International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Hepatocellular carcinoma (HCC), the most common form of liver cancer, is one of the most frequently diagnosed malignant neoplasms worldwide (1,2). In recent decades, HCC has received a significant amount of attention due to the rapid rise in HCC-associated mortality (1,3). Despite advances in diagnostic techniques and therapeutic strategies over the last decade, the prognosis of patients with HCC has remained poor (4,5). The majority of HCC patients are diagnosed in the first instance with advanced-stage HCC; therefore, the estimated 5-year overall survival rate is <20% (6). Previous studies have shown that the prognosis of HCC is associated with several factors, including the heterogeneity of HCC (7), diagnostic challenges (8), limited radiation therapy, and the development of resistance to HCC. Thus, additional research into the molecular mechanisms driving the malignant transformation of hepatocytes is urgently needed.
Aldehyde ketone reductase (AKR) family member B10 (AKR1B10) belongs to the AKR1B subgroup (9). AKR1B10 is a cytosolic NADPH-dependent reductase, catabolizing various endogenous compounds by catalyzing the corresponding redox reactions (2). According to recent studies, expression of this enzyme is upregulated in several types of cancer, including adrenocortical (10), breast (11), colon (12), and hepatocellular carcinoma (13,14). AKR1B10 has significant potential as a relevant biomarker and therapeutic target for predicting tumor progression. Based on a large-scale proteome quantification analysis, HCC tissues showed dysregulated AKR1B10 expression compared with normal liver (15,16). However, the specific function of AKR1B10 in HCC pathology and its molecular mechanisms remain to be determined.
The present study examined the diagnostic performance of AKR1B10 in HCC tumor tissues. Furthermore, the role and mechanism of AKR1B10 in the proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) of HCC cells was examined.
The genomics data of GSE146719/GPL20795 was downloaded from the Gene Expression Omnibus (GEO) database and analyzed using the DESeq2 package (version 1.39.8; http://www.ncbi.nlm.nih.gov/geo/). Normalized RNA-seq data (HTSeq-FPKM) and survival data of the Pan-Cancer Atlas (PANCAN) and the liver hepatocellular carcinoma (LIHC) project of The Cancer Genome Atlas (TCGA) were accessed from the GDC website (https://portal.gdc.cancer.gov/) on March 1, 2023, and the data set is referred to as GDC-TCGA-LIHC in this article. Normalized gene expression (normalized_read_count) and donor information of the liver cancer project (named: LIRI-JP) of the International Cancer Genome Consortium (ICGC) were downloaded from the ICGC data portal (https://dcc.icgc.org/), and the data set is referred to in this article as ICGC-LIRI. Immunohistochemical images of AKR1B10 in tumor samples were analyzed and accessed from The Human Protein Atlas database website (https://www.proteinatlas.org/). The gene effect and expression of HCC cell lines were analyzed and downloaded from the Broad Institute DepMap website (https://depmap.org/).
Normalized quantification of gene expression in GDC-TCGA-LIHC was converted into transcripts per million (TPM) and then logarithmically transformed [log2(TPM+1)]. In ICGC-LIRI, the expression values were directly log2 (normalized_read_count) transformed since they were all >0 (17). No normal samples were included in the prognosis analysis in GDC-TCGA-LIHC and ICGC-LIRI. Missing values were considered in the GDC-TCGA dataset if the clinical information of patients was unavailable or unknown.
Human HCC cell lines Huh7 and Hep3B were obtained from the Cell Bank of the Chinese Academy of Sciences and cultured in DMEM (Thermo Fisher Scientific, Inc.), supplemented with 10% FBS (Thermo Fisher Scientific, Inc.), and 1% penicillin/streptomycin (HyClone, Cytiva; cat. no. SV30010) at 37°C with 5% CO2. HCC cells were authenticated via short tandem repeat analysis. Mycoplasma-free cells were used in all experiments.
Cells were seeded into six-well plates (3–5×105 cells/well). Sh/oe-AKR1B10 in HCC cells was performed using the lentivirus (DNA:16 µg/100 ml; Shanghai GenePharma Co., Ltd.), when the cell confluency reached 60–70%. The cells were treated with 100 µl/ml (1×109 TU/ml) lentivirus for 8 h. Stably transduced cell lines were selected with 4 µg/ml puromycin (YEASEN, China). Full-length AKR1B10 sequences were ligated into the lentivirus vectors pCMV-3×HA. The shRNA sequences (5′-3′) were as follows: shAKR1B10, CGCTCCTACTGACTCCTATTT, and Scramble, CCTAAGGTTAAGTCGCCCTCG. The reagents and antibodies used are given in Table I.
HCC cell proliferation was assessed using CCK-8 assays (Beyotime Institute of Biotechnology). Briefly, 3–5×103 stable cells transfected with sh/oeAKR1B10 or corresponding scramble oligos were plated into 96-well plates and incubated for 4 days.
The cells were seeded in 12-well plates (1×104 cells/well) for 2 weeks to determine colony formation. The methanol-fixed colonies were then stained with crystal violet solution at room temperature.
Transfected Huh7 cells were seeded into six-well plates (1×105 cells/well). With a 10 µl pipette tip, wounds were made when the cell confluency reached 80–90%, and the cells were cultured in serum-free DMEM at 37°C. The wounds were observed under an inverted light microscope (×100). ImageJ v1.8.0 (National Institutes of Health) was used to evaluate the cell migration rate as follows: Wound closure surface area/wound total surface area ×100%.
Using RIPA buffer and PMSF (Beyotime Institute of Biotechnology) with phosphatase inhibitor (Beijing Solarbio Science & Technology Co., Ltd.), total cell proteins were extracted and analyzed by western blotting. Briefly, proteins (40 µg) were loaded onto 10% SDS-PAGE for electrophoresis and transferred to polyvinylidene difluoride membranes (MilliporeSigma). Membranes were blocked with 5% BSA at room temperature for 1 h and then incubated with primary antibodies overnight at 4°C and then secondary antibodies at 37°C for 1 h, according to the manufacturer's recommendations. Finally, the protein levels were confirmed using enhanced chemiluminescence (Tanon 4800; Tanon Science and Technology Co., Ltd.) and normalized with an anti-GAPDH antibody. The images were analyzed using ImageJ (version 1.8.0.345, National Institutes of Health).
Typically, 1×105 transfected Huh7/Hep3B cells in serum-free media were seeded into the upper chambers with (invasion) or without (migration) Matrigel coating (diluted in DMEM; Corning, Inc.), and the bottom chambers were filled with 600 µl supplemented DMEM medium. After 36 h, the cells that had migrated and invaded through to the bottom of the inserts were fixed with methanol and stained with crystal violet for 30 min at room temperature, respectively. In five random fields of view, the numbers of cells that had migrated/invaded were viewed under an inverted light microscope (magnification, ×200) and imaged and quantified.
For cell cycle analysis, cells were fixed with 70% ethanol (4°C, >30 min), washed with PBS (5 min, 3 times), and then stained with RNase/PI staining solution (room temperature, 30 min). Flow cytometry (Beckman Coulter, Inc.) was used to measure the DNA content (>10,000 cells per sample), and ModFIT LT v3.1 software (Verity Software House, Inc.) was used for analysis.
GraphPad Prism version 8.0 (GraphPad Software, Inc.) was used for statistical analysis. ImageJ was used for densitometry analysis. Comparisons between groups were assessed using a Student's t-test or an ANOVA followed by a post-hoc Tukey's test for multi-group comparison. P<0.05 was considered to indicate a statistically significant difference.
To evaluate the biological implications of the differential expression of genes in HCC vs. normal liver tissues, expression analysis in the GSE146719 dataset was performed. Moreover, 1,109 genes with q-value (p.adj) <0.05 were selected for subsequent processing (Fig. 1A). Deep analysis of these genes was performed using a volcano plot and mean differential plot maps (Fig. 1B). The top 10 genes from the above-analyzed data were selected for repeated analysis. Subsequently, the AKR1B10 was screened out. AKR1B10 status in HCC by exploring its expression in this disease. Higher AKR1B10 expression in pan-cancerous tissues suggested that this oncogene may be upregulated during the development of HCC. As shown in Fig. 1E and F, AKR1B10 expression in HCC tissues was significantly higher than in normal liver tissues. Combined with the public IHC datasets from The Human Protein Atlas database, the expression and localization of AKR1B10 were detected. AKR1B10 was primarily expressed in the cytoplasm (Fig. 1G), consistent with its function as an enzyme catalyzing redox reactions. HCC patients were divided into two groups based on the median value of AKR1B10 expression in GDC-TCGA-PANCAN and GDC-TCGA-LIHC datasets, and patients labeled as low-AKR1B10 had significantly longer survival than the remaining high-AKR1B10 (Fig. 1H and I; P<0.0001 and P=0.0021, respectively). Similarly, patients classified with the low-AKR1B10 group had a significantly better prognosis in the ICGC-LIRI dataset (Fig. 1J; P=0.0071). Thus, high expression of AKR1B10 in HCC patients was associated with poorer outcomes, and AKR1B10 was shown to be a useful biomarker for the disease (13,16).
Due to the differential expression of AKR1B10 and its prognostic value in HCC, its potential functions in this disease were examined. Using the DepMap dataset, a gene effect CRISPR (DepMap Public 22Q4 + Score, Chronos) analysis of this gene was performed. The results showed a significant gene effect of AKR1B10 in most HCC cell lines (Fig. 2A), especially in Huh 7 cell line (Fig. 2B). Next, the expression of AKR1B10 in HCC cell lines was analyzed using the DepMap dataset. The results showed that AKR1B10 was expressed at differentially high levels in all HCC cell lines, including Huh7 (Fig. 2C and D). The above results indicated that AKR1B10 was highly expressed in HCC tissues and showed a significant gene effect in HCC and Huh7 cells, and thus these cells were selected as an ideal HCC cell line for further experimental validation.
After transfection of sh-AKR1B10 into Huh7 cells, AKR1B10 expression was significantly decreased (Fig. 3A). AKR1B10 knockdown significantly reduced Huh7 cell viability and proliferation in CCK-8 and colony formation assays (Fig. 3B and C). Further studies illustrated that AKR1B10 promoted the migration and invasion of Huh7 cells in wound healing and Transwell assays (Fig. 3D-F). In addition, the above effects of AKR1B10 overexpression on Hep3B, a relatively low-expressing AKR1B10 HCC cell line, were assessed. The results showed that cellular activity was significantly promoted in Hep3B cells (Fig. 3G-I). The above results suggested that AKR1B10 played a prominent role in the proliferation, migration, and invasion of HCC.
Since AKR1B10 was upregulated in HCC tissues and exhibited a notable influence on HCC cell behavior; therefore, its potential mechanisms in promoting this disease were assessed. Next, the association between AKR1B10 expression and the cell proliferation-related gene CCND1 (18,19) and EMT-related hub genes in GDC-TCGA tumor samples. The EMT-related hub genes were selected as E-cadherin, N-cadherin, Vimentin, and TWIST1. The results showed that all of the above genes were significantly associated with the expression of AKR1B10 (P<0.0001; Fig. 4A-E). Next, another dataset, DepMap, was selected for a similar correlation analysis. The expression of E-cadherin (P=0.0217), N-cadherin (P=0.0245), and Vimentin (P=0.0073) genes in DepMap showed varying degrees of significant correlations with AKR1B10, apart from TWIST1 (P=0.7343; P-value cut-off=0.05; Fig. 4F-J).
To further validate the above functions of AKR1B10, we measured the effects of AKR1B10 on the gene expression of CCND1 and EMT-related genes in HCC cells. AKR1B10 knockdown suppressed CCND1 expression and abrogated the cell cycle distribution in HCC cells (Fig. 5A and B). In addition, the expression of E-cadherin was increased, and other EMT biomarkers, including N-cadherin, Vimentin, and TWIST-1, were downregulated after AKR1B10 knockdown (Fig. 5C). Based on these results, it is possible that AKR1B10 plays a significant role in the proliferation and EMT of HCC, affecting its proliferation, migration, and invasion.
As reported recently, AKR1B10 promotes tumor cell proliferation and migration through PI3K/AKT signaling (11). Furthermore, the degree of phosphorylation of proteins involved in the PI3K/AKT pathway was assessed, and it was found that phosphorylation was significantly reduced by AKR1B10 knockdown (Fig. 5D). Meanwhile, although cells transfected with AKR1B10 were subsequently treated with GDC-0941 (100 nM; PI3K/AKT pathway antagonist; MedChemExpress) for 24 h, western blotting showed that the protein content of AKR1B10 failed to be significantly altered (Fig. 5E). Based on these experiments, it was suggested that the PI3K/AKT signaling was involved in the pathological progression of HCC.
HCC is one of the most common cancers in the world and the third leading cause of cancer-associated death (20). Due to delayed diagnosis and frequent cancer metastasis, the majority of HCC patients are diagnosed with advanced-stage cancer at the initial diagnosis (21). With the recent developments in biological therapies, the clinical treatment of HCC has seen progress; however, the survival benefits of these drug treatments for HCC patients still have several limitations. In particular, with immune checkpoint inhibitors as monotherapy for HCC patients, the outcomes to date have been disappointing (22). Furthermore, HCC is a heterogeneous disease with limited chemoradiotherapy treatment (7). The 5-year survival rate for patients with early-stage HCC has been reported to exceed 50% (2). Despite this, HCC has a poor 5-year overall survival rate (6). The limited value of existing biomarkers for diagnosing and treating HCC requires urgent identification of better biomarkers. Therefore, there is a crucial need to understand the molecular mechanisms underlying HCC development to identify better biomarkers and develop novel therapeutics.
As a member of the AKR1B family (9), the role of AKR1B10 in lung cancer (23,24), Renal Cell Carcinoma (25), ovarian cancer (26) and bladder cancer (27) carcinogenesis has been studied extensively. AKR1B10 is a cytosolic NADPH-dependent reductase, catabolizing various endogenous compounds by catalyzing the corresponding redox reactions (2). Research has shown that AKR1B10 contributes to cancer progression (11). Recent studies found that the overexpression of the enzyme in several types of cancer, including adrenocortical (10), breast (11), colon (12), and HCC (13,14). Subsequently, this study investigated its role in HCC. Through a comprehensive analysis of data from GDC-TCGA-PANCAN, GDC-TCGA-LIHC, and ICGC-LIRI databases, it was found that AKR1B10 expression was significantly upregulated pan-cancer and in HCC, and high expression was associated with shorter survival times (Fig. 2D-J), and confirmed that AKR1B10 was a potential biomarker for prognostic prediction of HCC. Studies have shown that cancer cells proliferate and migrate when AKR1B10 is knocked down (28,29). Additionally, studies have shown that AKR1B10 expression is elevated in breast cancer and adrenocortical carcinoma tissues, where it is involved in proliferation, migration, and invasion (10,11). It should be noted that AKR1B10 may exhibit differing functions in different types of cells. Using the DepMap dataset, the gene effect CRISPR analysis, and the expression analysis of AKR1B10 in HCC cell lines, it was found that Huh7 cells were a potential excellent candidate for HCC cells. It was found in the present study that by knocking down AKR1B10 expression, Huh7 cells were less likely to proliferate, migrate, invade, and undergo EMT.
Different cellular processes rely on PI3K/AKT signaling, including cell proliferation, apoptosis, and migration (30,31). The PI3K/AKT pathway is reported to be regulated in the sustained activation of EMT in several types of cancer (32,33). PI3K/AKT-mediated EMT has been shown to promote HCC progression (34). Recently, there have been reports that AKR1B10 affects the activity of the PI3K pathway by regulating the substrate synthesis of PI3K in cancer cells (35,36). Previous studies demonstrated that AKR1B10-overexpressing breast cancer cells activated PI3K/AKT (11), thus, the association between AKR1B10 and PI3K/AKT signaling was assessed. Studies have reported various ways by which AKR1B10 promotes HCC proliferation, migration, and invasion (21,37). Additionally, AKRB10 may play a significant role in metabolic adaptation (2). While AKRB10 has been studied in HCC, the results were inconsistent. For example, AKR1B10 may play different roles depending on the HCC stage (9). Together, AKR1B10 may influence the progression of HCC through multiple signaling pathways associated with cell proliferation and migration. Finally, in the present study, it was found that AKR1B10 promoted HCC progression in vitro by upregulating the activity of the PI3K/AKT signaling pathway. Nevertheless, future studies are required using in vivo tumor models to verify the validity of the findings of the clinical tissue samples.
In conclusion, the results of the present study showed that AKR1B10 activated the PI3K/AKT pathway in Huh7 cells, and this resulted in increased proliferation, invasion, migration, and EMT.
Not applicable.
Funding: No funding was received.
All data generated or analyzed during this study are included in this published article.
KT, ZL and HZ performed the experiments. YD collected the samples. ZL and HZ analyzed the data. HY conceived the study experiments and wrote the manuscript. KT and HY confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
|
Ladd AD, Duarte S, Sahin I and Zarrinpar A: Mechanisms of drug resistance in HCC. Hepatology. Jan 3–2023.(Epub ahead of print). View Article : Google Scholar : PubMed/NCBI | |
|
Wang Z, Pei Y, Li W, Zhang J and Liu J: Clinical value of AKR1B10 in hepatocellular carcinoma: A systematic review and meta-analysis. PLoS One. 17:e02795912022. View Article : Google Scholar : PubMed/NCBI | |
|
Siegel RL, Miller KD, Wagle NS and Jemal A: Cancer statistics, 2023. CA Cancer J Clin. 73:17–48. 2023. View Article : Google Scholar : PubMed/NCBI | |
|
Yu M, Chen Z, Zhou Q, Zhang B, Huang J, Jin L, Zhou B, Liu S, Yan J, Li X, et al: PARG inhibition limits HCC progression and potentiates the efficacy of immune checkpoint therapy. J Hepatol. 77:140–151. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Erstad DJ and Tanabe KK: Hepatocellular carcinoma: Early-stage management challenges. J Hepatocell Carcinoma. 4:81–92. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Yang MY, Hung TW, Wang CJ and Tseng TH: Inhibitory Effect of Nelumbo nucifera Leaf extract on 2-acetylaminofluorene-induced hepatocarcinogenesis through enhancing antioxidative potential and alleviating inflammation in rats. Antioxidants (Basel). 8:3292019. View Article : Google Scholar : PubMed/NCBI | |
|
Huang H, Tsui YM and Ng IO: Fueling HCC dynamics: Interplay between tumor microenvironment and tumor initiating cells. Cell Mol Gastroenterol Hepatol. 15:1105–1116. 2023. View Article : Google Scholar : PubMed/NCBI | |
|
Cicinnati VR, Sotiropoulos GC and Beckebaum S: Established and emerging therapies for hepatocellular carcinoma. Minerva Med. 101:405–418. 2010.PubMed/NCBI | |
|
DiStefano JK and Davis B: Diagnostic and prognostic potential of AKR1B10 in human hepatocellular carcinoma. Cancers (Basel). 11:4862019. View Article : Google Scholar : PubMed/NCBI | |
|
Chen D, Huang R, Ren F, Wang H, Wang C and Zhang Y: FNDC5 and AKR1B10 inhibit the proliferation and metastasis of adrenocortical carcinoma cells by regulating AMPK/mTOR pathway. Exp Ther Med. 25:1362023. View Article : Google Scholar : PubMed/NCBI | |
|
Qu J, Li J, Zhang Y, He R, Liu X, Gong K, Duan L, Luo W, Hu Z, Wang G, et al: AKR1B10 promotes breast cancer cell proliferation and migration via the PI3K/AKT/NF-κB signaling pathway. Cell Biosci. 11:1632021. View Article : Google Scholar : PubMed/NCBI | |
|
Liu C, Shi L, Li W, Huang Z, Wang S, Xu P, Li T, Li Z, Luo F, Li W, et al: AKR1B10 accelerates the production of proinflammatory cytokines via the NF-κB signaling pathway in colon cancer. J Mol Histol. 53:781–791. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Ye X, Li C, Zu X, Lin M, Liu Q, Liu J, Xu G, Chen Z, Xu Y, Liu L, et al: A large-scale multicenter study validates aldo-keto reductase family 1 member B10 as a prevalent serum marker for detection of hepatocellular carcinoma. Hepatology. 69:2489–2501. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Xie C, Ye X, Zeng L, Zeng X and Cao D: Serum AKR1B10 as an indicator of unfavorable survival of hepatocellular carcinoma. J Gastroenterol. 58:1030–1042. 2023. View Article : Google Scholar : PubMed/NCBI | |
|
Xu B, Wang F, Song C, Sun Z, Cheng K, Tan Y, Wang H and Zou H: Large-scale proteome quantification of hepatocellular carcinoma tissues by a three-dimensional liquid chromatography strategy integrated with sample preparation. J Proteome Res. 13:3645–3654. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Kim SY, Shen Q, Son K, Kim HS, Yang HD, Na MJ, Shin E, Yu S, Kang K, You JS, et al: SMARCA4 oncogenic potential via IRAK1 enhancer to activate Gankyrin and AKR1B10 in liver cancer. Oncogene. 40:4652–4662. 2021. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang J, Zhang X, Li J and Song Z: Systematic analysis of the ABC transporter family in hepatocellular carcinoma reveals the importance of ABCB6 in regulating ferroptosis. Life Sci. 257:1181312020. View Article : Google Scholar : PubMed/NCBI | |
|
Yang Z, Xu T, Xie T, Yang L, Wang G, Gao Y, Xi G and Zhang X: CDC42EP3 promotes glioma progression via regulation of CCND1. Cell Death Dis. 13:2902022. View Article : Google Scholar : PubMed/NCBI | |
|
Leontieva OV, Demidenko ZN and Blagosklonny MV: MEK drives cyclin D1 hyperelevation during geroconversion. Cell Death Differ. 20:1241–1249. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Siegel RL, Miller KD, Fuchs HE and Jemal A: Cancer statistics, 2021. CA Cancer J Clin. 71:7–33. 2021. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang T, Guan G, Zhang J, Zheng H, Li D, Wang W, Lu F and Chen X: E2F1-mediated AUF1 upregulation promotes HCC development and enhances drug resistance via stabilization of AKR1B10. Cancer Sci. 113:1154–1167. 2022. View Article : Google Scholar : PubMed/NCBI | |
|
Romero D: Combination set to transform HCC therapy. Nat Rev Clin Oncol. 17:3892020. View Article : Google Scholar : PubMed/NCBI | |
|
Kim B, Lee HJ, Choi HY, Shin Y, Nam S, Seo G, Son DS, Jo J, Kim J, Lee J, et al: Clinical validity of the lung cancer biomarkers identified by bioinformatics analysis of public expression data. Oncotarget. 67:7431–7438. 2007. | |
|
Zhu D, Nie Y, Zhao Y, Chen X, Yang Z and Yang Y: RNF152 suppresses fatty acid oxidation and metastasis of lung adenocarcinoma by inhibiting IRAK1-Mediated AKR1B10 expression. Am J Pathol. 193:1603–1617. 2023. View Article : Google Scholar : PubMed/NCBI | |
|
Zheng L, Zhang X, Pan X, Huang Z, Zhang M, Xian J, Wei Y, Nie L, Zhang M, Gong J, et al: AKR1B10 is a new sensitive and specific marker for fumarate hydratase-deficient renal cell carcinoma. Mod Pathol. 36:1003032023. View Article : Google Scholar : PubMed/NCBI | |
|
Hojnik M, Šuster NK, Smrkolj Š, Sisinger D, Grazio SF, Verdenik I and Rižner TL: AKR1B1 as a prognostic biomarker of high-grade serous ovarian cancer. Cancers (Basel). 14:8092022. View Article : Google Scholar : PubMed/NCBI | |
|
Huang Z, Yan Y, Zhu Z, Liu J, He X, Dalangood S, Li M, Tan M, Cai J, Tang P, et al: CBX7 suppresses urinary bladder cancer progression via modulating AKR1B10-ERK signaling. Cell Death Dis. 12:5372021. View Article : Google Scholar : PubMed/NCBI | |
|
Shao X, Wu J, Yu S, Zhou Y and Zhou C: AKR1B10 inhibits the proliferation and migration of gastric cancer via regulating epithelial-mesenchymal transition. Aging (Albany NY). 13:22298–22314. 2021. View Article : Google Scholar : PubMed/NCBI | |
|
Yao Y, Wang X, Zhou D, Li H, Qian H, Zhang J, Jiang L, Wang B, Lin Q and Zhu X: Loss of AKR1B10 promotes colorectal cancer cells proliferation and migration via regulating FGF1-dependent pathway. Aging (Albany NY). 12:13059–13075. 2020. View Article : Google Scholar : PubMed/NCBI | |
|
He Y, Sun MM, Zhang GG, Yang J, Chen KS, Xu WW and Li B: Targeting PI3K/Akt signal transduction for cancer therapy. Signal Transduct Target Ther. 6:4252021. View Article : Google Scholar : PubMed/NCBI | |
|
Yang J, Nie J, Ma X, Wei Y, Peng Y and Wei X: Targeting PI3K in cancer: Mechanisms and advances in clinical trials. Mol Cancer. 18:262019. View Article : Google Scholar : PubMed/NCBI | |
|
Wang C, Yang Z, Xu E, Shen X, Wang X, Li Z, Yu H, Chen K, Hu Q, Xia X, et al: Apolipoprotein C-II induces EMT to promote gastric cancer peritoneal metastasis via PI3K/AKT/mTOR pathway. Clin Transl Med. 11:e5222021. View Article : Google Scholar : PubMed/NCBI | |
|
Wang Y, Li Y, Wang L, Chen B, Zhu M, Ma C, Mu C, Tao A, Li S, Luo L, et al: Cinnamaldehyde suppressed EGF-Induced EMT process and inhibits ovarian cancer progression through PI3K/AKT pathway. Front Pharmacol. 13:7796082022. View Article : Google Scholar : PubMed/NCBI | |
|
Dian MJ, Li J, Zhang XL, Li ZJ, Zhou Y, Zhou W, Zhong QL, Pang WQ, Lin XL, Liu T, et al: MST4 negatively regulates the EMT, invasion and metastasis of HCC cells by inactivating PI3K/AKT/Snail1 axis. J Cancer. 12:4463–4477. 2021. View Article : Google Scholar : PubMed/NCBI | |
|
Huang C, Cao Z, Ma J, Shen Y, Bu Y, Khoshaba R, Shi G, Huang D, Liao DF, Ji H, et al: AKR1B10 activates diacylglycerol (DAG) second messenger in breast cancer cells. Mol Carcinog. 57:1300–1310. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Manning BD and Toker A: AKT/PKB signaling: Navigating the network. Cell. 169:381–405. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Wu T, Ke Y, Tang H, Liao C, Li J and Wang L: Fidarestat induces glycolysis of NK cells through decreasing AKR1B10 expression to inhibit hepatocellular carcinoma. Mol Ther Oncolytics. 23:420–431. 2021. View Article : Google Scholar : PubMed/NCBI |