Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
February 2012 Volume 3 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February 2012 Volume 3 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Oncolytic plasmid: A novel strategy for tumor immuno-gene therapy

  • Authors:
    • Chieko Yoshihara
    • Katsuyuki Hamada
    • Minako Kuroda
    • Yoshiyuki Koyama
  • View Affiliations / Copyright

    Affiliations: Department of Textile Science, Otsuma Women's University, Tokyo 102-8357, Japan, Department of Obstetrics and Gynecology, School of Medicine, Ehime University, Ehime 791-0295, Japan
  • Pages: 387-390
    |
    Published online on: October 31, 2011
       https://doi.org/10.3892/ol.2011.467
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The oncolytic virus is expected to proliferate in and destroy tumor cells. The virus is also thought to generate antitumor immunity. Virally infected tumor cells express viral antigens on their surfaces. Such tumor cells or their fragments would be taken up by antigen-presenting cells (APCs) together with tumor-associated antigens (TAAs), and facilitated cross‑priming of tumor-specific T cells. Virus-specific protein presented on the infected cells therefore played a crucial role in the enhancement of the adaptive antitumor immunity. In this study, a plasmid encoding adenovirus protein, the adenovirus death protein (ADP), was constructed, and a very fine complex of the plasmid with polyethylenimine (PEI) and chondroitin sulfate (CS) was injected into tumor-bearing mice. Transfection of the ADP gene was shown to suppress tumor growth as effectively as granulocyte-macrophage colony-stimulating factor (GM-CSF) transfection. When mice were administered plasmid coding ADP (pDNA‑ADP) to generate an immune response to ADP prior to therapy, transfection of the ADP gene induced a much higher level of tumor growth suppression than that found in the non-immunized mice. An evident synergistic effect of ADP and GM-CSF genes was also observed, and at a pDNA-ADP/pDNA-GM-CSF ratio of 4:1, significant suppression of tumor growth was achieved even in the non-immunized mice.

Introduction

Since oncolytic activity attributed to replicating viruses was previously reported by De Pace (1), a number of clinical trials were conducted using viruses to treat tumors. In the 1950s, virotherapy of cancer was started with the naturally occurring oncolytic virus, a virus capable of replicating specifically in tumor cells and causing specific lysis of cancer cells but not normal cells. Advancements in virotherapy were made following the development of the genetically engineered, replication-selective oncolytic virus in 1991 (2). Such oncolytic viruses are expected to proliferate in and destroy tumor cells.

However, preclinical and clinical data suggest that in some cases virotherapy may in fact act as cancer immunotherapy. Tumor-bearing mice injected with an oncolytic virus exhibited an antitumor immune response, and local injection of the oncolytic virus often caused regression of remote as well as peripheral tumors. It should be mediated by the systemic antitumor immune response. Tumor-specific cytotoxic T lymphocytes (CTL) activity against tumor cells persisted for a long period of time, and protection against tumor rechallenge was observed (3).

Viruses are thought to generate antitumor immunity. Virally infected tumor cells would express viral antigens on their surfaces, and effectively stimulate antigen-presenting cells (APCs) to cross-prime tumor-specific T cells (4). Virus-specific proteins presented on the infected tumor cells or their fragments thus appeared to play a crucial role in the enhancement of the adaptive antitumor immunity.

We thought that adaptive antitumor immunity might be induced not only by virus infection, but also by transfection of the gene encoding viral protein into the tumor cells. Extra viral genes would produce a viral antigen in the tumor cells, and cause the stimulation of APCs as well as viral-infected cells.

The question arises as to which of the virus proteins would be most effective in inducing antitumor immunity. Oncolytic adenoviruses have usually been engineered by deletion of E1 genes that are necessary for a virus to replicate in normal cells. E3 genes were often deleted to provide more space for therapeutic gene insertion. However, E3-positive (E3+) viruses were reported to kill tumor cells 1.6–20 times more effectively in different cell lines (5). Among the E3 proteins, the adenovirus death protein (ADP) has unique properties. ADP is an adenovirus nuclear membrane glycoprotein (6), and, unlike other E3 genes, ADP is expressed at late stages of infection. Whereas almost all other E3 genes have immunomodulatory functions, ADP is responsible for the efficient lysis and release of the progeny virus from the infected cell (7–9). Adenovirus, which overexpresses ADP, was also prepared by deleting the E3 region and reinserting the ADP gene, and was found to spread more rapidly and effectively through tumors, showing highly improved tumor growth regression (10).

In this study, plasmid DNA encoding ADP gene was constructed, and an extremely fine complex of the plasmid with polyethylenimine (PEI) and chondroitin sulfate (CS) was prepared by a previously reported method (11). The complex was injected into tumor-bearing mice, and the tumor growth inhibition effect was examined.

Materials and methods

Materials and animals

CS from shark cartilage was supplied by Seikagaku Corporation (Tokyo, Japan). Linear PEI ‘MAX’ (MW 40,000) was purchased from Polyscience, Inc. (Warrington, PA, USA).

Plasmid coding adenovirus ADP (pDNA-ADP) was constructed with the product of PCR conducted with ADP-S ATGACCAACACAACCAACGC and ADP-AS-1 ACTCGAGGAATCATGTCTCA as primers, the genome of adenovirus type 5 (Microbix Biosystems, Ontario, Canada) as a template, and Takara Ex Taq (Takara, Japan) as the enzyme. pDNA-ADP was first subcloned into pTAC-1, and its sequence was analyzed by ABI Sequencing Analysis. Finally, pDNA-ADP was inserted into pcDNA3.1(-) (Invitrogen, USA) with EcoRI and BamHI, and the sequence was confirmed again by ABI Sequencing Analysis. Plasmid coding mouse granulocyte macrophage-colony stimulating factor (pDNA-GM-CSF) was similarly produced with pcDNA3.1 vector as previously reported (11). The plasmids were amplified, and purified by Mitsuwa Frontech Corp., Japan.

Cytotoxic activity of the ADP plasmid complex
Preparation of DNA complex

CS solution (267 μg in 600 μl) and PEI solution (132 μg in 300 μl), respectively, were added in this order to a solution of plasmid DNA coding ADP or luciferase (45 μg in 300 μl). The solutions were previously prepared in 7 mM phosphate buffer (PB). After 30 min, the mixture was diluted by condensed PBS to afford an isotonic solution containing a given amount of the plasmid complex.

Evaluation of the cytotoxicity

B16 cells, a mouse melanoma cell line, were seeded onto 96-well plates at 7.5×104 cells per well, and cultured for 2 days in Gibco minimum essential medium (MEM) supplemented with 10% fetal bovine serum (FBS), penicillin G sodium (100 U/ml), and streptomycin sulfate (0.1 mg/ml). The primary growth medium was then replaced with 100 μl of fresh MEM with FBS and antibiotics. Fresh or lyophilized-and-rehydrated plasmid DNA complex suspensions prepared above were added to the cells (100 μl/well), and incubated for 4 h at 37°C. Fresh medium was added to the wells (100 μl/well), and after an additional incubation at 37°C (20 or 68 h), cell viability was measured by WST-1 assay.

Therapeutic effect of the ADP plasmid complex
Preparation of freeze-dried DNA complex

CS solution (594 μg in 118.7 μl) and PEI solution (294 μg in 58.8 μl), respectively, were added in this order to a plasmid DNA coding ADP or mouse GM-CSF solution (100 μg in 4.82 ml). All the solutions were previously prepared in 7 mM PB. After standing for 20 min, the complex of plasmid-ADP and that made of plasmid-GM-CSF was mixed at the given ratio. Dextran solution in H2O (10%, 50 μl) was added, and the mixture was freeze-dried, and stored at 4°C. It was rehydrated with 250 μl of H2O just before use.

Immunization

Immunization was performed by intramuscular injection of pDNA-ADP (10 μg in 50 μl PBS) into the left posterior leg of male ddY mice 3 weeks prior to inoculation of B16 cells.

Therapeutic effect on the tumor-bearing mice

Male C57BL/6 mice (5 weeks) were inoculated subcutaneously with 2.0–2.7×106 B16 cells. When the size of the tumor reached 3–4 mm in diameter, the animals were intratumorally injected with the rehydrated plasmid complex (containing 100 μg of plasmid) five times every other day. The tumor diameter was measured every day for 25 days, and the tumor size was calculated as (4/3)πab2, where a is the long axis and b the short axis of the solid tumor. The care and use of laboratory animals followed the guidelines for animal experiments of the institutes involved.

Results

Preparation of the small DNA complex particle suspension

Extremely small DNA complex particles were obtained by mixing the plasmid/CS premixed solution with PEI at a very low concentration, followed by the lyophilyzed-and-rehydrated condensation procedure, as previously reported (11). Particle size analysis using a laser-diffraction particle size analyzer showed that 50% of the complexes were no more than 150 nm in diameter.

Cytotoxic activity of the pDNA-ADP complex

The cultured B16 melanoma cells were treated with the pDNA-ADP complex, and the survival percentage compared to the non-treated control was estimated by WST-1 assay. The survival rate in the cells treated with pDNA-luciferase complex was also simultaneously examined. As shown in Fig. 1, after 24 h incubation with 10 μg/ml of pDNA-ADP complex, cell survival was almost 60%, as was the case with the pDNA-luciferase complex. After 72 h treatment with the pDNA-ADP complex, a reduction of approximately 50% was observed, while the cells transfected with the luciferase gene still showed a relatively high rate (75%).

Figure 1

Cytotoxicity of plasmid complexes. Each complex was incubated with B16 melanoma cells for 24 or 72 h at the given concentrations.

Therapeutic effect of the pDNA-ADP complex on tumor-bearing mice

Small DNA/PEI/CS complex was prepared with pDNA-ADP, and intratumorally injected five times every other day into immunized or non-immunized male C57BL/6 mice bearing subcutaneous B16 tumors. The results of the pDNA-ADP complex and the pDNA-GM-CS complex are shown in Fig. 2. Rapid growth of the tumor was observed in all the control non-treated mice. In the non-immunized mice, the pDNA-ADP complex showed as effective a suppression of tumor growth as the pDNA-GM-CSF complex, which exhibited a high therapeutic effect, as shown in our previous study (11). When mice were administered pDNA-ADP prior to therapy to generate an immune response to ADP, transfection of the ADP gene induced a much higher level of tumor growth suppression than in the non-immunized mice, whereas the therapeutic effect by the GM-CSF gene was no different between the immunized and non-immunized groups.

Figure 2

In vivo effects of tumor treatment with pDNA-ADP complex (closed circle), or pDNA-GM-CSF complex (open circle), on the non-immunized mice (solid line) or the mice pre-immunized by intramuscular injection of pDNA-ADP (dotted line). The open square expresses the results with control non-treated mice. Each complex containing 100 μg of the plasmid was intratumorally injected five times every other day into male C57BL/6 mice bearing subcutaneous B16 melanoma solid tumors. Tumor volume was expressed as the mean ± SE (n=5).

The effect of the simultaneous co-transfection of pDNA-ADP and pDNA-GM-CSF (total 100 μg of the plasmid per mouse) was examined at various pDNA-ADP/pDNA-GM-CSF ratios on the non-immunized mice. As shown in Fig. 3, an evident synergistic effect of the genes was observed, and significant suppression of tumor growth was observed even in the non-immunized mice. The highest therapeutic effect was obtained at plasmid-ADP/plasmid-GM-CSF at a ratio of 4:1, and the tumor volume was maintained <5 times as large as at the beginning of treatment for 20 days, while that in the control mice became 10 times larger in 10 days.

Figure 3

In vivo effects of tumor treatment with the complexes comprising pDNA-ADP+pDNA-GM-CSF at ratios of 0:5 (open circle), 1:4 (open diamond), 2:3 (open triangle), 3:2 (closed triangle), 4:1 (closed square), and 5:0 (closed circle) on the non-immunized mice. The open square expresses the results with control non-treated mice. Each complex containing 100 μg of the plasmid was intratumorally injected five times every other day into male C57BL/6 mice bearing subcutaneous B16 melanoma solid tumors. Tumor volume was expressed as the mean ± SE (n=5).

Discussion

Cytotoxic activity of the pDNA-ADP complex

ADP has been reported to be associated with a cell lytic activity of adenovirus. Transfection of the ADP gene to cultured cells was therefore expected to show cytotoxic activity. Induction of cytotoxicity by ADP-transfection was higher than that by pDNA-luciferase, but not as high as expected from the cell lytic activity reported. The duration of the plasmid-gene expression, or the protein production may not be sufficient to express strong cell lytic phenomena. Otherwise, ADP may not be capable of cell killing activity by itself. Another adenovirus death factor, E4orf4, was also found to induce cell death and suggested to collaborate with ADP in the induction of cell lysis and progeny release (12).

Therapeutic effect of the pDNA-ADP complex on tumor-bearing mice

In the non-immunized mice, the pDNA-ADP complex was found to be as effective in the suppression of tumor growth as GM-CSF. The effect of the ADP transfection was strongly enhanced by pre-immunization of mice with ADP-coding plasmid. Pre-existing anti-ADP antibody or ADP-specific CTL in the immunized mice would be attributed to the rapid response in the early therapeutic stage.

In in vivo therapy for tumors, GM-CSF is often used as an immunomodulatory agent. Oncolytic viruses engineered to secrete GM-CSF have been reported to show higher antitumor activity (13). Co-injection of GM-CSF-expressing virus also enhanced the anticancer effect of oncolytic viruses (14). The simultaneous co-transfection of the ADP and GM-CSF genes was subsequently attempted to examine the synergistic effect of the proteins on tumor growth suppression. As expected, a much higher therapeutic effect was obtained even in the non-immunized mice at a plasmid-ADP/plasmid-GM-CSF ratio of 3:2 and 4:1. GM-CSF is known to recruit and stimulate DCs in viral tumor therapy (15). The activity of DCs against ADP-expressing tumor cells would be enhanced by the cytokines.

In our previous study, an allogeneic model, B16 melanoma cells in ddY mice, was used allowing pDNA-GM-CSF to exhibit complete regression of the tumor (11). In the present study, a syngeneic model was employed in which tumor growth is more rapid than in the allogeneic model, and the effect of the transfection of the GM-CSF gene was not so strong as to completely inhibit the tumor growth. In the syngeneic model, tumor cells may escape from immune surveillance since the cells are altered cells derived from genetically identical mice. GM-CSF expression may not be enough to prevent tumor escape in a syngeneic model.

Tumor escape from the immune system is most often caused by weak immunogenicity of tumor-associated antigens (TAAs), and has been a major problem in immunotherapy. Various DNA vaccine encoding TAAs have been developed and applied in antitumor immunotherapy. However, the activation of immunity against poorly immunogenic tumor antigens is difficult. Weber et al reported that vaccination of mice with DNA encoding cancer differentiation antigens is ineffective when self-DNA is used (16). These authors showed a high potential of the orthologous DNA from another species. To conquer the disadvantage of weak immunogenicity, Bergman et al developed the xenogeneic DNA vaccination (17). Injection of the plasmid encoding human tyrosinase into dogs bearing melanoma was capable of breaking tolerance against a self-tumor differentiation antigen, leading to high clinical responses.

In this study, a viral protein, ADP, was transfected on the tumor cells. ADP is an integral membrane glycoprotein that localizes to the inner and outer nuclear membrane and the Goldi apparatus. Some ADP molecules may also exist on the cell surface membrane, or at least appear on the apoptotic tumor cell fragments. These fragments would be captured by and stimulate APCs to mature and cross-prime T cells against both ADP and TAAs.

Since Tang et al demonstrated that plasmid DNA induces the formation of antibodies against an encoded protein (18), there has been rapid progress in the DNA vaccine, and it has now been accepted as a promising therapy for tumors. Prior identification of each tumor-related antigen is required for peptide-based immunotherapy. The transfection of ADP is apparently effective in various types of tumor. The elicitation of immune response towards tumor antigens by the transfection of such viral protein genes into tumor cells is likely to be a breakthrough in genetic immunotherapy.

References

1 

De Pace NG: Sulla scomparsa di un enorme cancro vegetante del collo dell’utero senza cura chirurgica. Ginecologia. 9:82–88. 1912.

2 

Martuza RL, Malick A, Markert JM, Ruffner KL and Coen DM: Experimental therapy of human glioma by means of a mutant. Science. 252:854–856. 1991. View Article : Google Scholar : PubMed/NCBI

3 

Todo T, Rabkin SD, Sundaresan P, Wu A, Meehan KR, Herscowitz HB and Martuza RL: Systemic antitumor immunity in experimental brain tumor therapy using a multimutated, replication-competent herpes simplex virus. Hum Gene Ther. 10:2741–2755. 1999. View Article : Google Scholar

4 

Prestwich RJ, Harrington KJ, Pandha HS, Vile RG, Melcher AA and Errington F: Oncolytic viruses: a novel form of immunotherapy. Expert Rev Anticancer Ther. 8:1581–1588. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Suzuki K, Alemany R, Yamamoto M and Curiel DT: The presence of the adenovirus E3 region improves the oncolytic potency of conditionally replicative adenoviruses. Clin Cancer Res. 8:3348–3359. 2002.PubMed/NCBI

6 

Wold WSM, Cladaras C, Magie SC and Yacoub N: Mapping a new gene that encodes an 11,600-molecular-weight protein in the E3 transcription unit of adenovirus 2. J Virol. 52:307–313. 1984.PubMed/NCBI

7 

Tollefson AE, Ryerse JS, Scaria A, Hermiston TW and Wold WS: The E3-11.6-kDa adenovirus death protein (ADP) is required for efficient cell death: characterization of cells infected with adp mutants. Virology. 220:152–162. 1996. View Article : Google Scholar : PubMed/NCBI

8 

Wold WSM, Doronin K, Toth K, Kuppuswamy M, Lichtenstein DL and Tollefson AE: Immune responses to adenoviruses: viral evasion mechanisms and their implications for the clinic. Curr Opin Immunol. 11:380–386. 1999. View Article : Google Scholar : PubMed/NCBI

9 

Tollefson AE, Scaria A, Hermiston TW, Ryerse JS, Wold LJ and Wold WS: The adenovirus death protein (E3-11.6K) is required at very late stages of infection for efficient cell lysis and release of adenovirus from infected cells. J Virol. 70:2296–2306. 1996.PubMed/NCBI

10 

Doronin K, Toth K, Kuppuswamy M, Ward P, Tollefson AE and Wold WS: Tumor-specific, replication-competent adenovirus vectors overexpressing the adenovirus death protein. J Virol. 74:6147–6155. 2000. View Article : Google Scholar : PubMed/NCBI

11 

Ito T, Yoshihara C, Hamada K and Koyama Y: DNA/polyethyl eneimine/hyaluronic acid small complex particles and tumor suppression in mice. Biomaterials. 31:2912–2918. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Lavoie JN, Nguyen M, Marcellus RC, Branton PE and Shore GC: E4orf4, a novel adenovirus death factor that induces p53-independent apoptosis by a pathway that is not inhibited by zVADfmk. J Cell Biol. 140:637–645. 1998. View Article : Google Scholar : PubMed/NCBI

13 

Malhotra S, Kim T, Zager J, Bennett J, Ebright M, D’Angelica M and Fong Y: Use of an oncolytic virus secreting GM-CSF as combined oncolytic and immunotherapy for treatment of colorectal and hepatic adenocarcinomas. Surgery. 141:520–529. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Hamada K, Desaki J, Nakagawa K, Zhang T, Shirakawa T, Gotoh A and Tagawa M: Carrier cell-mediated delivery of a replication-competent adenovirus for cancer gene therapy. Mol Ther. 15:1121–1128. 2007.PubMed/NCBI

15 

Todo T, Rabkin SD, Sundaresan P, Wu A, Meehan KR, Herscowitz HB and Martuza RL: Systemic antitumor immunity in experimental brain tumor therapy using a multimutated, replication-competent herpes simplex virus. Hum Gene Ther. 10:2741–2755. 1999. View Article : Google Scholar

16 

Weber LW, Bowne WB, Wolchok JD, Srinivasan R, Qin J, Moroi Y, Clynes R, Song P, Lewis JJ and Houghton AN: Tumor immunity and autoimmunity induced by immunization with homologous DNA. J Clin Investig. 102:1258–1264. 1998. View Article : Google Scholar : PubMed/NCBI

17 

Bergman PJ, McKnight J, Novosad A, Charney S, Farrelly J, Craft D, Wulderk M, Jeffers Y, Sadelain M, Hohenhaus AE, Segal N, Gregor P, Engelhorn M, Riviere I, Houghton AN and Wolchok JD: Clin Cancer Res. 9:1284–1290. 2003.

18 

Tang DC, DeVit M and Johnston SA: Genetic immunization is a simple method for eliciting an immune response. Nature. 356:152–154. 1992. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yoshihara C, Hamada K, Kuroda M and Koyama Y: Oncolytic plasmid: A novel strategy for tumor immuno-gene therapy. Oncol Lett 3: 387-390, 2012.
APA
Yoshihara, C., Hamada, K., Kuroda, M., & Koyama, Y. (2012). Oncolytic plasmid: A novel strategy for tumor immuno-gene therapy. Oncology Letters, 3, 387-390. https://doi.org/10.3892/ol.2011.467
MLA
Yoshihara, C., Hamada, K., Kuroda, M., Koyama, Y."Oncolytic plasmid: A novel strategy for tumor immuno-gene therapy". Oncology Letters 3.2 (2012): 387-390.
Chicago
Yoshihara, C., Hamada, K., Kuroda, M., Koyama, Y."Oncolytic plasmid: A novel strategy for tumor immuno-gene therapy". Oncology Letters 3, no. 2 (2012): 387-390. https://doi.org/10.3892/ol.2011.467
Copy and paste a formatted citation
x
Spandidos Publications style
Yoshihara C, Hamada K, Kuroda M and Koyama Y: Oncolytic plasmid: A novel strategy for tumor immuno-gene therapy. Oncol Lett 3: 387-390, 2012.
APA
Yoshihara, C., Hamada, K., Kuroda, M., & Koyama, Y. (2012). Oncolytic plasmid: A novel strategy for tumor immuno-gene therapy. Oncology Letters, 3, 387-390. https://doi.org/10.3892/ol.2011.467
MLA
Yoshihara, C., Hamada, K., Kuroda, M., Koyama, Y."Oncolytic plasmid: A novel strategy for tumor immuno-gene therapy". Oncology Letters 3.2 (2012): 387-390.
Chicago
Yoshihara, C., Hamada, K., Kuroda, M., Koyama, Y."Oncolytic plasmid: A novel strategy for tumor immuno-gene therapy". Oncology Letters 3, no. 2 (2012): 387-390. https://doi.org/10.3892/ol.2011.467
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team