concentration of the proteins was measured using a bicinchoninic acid assay kit (cat. no. P0011; Beyotime Institute of Biotechnology). A total of 30 µg proteins were separated by 10% SDS-PAGE and transferred onto a polyvinylidene difluoride membrane (Merck KGaA, Darmstadt, Germany). The membranes were blocked with 5% skim milk for 2 h at room temperature in Tris-buffered saline. Then, the membranes were incubated with primary antibodies overnight at 4°C. Anti-β-actin antibody was selected as internal reference. Then, the membranes were washed with Tris-buffered saline and incubated in biotinylated goat IgG conjugated to horseradish peroxidase (HRP) secondary antibody (cat. no. ab7090, Abcam) for 2 h at room temperature. Immunoreactivity was visualized by colorimetric reaction using an enhanced chemiluminesence substrate buffer (Merck KgaA). Membranes were scanned with Gel Doz EZ imager (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Bans were quantified using Quantity One 5.0 software (Bio-Rad Laboratories, Inc.).

Statistical analysis

Data were analyzed using SPSS software (version 18.0; SPSS, Inc., Chicago, IL, USA). The relevant data are expressed as the mean ± standard error of the mean. Statistical analysis was performed using one-way analysis of variance followed by Duncan's multiple range test. P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of Wnt6 in human colon cancer cell lines

RT-qPCR was employed to evaluate the expression levels of Wnt6 in human colon cancer cells. The results demonstrated that HCT116 and SW480 cells exhibited increased expression levels of Wnt6 (Fig. 1A). Therefore, we selected HCT116 and SW480 cells lines in the further studies, to explore the effect of Wnt6 expression on colon cancer. Additionally, pGPU6/GFP/Neo-Wnt6-Homo-1 plasmid was constructed to assess the effects of overexpression of Wnt6, whereas specific shRNA-expressing vectors were employed to knockdown Wnt6. Fig. 1B and C demonstrate the transfection efficiency of vectors using HCT116 and SW480 cells. As presented in Fig. 1D and E, shWnt6 (a plasmid carrying shRNA targeting Wnt6) significantly reduced the expression of Wnt6, whereas pWnt6 (Wnt6 overexpression plasmid) significantly increased the expression of Wnt6 in HCT116 and SW480 cells.

Figure 1.

Expression of Wnt6 in human colon cancer cell lines. (A) RT-qPCR analysis of the expression levels of Wnt6 in colon cancer cells (LoVo, SW480, HCT116, SW620 and HT29). **P<0.01 vs. LoVo; ##P<0.01 vs. SW480; ▲▲P<0.01 vs. HCT116; rrP<0.01 vs. SW620. HCT116 cells and SW480 cell were transfected with The shNC, shWnt6, EV or pWnt6 were successfully transfected into (B) HCT116 cells and (C) SW480 cell and detected using fluorescence microscope. The expression levels of Wnt6 in (D) HCT116 cells and (E) SW480 cells transfected with shNC, shWnt6, EV or pWnt6 as detected using RT-qPCR. **P<0.01 vs. shNC; ##P<0.01 vs. shWnt6. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; sh, short hairpin; NC, negative control; EV, empty vector; p, plasmid; CON, control.

Overexpression of Wnt6 induced colon cancer cell proliferation

Cell proliferation was evaluated using an MTT assay. Cells were divided into the following groups: Control, shNC (transfection with negative control), shWnt6 (transfection with shWnt6), EV (transfection with empty vector) and shWnt6+pWnt6 (combined transfection with shWnt6 and pWnt6). The results demonstrated that cell proliferation was decreased in the shWnt6 group compared with that of the shNC group at 24, 48 and 72 h (Fig. 2A and B), indicating downregulation of Wnt6 inhibited the proliferation of HTC116 and SW480. Cell viability was significantly increased in the shWnt6+pWnt6 group in a time-dependent manner compared with the shWnt6 group (Fig. 2A and B). Therefore, knockdown of Wnt6 decreased cell proliferation and transfection with pWnt6 reversed this effect in HCT116 and SW480 cells.

Figure 2.

Wnt6 promotes cell proliferation in HCT116 and SW480 cells. Cell proliferation was evaluated using an MTT assay. The proliferation of (A) HCT116 and (B) SW480 cells in CON, shNC, shWnt6, EV and shWnt6 groups. **P<0.01 vs. shNC; ##P<0.01 vs. shWnt6. sh, short hairpin; NC, negative control; EV, empty vector; p, plasmid; CON, control.

Overexpression of Wnt6 inhibits the apoptosis of colon cancer cell

Cell apoptosis was evaluated using Annexin V-FITC/PI staining and flow cytometry. As presented in Fig. 3A and B, the percentage of apoptotic cells was significantly increased in the shWnt6 group compared with that of the shNC group. However, shWnt6+pWnt6 group exhibited decreased apoptosis compared with that of shWnt6 group. Knockdown of Wnt6 increased apoptosis and transfection with pWnt6 reversed this effect in HCT116 and SW480 cells.

Figure 3.

Wnt6 decreases apoptosis in HCT116 and SW480 cells. The percentage of apoptotic cells in (A) HCT116 and (B) SW480 cells in CON, shNC, shWnt6, EV and shWnt6 groups was evaluated using flow cytometry. **P<0.01 vs. shNC; ##P<0.01 vs. shWnt6. sh, short hairpin; NC, negative control; EV, empty vector; p, plasmid; CON, control.

Overexpression of Wnt6 promotes colon cancer cell cycle

The effect of Wnt6 on cell cycle was evaluated using flow cytometry. As presented in Fig. 4A and B, cells transfected with shWnt6 exhibited a significant G0-G1 cell cycle arrest accompanied with a reduction of cell numbers in S-phase, which was reversed in response to transfection with pWnt6. These results suggest that knockdown of Wnt6 may induce cell cycle arrest in G0-G1 phase in colon cancer cell lines and transfection with pWnt6 reversed this effect.

Figure 4.

Inhibition of Wnt6 induces cell cycle arrest in G0-G1 phase. The cell cycle distribution in (A) HCT116 and (B) SW480 cells was evaluated using flow cytometry in CON, shNC, shWnt6, EV and shWnt6 groups. **P<0.01 vs. shNC; ##P<0.01 vs. shWnt6. sh, short hairpin; NC, negative control; EV, empty vector; p, plasmid; CON, control.

Overexpression of Wnt6 induces the migration of colon cancer cell

Cell migration was evaluated using Transwell assays. As presented in Fig. 5A and B, transfection with shWnt6 significantly suppressed the migration of cells compared with that of the shNC group, whereas shWnt6+pWnt6 group exhibited increased numbers of migrated cells. Knockdown of Wnt6 decreased the migratory ability of cells and transfection with pWnt6 reversed this effect in HCT116 and SW480 cells.

Figure 5.

Wnt6 promotes the migration of HCT116 and SW480 cells. The migration of (A) HCT116 and (B) SW480 cells was evaluated using Transwell assays in CON, shNC, shWnt6, EV and shWnt6 groups. **P<0.01 vs. shNC; ##P<0.01 vs. shWnt6. sh, short hairpin; NC, negative control; EV, empty vector; p, plasmid; CON, control.

Overexpression of Wnt6 effects on the expression of apoptosis-associated proteins

The expression of Bax, caspase-3 and MMP2 was assessed using western blot analysis. The results confirmed that shWnt6-transfected cells exhibited decreased expression levels of Wnt6 compared with that of the shNC group, whereas the shWnt6+pWnt6 group exhibited increased expression levels of Wnt6 compared with that of the shNC group (Fig. 6A and B). Additionally, the expression levels of caspase-3 and MMP2 were decreased, whereas the expression levels of Bax were increased in response to shWnt6 (Fig. 6). The expression of caspase-3 and MMP2 was increased, whereas the expression of Bax was decreased following overexpression of Wnt6 (achieved by pWnt6) (Fig. 6A and B).

Figure 6.

Wnt6 regulates the expression of Bax, caspase-3 and MMP2. The expression of Bax, caspase-3 and MMP2 in (A) HCT116 and (B) SW480 cells was evaluated using western blot analysis. **P<0.01 vs. shNC; ##P<0.01 vs. shWnt6. sh, short hairpin; NC, negative control; EV, empty vector; p, plasmid; CON, control; Bax, B-cell lymphoma 2-associated X protein; MMP, matrix metalloproteinase.

Discussion

The Wnt/β-catenin signaling pathway is triggered by a series of signaling cascade reactions, thus leading to transcription of target genes in the nucleus (10). The Wnt signaling pathway is involved in cell proliferation, apoptosis and epithelial-mesenchymal transition (EMT) (22). Additionally, previous studies demonstrated that aberrant Wnt signaling pathway promotes cell proliferation and tumorigenesis (23) in various types of cancer, including gastrointestinal (24), breast (25), kidney (26), pancreatic (27), prostate cancer (28), melanoma (29) and osteosarcoma (30). Wnt6 is a member of the Wnt protein family that has been reported to be involved various types of cancer (19,31). However, the function of Wnt6 in colon cancer remains unclear.

In the present study, the expression of Wnt6 was increased in HCT116 and SW480 cells compared with LoVo and HT29 cells. Therefore, HCT116 and SW480 cells were selected for subsequent experiments. The expression pattern of Wnt6 may differ in colon cell lines due to differences in histological differentiation, tumor staging and biological characteristics. Kirikoshi et al (15) reported that Wnt6 is strongly expressed in SW480 cells. Wnt proteins have been reported to promote various types of cancer. Wnt1 regulates the progression of breast cancer by promoting cell proliferation and migration (32). Overexpression of Wnt2 contributes to tumorigenesis of colorectal and lung cancer (33,34). Wnt10b expression serves an important function in the development of endometrial cancer (35). In the present study, it was demonstrated that inhibition of Wnt6 may inhibit cell proliferation, cell cycle process and migration, and promote cell apoptosis, and overexpression of Wnt6 reversed this effect, thus upregulation of Wnt6 may contribute to tumorigenesis and development of malignant colon tumor.

The results demonstrated that the expression of caspase-3 and MMP2 was increased, whereas the expression of Bax was decreased following overexpression of Wnt6. Caspase-3 has been demonstrated to be cleaved in apoptotic cells and the expression of caspase-3 precursor decreased (36). The results of the present study demonstrated that overexpression of Wnt6 increased the expression of caspase-3 precursor, indicating that Wnt6 may inhibit cell apoptosis. MMP2 is involved in the breakdown of extracellular matrix. MMP2 is associated with the development of various malignant tumors and may promote EMT, a key process involved in cancer metastasis (37). Wnt6 increased the expression of MMP2 indicating that Wnt6 may promote cell migration. Bax is an apoptosis-promoting member of the Bcl-2 family (38). The results of the present study demonstrated that overexpression of Wnt6 decreased the expression of Bax, indicating that Wnt6 may inhibit cell apoptosis. Wnt1, Wnt3 and Wnt8 have been reported to activate Wnt/β-catenin signaling pathway (39,40). However, whether Wnt6 may activate the Wnt signaling pathway in colon cancer requires further investigation.

The present study demonstrated that HCT116 and SW480 cells exhibit increased expression levels of Wnt6. Downregulation of Wnt6 by shWnt6 inhibited cell proliferation and migration and induced cell apoptosis of HCT16 and SW480 cells. Additionally, overexpression of Wnt6 may promote the proliferation, cell cycle and migration of HCT116 and SW480 cells, but inhibit cell apoptosis by upregulation of the expression of caspase-3 and MMP2, and downregulation of the expression of Bax. These results indicated that Wnt6 may serve a vital function in the progression of colon cancer and may be utilized as a potential therapeutic target.

Acknowledgements

Not applicable.

Funding

The present work was supported by the National High Technology Research and Development Program 863 (grant no. 20151127D2811).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

XZ was responsible for all the experiments and data analyses and editing of the manuscript; HY was responsible for the overall design of the study and responsible for providing the materials. All the authors approved the final submission.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Ahmed S, Johnson K, Ahmed O and Iqbal N: Advances in the management of colorectal cancer: From biology to treatment. Int J Colore Dis. 29:1031–1042. 2014. View Article : Google Scholar

2 

László L: Predictive and prognostic factors in the complex treatment of patients with colorectal cancer. Magy Onkol. 54:383–394. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Sung JJ, Lau JY, Goh KL and Leung WK: Asia Pacific Working Group on Colorectal Cancer: Increasing incidence of colorectal cancer in Asia: Implications for screening. Lancet Oncol. 6:871–876. 2005. View Article : Google Scholar : PubMed/NCBI

4 

Hu T, Li Z, Gao CY and Cho CH: Mechanisms of drug resistance in colon cancer and its therapeutic strategies. World J Gastroenterol. 22:6876–6889. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Shi W, Ye Z, Zhuang L, Li Y, Shuai W, Zuo Z, Mao X, Liu R, Wu J, Chen S and Huang W: Olfactomedin 1 negatively regulates NF-kB signalling and suppresses the growth and metastasis of colorectal cancer cells. J Pathol. 240:352–365. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Yan H, Hu K, Wu W, Li Y, Tian H, Chu Z, Koeffler HP and Yin D: Low expression of DYRK2 (Dual specificity tyrosine phosphorylation regulated kinase 2) correlates with poor prognosis in colorectal cancer. PLoS One. 11:e01599542016. View Article : Google Scholar : PubMed/NCBI

7 

Zhang Y, Lin C, Liao G, Liu S, Ding J, Tang F, Wang Z, Liang X, Li B, Wei Y, et al: MicroRNA-506 suppresses tumor proliferation and metastasis in colon cancer by directly targeting the oncogene EZH2. Oncotarget. 6:32586–32601. 2015.PubMed/NCBI

8 

Zhou FQ, Qi YM, Xu H, Wang QY, Gao XS and Guo HG: Expression of EpCAM and Wnt/β-catenin in human colon cancer. Genet Mol Res. 14:4485–4494. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Phipps AI, Shi Q, Newcomb PA, Nelson GD, Sargent DJ, Alberts SR and Limburg PJ: Associations between cigarette smoking status and colon cancer prognosis among participants in North central cancer treatment group phase III trial N0147. J Clin Oncol. 31:2016–2023. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Clevers H and Nusse R: Wnt/β-catenin signaling and disease. Cell. 149:1192–1205. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Luo J, Chen J, Deng ZL, Luo X, Song WX, Sharff KA, Tang N, Haydon RC, Luu HH and He TC: Wnt signaling and human diseases: What are the therapeutic implications? Lab Invest. 87:97–103. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Bienz M and Clevers H: Linking colorectal cancer to Wnt signaling. Cell. 103:311–320. 2000. View Article : Google Scholar : PubMed/NCBI

13 

Basu S, Haase G and Ben-Ze'ev A: Wnt signaling in cancer stem cells and colon cancer metastasis. F1000Res. 5:pii: F1000 Faculty Rev. –699. 2016. View Article : Google Scholar

14 

Kikuchi A: Canonical Wnt signaling pathway and cellular responses. Clin Calcium. 23:799–807. 2013.(In Japanese). PubMed/NCBI

15 

Kirikoshi H, Sekihara H and Katoh M: WNT10A and WNT6, clustered in human chromosome 2q35 region with head-to-tail manner, are strongly coexpressed in SW480 cells. Biochem Biophys Res Commun. 283:798–805. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Yuan G, Regel I, Lian F, Friedrich T, Hitkova I, Hofheinz RD, Ströbel P, Langer R, Keller G, Röcken C, et al: WNT6 is a novel target gene of caveolin-1 promoting chemoresistance to epirubicin in human gastric cancer cells. Oncogene. 32:375–387. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Katoh M: WNT and FGF gene clusters (review). Int J Oncol. 21:1269–1273. 2002.PubMed/NCBI

18 

Lavery DL, Davenport IR, Turnbull YD, Wheeler GN and Hoppler S: Wnt6 expression in epidermis and epithelial tissues during Xenopus organogenesis. Dev Dyn. 237:768–779. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Galbraith RL, Poole EM, Duggan D, Muehling J, Hsu L, Makar K, Xiao L, Potter JD and Ulrich CM: Polymorphisms in WNT6 and WNT10A and colorectal adenoma risk. Nutr Cancer. 63:558–564. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Na YJ, Jeon YJ, Suh JH, Kang JS, Yang KH and Kim HM: Suppression of IL-8 gene expression by radicicol is mediated through the inhibition of ERK1/2 and p38 signaling and negative regulation of NF-kappaB and AP-1. Int Immunopharmacol. 1:1877–1887. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Li X, Xu Y, Chen Y, Chen S, Jia X, Sun T, Liu Y, Li X, Xiang R and Li N: SOX2 promotes tumor metastasis by stimulating epithelial-to-mesenchymal transition via regulation of WNT/β-catenin signal network. Cancer Lett. 336:379–389. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Lustig B and Behrens J: The Wnt signaling pathway and its role in tumor development. J Cancer Res Clin Oncol. 129:199–221. 2003.PubMed/NCBI

24 

Kirikoshi H, Sekihara H and Katoh M: Up-regulation of WNT10A by tumor necrosis factor alpha and Helicobacter pylori in gastric cancer. Int J Oncol. 19:533–536. 2001.PubMed/NCBI

25 

Mukherjee N, Bhattacharya N, Alam N, Roy A, Roychoudhury S and Panda CK: Subtype-specific alterations of the Wnt signaling pathway in breast cancer: Clinical and prognostic significance. Cancer Sci. 103:210–220. 2012. View Article : Google Scholar : PubMed/NCBI

26 

Guillen-Ahlers H: Wnt signaling in renal cancer. Curr Drug Targets. 9:591–600. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Chen GAJ, Wang M, Farley S, Lee LY, Lee LC and Sawicki MP: Menin promotes the Wnt signaling pathway in pancreatic endocrine cells. Mol Cancer Res. 6:1894–1907. 2008.PubMed/NCBI

28 

Robinson DR, Zylstra CR and Williams BO: Wnt signaling and prostate cancer. Curr Drug Targets. 9:571–580. 2008. View Article : Google Scholar : PubMed/NCBI

29 

Larue L and Delmas V: The WNT/Beta-catenin pathway in melanoma. Front Biosci. 11:733–742. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Modder UI, Oursler MJ, Khosla S and Monroe DG: Wnt10b activates the Wnt, notch, and NFkB pathways in U2OS osteosarcoma cells. J Cell Biochem. 112:1392–1402. 2011. View Article : Google Scholar : PubMed/NCBI

31 

Yuan G, Regel I, Lian F, Friedrich T, Hitkova I, Hofheinz RD, Ströbel P, Langer R, Keller G, Röcken C, et al: WNT6 is a novel target gene of caveolin-1 promoting chemoresistance to epirubicin in human gastric cancer cells. Oncogene. 32:375–387. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Wieczorek M, Paczkowska A, Guzenda P, Majorek M, Bednarek AK and Lamparska-Przybysz M: Silencing of Wnt-1 by siRNA induces apoptosis of MCF-7 human breast cancer cells. Cancer Biol Ther. 7:268–274. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Jung YS, Jun S, Lee SH, Sharma A and Park JI: Wnt2 complements Wnt/β-catenin signaling in colorectal cancer. Oncotarget. 6:37257–37268. 2015. View Article : Google Scholar : PubMed/NCBI

34 

Huang C, Ma R, Xu Y, Li N, Li Z, Yue J, Li H, Guo Y and Qi D: Wnt2 promotes non-small cell lung cancer progression by activating WNT/β-catenin pathway. Am J Cancer Res. 5:1032–1046. 2015.PubMed/NCBI

35 

Chen H, Wang Y and Xue F: Expression and the clinical significance of Wnt10a and Wnt10b in endometrial cancer are associated with the Wnt/β-catenin pathway. Oncol Rep. 29:507–514. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Cao LH, Li HT, Lin WQ, Tan HY, Xie L, Zhong ZJ and Zhou JH: Morphine, a potential antagonist of cisplatin cytotoxicity, inhibits cisplatin-induced apoptosis and suppression of tumor growth in nasopharyngeal carcinoma xenografts. Sci Rep. 6:187062016. View Article : Google Scholar : PubMed/NCBI

37 

Gialeli C, Theocharis AD and Karamanos NK: Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting. FEBS J. 278:16–27. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Sugimoto C, Fujieda S, Seki M, Sunaga H, Fan GK, Tsuzuki H, Borner C, Saito H and Matsukawa S: Apoptosis-promoting gene (bax) transfer potentiates sensitivity of squamous cell carcinoma to cisplatin in vitro and in vivo. Int J Cancer. 82:860–867. 1999. View Article : Google Scholar : PubMed/NCBI

39 

Lee EH, Chari R, Lam A, Ng RT, Yee J, English J, Evans KG, Macaulay C, Lam S and Lam WL: Disruption of the Non-canonical WNT pathway in lung squamous cell carcinoma. Clin Med Oncol. 2:169–179. 2008.

40 

Ramel MC and Lekven AC: Repression of the vertebrate organizer by Wnt8 is mediated by Vent and Vox. Development. 131:3991–4000. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zheng XL and Yu HG: Wnt6 contributes tumorigenesis and development of colon cancer via its effects on cell proliferation, apoptosis, cell‑cycle and migration. Oncol Lett 16: 1163-1172, 2018.
APA
Zheng , X., & Yu, H. (2018). Wnt6 contributes tumorigenesis and development of colon cancer via its effects on cell proliferation, apoptosis, cell‑cycle and migration. Oncology Letters, 16, 1163-1172. https://doi.org/10.3892/ol.2018.8729
MLA
Zheng , X., Yu, H."Wnt6 contributes tumorigenesis and development of colon cancer via its effects on cell proliferation, apoptosis, cell‑cycle and migration". Oncology Letters 16.1 (2018): 1163-1172.
Chicago
Zheng , X., Yu, H."Wnt6 contributes tumorigenesis and development of colon cancer via its effects on cell proliferation, apoptosis, cell‑cycle and migration". Oncology Letters 16, no. 1 (2018): 1163-1172. https://doi.org/10.3892/ol.2018.8729
Copy and paste a formatted citation
x
Spandidos Publications style
Zheng XL and Yu HG: Wnt6 contributes tumorigenesis and development of colon cancer via its effects on cell proliferation, apoptosis, cell‑cycle and migration. Oncol Lett 16: 1163-1172, 2018.
APA
Zheng , X., & Yu, H. (2018). Wnt6 contributes tumorigenesis and development of colon cancer via its effects on cell proliferation, apoptosis, cell‑cycle and migration. Oncology Letters, 16, 1163-1172. https://doi.org/10.3892/ol.2018.8729
MLA
Zheng , X., Yu, H."Wnt6 contributes tumorigenesis and development of colon cancer via its effects on cell proliferation, apoptosis, cell‑cycle and migration". Oncology Letters 16.1 (2018): 1163-1172.
Chicago
Zheng , X., Yu, H."Wnt6 contributes tumorigenesis and development of colon cancer via its effects on cell proliferation, apoptosis, cell‑cycle and migration". Oncology Letters 16, no. 1 (2018): 1163-1172. https://doi.org/10.3892/ol.2018.8729
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team