Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
April-2015 Volume 9 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2015 Volume 9 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Promoter methylation and expression changes of BRCA1 in cancerous tissues of patients with sporadic breast cancer

  • Authors:
    • Qiuyun Li
    • Wei Wei
    • Yi Jiang
    • Huawei Yang
    • Jianlun Liu
  • View Affiliations / Copyright

    Affiliations: Department of Breast Surgery, The Affiliated Tumor Hospital of Guangxi Medical University, Nanning, Guangxi 530021, P.R. China
  • Pages: 1807-1813
    |
    Published online on: January 27, 2015
       https://doi.org/10.3892/ol.2015.2908
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

BRCA1 is a susceptibility gene that has a genetic predisposition for breast cancer. BRCA1 gene mutation is closely associated with familial hereditary breast cancer, but the BRCA1 gene mutation is rarely found in sporadic breast cancer. According to previous studies, decreased expression of BRCA1 was detected in certain types of sporadic breast cancer. Aberrant methylation of DNA promoter CpG islands is one of the mechanisms by which tumor suppressor gene expression and function is lost. The aim of the present study was to investigate BRCA1 gene expression, methylation status and clinical significance in sporadic types of breast cancer. Quantitative polymerase chain reaction (PCR) and bisulfite sequencing PCR were respectively used to detect expression differences of BRCA1 mRNA and BRCA1 methylation in the 49 cancerous and paired non‑cancerous samples from patients with breast cancer. The associations of BRCA1 expression and methylation status with the clinicopathologic characteristics were analysed. BRCA1 mRNA expression levels in the 49 breast cancer tissues were lower than those in the paired non‑cancerous tissues. There was a significant statistical difference (P=0.001). BRCA1 mRNA expression was not associated with the main clinicopathologic characteristics. Frequency of the BRCA1 promoter methylation in the breast cancerous tissues was significantly higher than that in the non‑cancerous tissues (P=0.007); BRCA1 gene methylation status was negatively correlated with mRNA expression (P=0.029); and BRCA1 methylation exhibited no association with all clinicopathological features. DNA promoter hypermethylation may be the potential mechanism accounting for BRCA1 expression silence in part of sporadic types of breast cancer. Some patients with hypermethylated BRCA1 may display favorable clinicopathological status.

Introduction

BRCA1, breast cancer susceptibility gene 1, maps to 17q21 (1) and encodes a multifunctional protein involved in DNA repair (2), control of cell-cycle checkpoints (3), ubiquitinylation and chromatin remodeling (4). BRCA1 was originally identified and cloned as a predisposition gene of familial breast cancer in 1994 (5). Although a significant fraction of familial types of breast cancer could be explained by the inherited mutations of BRCA1, a large proportion of familial and sporadic types of breast cancer are not associated with mutations in BRCA1 (6–9) Furthermore, BRCA1 mRNA levels were also found to be reduced or absent in invasive sporadic types of breast cancer, thus assigning a role of BRCA1 in these as well (10–12). This suggests that other mechanisms for loss of functions may exist.

Breast cancer results from the manifestation of genetic and epigenetic changes in tumor suppressor genes and oncogenes (13,14). Although the causal association remains under debate, increasing evidence has shown that hypermethylation of promoter CpG islands (15,16), accompanied by global hypomethylation (17,18), are common molecular events in cancer cells. Promoter CpG islands, which frequently locate at the 5′ end regulatory regions of genes, are subject to epigenetic modification by DNA methylation which is known to play an important role in regulating gene expression (16,19). If promoter CpG islands of key genes were hypermethylated and form a closed repressive chromatin configuration, the transcription initiation of the corresponding genes should be affected (20).

There are reports that BRCA1 promoter methylation status is associated with downregulated mRNA and protein levels in breast cancerous tissues (21,22) and cell lines (23). Aberrant BRCA1 promoter methylation is associated with particular biological and clinicopathological features (24,25). However, these studies failed to lead to a conclusive finding. In the current study, the hypothesis is that the absence of BRCA1 transcript is associated with promoter methylation in sporadic types of breast cancer. The present study further investigates BRCA1 gene expression, methylation status and their clinical significance in sporadic breast cancer.

Materials and methods

Study cohort and tissue samples

The study was approved by the ethics committee of Guangxi Medical University (Nanning, China). All patients involved in the study provided their informed consent. The study cohort consisted of 49 patients, who were randomly selected from patients continuously diagnosed with operable breast cancer between September 2010 and September 2012 in the Department of Breast Surgery of the Affiliated Tumor Hospital of Guangxi Medical University. Patients were excluded from participation in the case of familial types of breast cancer; prior chemotherapy or radiotherapy for any malignancy; and pregnancy or lactation.

All the studied samples included 49 surgically resected cancerous tissues and 49 corresponding paired non-cancerous tissues which were taken >5 cm from the tumor macroscopically (in cases where such distance was not present, the non-cancerous sample was taken from the distance furthest from the tumor sample). These samples were the fresh tissues following surgical removal, and were immediately put into liquid nitrogen for 10 min and then into a −80°C ultra freezer. All samples were subsequently reviewed and confirmed by the Department of Pathology of the Affiliated Tumor Hospital of Guangxi Medical University. Pathological information was collected from the patient clinical database, and the information was blinded in another database. The clinicopathologic characteristics of patients included histological tumor type, primary tumor size, axillary nodal status, grade of the disease, estrogen/progesterone receptor (ER/PR) status or HER-2/neu status.

RNA extraction and quantitative polymerase chain reaction (PCR)

The RNA isolated from the breast cancerous tissues and paired non-cancerous tissues were kept using TRIzol® reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. β-actin mRNA was the reference gene used as the internal control. The primers of BRCA1 and β-actin (Invitrogen Life Technologies) are shown in Table I. The PCR cycle conditions used are 95°C for 2 min; 40 cycles at 95°C for 10 sec, 60°C for 30 sec, and 70°C for 30 sec; and final extension at 72°C for 7 min. Dissociation curve analyses were used to confirm the specificity of the SYBR® Green (Invitrogen Life Technologies) signals in each experiment. Data were analyzed using ABI Prism 7900 SDS software (Applied Biosystems, Waltham, MA, USA). The mRNA expression of BRCA1 was analyzed using the 2−ΔΔCt method (26). Fluorescent data were converted into RQ measurements, which stand for relative expression automated by the system software. Thermal dissociation plots were examined for biphasic melting curves. To ensure experiment accuracy, quantitative PCR products were randomly selected for sequencing.

Table I

Primer sequences used in the study.

Table I

Primer sequences used in the study.

Gene/primerSequence
BRCA1
 Forward TGTGAGGCACCTGTGGTGAC
 Reverse GTGGCTGGCTGCAGTCAGTAG
β-catenin
 Forward GAAACGGCTTTCAGTTGAGC
 Reverse CTGGCCATATCCACCAGAGT
Bisulfite sequencing primer
 Forward GATTGGGTGGTTAATTTAGAGT
 Reverse AATTATCTAAAAAACCCCACAA
DNA extraction and sodium bisulfite modification

Total genomic DNA of the specimens were isolated from the breast cancerous tissues and paired non-cancerous tissues, by the DNeasy Tissue AxyPrep DNA extraction kit (Tiangen, Beijing, China). All procedures were followed according to the manufacturer’s instructions. Genomic DNA was modified with bisulfite using MethylCode™ Bisulfite Conversion kit (Invitrogen Life Technologies) according to the manufacturer’s instructions.

Bisulfite genomic sequencing

Bisulfite genomic DNA sequencing was carried out as previously described (27) with sodium bisulfite modification. The CpG islands of promoter region located between −937 and −717 bp (translation start site as 1). The bisulfite-treated DNA was subjected to PCR in order to amplify the BRCA1 promoter region. The primers of bisulfite genomic sequencing are shown in Table I. PCR products were purified and cloned into the pMD18-T vector (Takara, Dalian, China), then transformed into Escherichia coli strain DH5α (Invitrogen Life Technologies). Five positive clones for each sample were selected and analyzed using the ABI 3730 DNA Sequencer (Applied Biosystems). The percentage of methylation for each sample was calculated as the number of methylated CpG dinucleotides/(5×48) × 100%.

Statistical analysis

Statistical analysis was performed using SPSS software version 13.0 (SPSS, Inc., Chicago, IL, USA). Gene expression levels or DNA methylation status of paired samples with normal distribution were expressed as the mean ± standard deviation; otherwise, they were expressed as the median with the first and third interquartile ranges (IQR1 and IQR3). Associations between BRCA1 mRNA expression or DNA methylation and the categorical variables were assessed by the Pearson’s χ2 or Mann-Whitney U tests, as appropriate. Correlation coefficients were assessed by Spearman’s correlation analysis. P<0.05 was considered to indicate a statistically significant difference, and all P-values were two-sided.

Results

Expression of BRCA1 in breast cancerous and paired non-cancerous samples

In the present study, the median level of BRCA1 in non-cancerous samples was set as 1. The median RQs of BRCA1 mRNA in breast cancerous and paired non-cancerous samples were 0.33 (IQR1, 0.18; IQR3, 0.95) and 0.94 (IQR1, 0.46; IQR3, 1.98), respectively. The difference between the two group was statistically significant (Wilcoxon matched-pairs signed-ranks test, P=0.001). The representative results of the quantitative PCR are provided in Fig. 1. The results indicate that the expression of BRCA1 in breast cancer was aberrantly decreased at the transcriptional level.

Figure 1

Relative expression of BRCA1 in breast cancer and paired adjacent non-cancerous samples from the selected patients. BRCA1 expression was expressed as the 2−ΔΔCT.

According to the median RQ of the paired non-cancerous tissues which was 0.94, the tumor tissues were divided into three groups: overexpression (>0.94), normal expression (=0.94) and reduced expression (<0.94). Due to the limited number of tissues in the over and normal expression groups, these two groups were combined into one group, named the unreduced expression group. The correlation between BRCA1 mRNA and the main clinicopathologic characteristics was also analyzed. The associations between them are shown in Table II. No significant correlation was observed between BRCA1 mRNA and the various parameters.

Table II

Correlations between BRCA1 mRNA expression and the main clinicopathologic characteristics.

Table II

Correlations between BRCA1 mRNA expression and the main clinicopathologic characteristics.

BRCA1 mRNA expression

VariablenReduced%Overexpression%P-value
Age (years)0.304a
 <50281967.9932.1
 ≥50211781.0419.0
Menopause0.129a
 Pre291965.51034.5
 Post201785.0315.0
TNM stage0.078b
 I9555.6444.4
 II241770.8729.2
 III161487.5212.5
ER0.219a
 Negative141285.7214.3
 Positive352468.61131.4
PR0.232a
 Negative221881.9418.2
 Positive271866.7933.3
HER-2/neu0.156a
 Negative342779.4720.6
 Positive15960.0640.0
Ki-670.492a
 <0.15151280.0320.0
 ≥0.15342470.61029.4
Axillary nodes0.682a
 Negative241770.8729.2
 Positive251976.0624.0
Tumor stage0.140b
 T16350.0350.0
 T2251872.0728.0
 T3121083.3216.7
 T46583.3116.7

a P-value when expression levels were compared using the Pearson’s χ2 test.

b P-value when expression levels were compared using the Mann-Whitney U test.

{ label (or @symbol) needed for fn[@id='tfn3-ol-09-04-1807'] } TNM, tumor, node and metastasis; ER, estrogen receptor; PR, progesterone receptor.

Correlation of BRCA1 expression and methylation in breast cancerous and paired non-cancerous samples

Analysis was carried out using the Methyl Primer Express version 1.0 (Applied Biosystems) to analyze the CpG islands of the region between −2,000 and +1,000 bp, including the translational initiation codon (ATG) in detail. In the 5′ end of the BRCA1 gene, two CpG islands were revealed, a 244 bp (between −1,279 and −1,036 bp) and a 221 bp (between −937 and −717 bp) segment (Fig. 2).

Figure 2

Genomic architecture of the human BRCA1 gene. (A) Location of the BRCA1 gene within human chromosome 17 (ch17 q21.31); (B) exon/intron structure of the human BRCA1 gene. Noted is the relative location of the first 1 coding exons and the translational start (ATG) codons. (C) Structure of 5′ end of BRCA1 gene. Graph of percent guanine (G) and cytosine (C) nucleotides across this region and boundaries of the CpG island. (D) Detailed information of the BRCA1 promoter region sequence. The bisulfite sequencing polymerase chain reaction primers are presented in the green shaded region. There are 14 CpG sites in this region.

To determine whether epigenetic silencing of the BRCA1 gene also occurs in primary breast cancer, the BRCA1 methylation status in 49 paired breast cancer and corresponding non-cancerous tissues was examined (Fig. 3). Aberrant hypermethylation was detected in 24 of 49 (49%) tumors, which was more frequent than that in the paired no-cancerous tissues (11 of 49, 22.4%; Wilcoxon matched-pairs signed-ranks test, P=0.007). In 24 cases of hypermethylation of cancerous tissues, 20 (83.3%) showed a lower BRCA1 mRNA expression. Furthermore, it was revealed that the association between BRCA1 mRNA expression level and methylation status was a negative correlation (r=-0.311, P=0.029), which indicated a correlation between CpG island hypermethylation and transcriptional silencing.

Figure 3

Methylation status analysis of BRCA1 in breast cancer. BSP methylation status analysis of BRCA1 in (A) breast cancer and (B) non-cancerous tissues; Sulfite process BSP sequencing mode of BRCA1 in (C) breast cancer and (D) non-cancerous tissues. BSP, bisulfite sequencing polymerase chain reaction.

Association between BRCA1 methylation level in breast cancer and the main clinicopathological parameters

To ascertain the potential clinical significance of the epigenetic event, analysis was conducted on the main clinicopathological characters and methylation status of BRCA1 in the 49 cases. The associations between BRCA1 methylation status and various clinicopathological parameters are shown in Table III. No significant correlation was observed between BRCA1 hypermethylation and main parameters such as age at diagnosis, menopausal status, tumor, node and metastasis (TNM) stage, primary tumor size, axillary nodal status, ER/PR status or HER-2/neu status.

Table III

Correlations between BRCA1 methylation status and the main clinicopathological characteristics.

Table III

Correlations between BRCA1 methylation status and the main clinicopathological characteristics.

BRCA1 methylation status

VariablenReduced%Overexpression%P-value
Age0.458a
 <50281346.41553.6
 ≥50211257.1942.9
Menopause0.644a
 Pre291448.31551.7
 Post201155.0945.0
TNM stage0.465b
 I stage9444.4555.6
 II stage241562.5937.5
 III stage16637.51062.5
ER0.470a
 Negative14642.9857.1
 Positive351954.31645.7
PR0.201a
 Negative22940.91359.1
 Positive271659.31140.7
HER-2/neu0.686a
 Negative341852.91647.1
 Positive15746.7853.3
Ki-670.086a
 <0.1515640.0960.0
 ≥0.15341955.91544.1
Axillary nodes0.666a
 Negative241354.21145.9
 Positive251248.01352.0
Tumor stage0.508b
 T16233.3466.7
 T2251144.01456.0
 T312975.0325.0
 T46350.0350.0

a P-value when expression levels were compared using the Pearson’s χ2 test.

b P-value when expression levels were compared using the Mann-Whitney U test.

{ label (or @symbol) needed for fn[@id='tfn6-ol-09-04-1807'] } TNM, tumor, node and metastasis; ER, estrogen receptor; PR, progesterone receptor.

Discussion

BRCA1 is a well-established breast cancer susceptibility gene, and is involved in maintaining genome integrity through pathways including participation in DNA damage repair, the control of cell cycle checkpoints and apoptosis (2–4). In these functions, BRCA1 is implicated in the repair of double strand DNA breaks by homologous chromosomal recombination (28,29). Deficiencies in homology-directed DNA repair cause high levels of genomic instability that increases the risk of tumorigenesis (30). BRCA1 that impairs such function leads to increased proliferation and chromosomal instability. It has been proved that BRCA1 mutation is one of the main genetic events in the hereditary type of breast cancer (6), but no or limited somatic mutations in BRCA1 have been found in the sporadic form of breast cancer. On the another hand, a growing number of studies have demonstrated loss of heterozygosity and a reduced level or absence of BRCA1 expression in sporadic breast cancer (31,32). These two factors suggest that transcriptional and/or posttranscriptional repression of BRCA1 may participate in the development of sporadic breast cancer. One of the common mechanisms of functional inactivation of tumor suppressor genes in cancer cells is the aberrant DNA hypermethylation of CpG islands in the promoter region of the gene that is associated with the loss of gene expression.

Firstly, BRCA1 expression at the mRNA level was detected in paired cancerous and non-cancerous tissue of sporadic breast cancer. BRCA1 expression of breast cancerous tissues showed a relatively lower level as compared with those of the paired non-cancerous tissues. The difference between them was statistically significant. The data indicated that the expression of BRCA1 in breast cancer was aberrantly reduced. Subsequently, the present study demonstrated that the low expression of BRCA1 was significantly correlated with the hypermethylation in its promoter region. In the present study, BRCA1 hypermethylation was detected in 49% of the cases, which was consistent with other previous reports (9.1~59%) (33–35). The differences in the frequency of hypermethylation among the studies may be accounted for by several factors including: Methodology, study cohort, adjacent non-cancerous tissues contaminated by cancer cells and population differences due to exposure to specific environmental factors.

Furthermore, the correlation between BRCA1 hypermethylation and the main clinicopathological characters was analyzed. Ever since BRCA1 hypermethylation was proved to be involved in sporadic breast cancer, some studies were dedicated to explore the correlation between its aberrant methylation and the disease characteristics. BRCA1 promoter methylation status displayed various disease characteristic phenotypes in different studies; however, the majority of studies demonstrated that BRCA1 hypermethylation correlated with lack of estrogen and progesterone receptor expression in younger females (<50 years). Nevertheless, the present study did not discover a significant association between BRCA1 hypermethylation and ER/PR status. This result was similar to that reported in a previous study by Xu et al (36). Furthermore, in the study by Matros et al (37), they even found that BRCA1 hypermethylation is correlated with progesterone receptor positive expression, suggesting a more complex phenotypic association.

In addition, two interesting details were revealed which may be associated with favorable clinical prognosis, though there was no association between BRCA1 hypermethylation and the main clinicopathological characters including age at diagnosis, menopausal status, TNM stage, primary tumor size, axillary nodal status, ER/PR status or HER-2/neu status in sporadic breast cancer. Firstly, the BRCA1 hypermethylation exhibited a higher percentage of the smaller size primary tumor (T1 and T2, tumor size ≤5 cm) compared to the BRCA1 non-methylation ( 58.1% vs. 49.1%). The result seemed to display a trend that BRCA1 hypermethylation tumors tended to be the smaller tumor size. The larger size of tumor is one of the most important indicators for poor prognosis. Secondly, there was more BRCA1 hypermethylation of low Ki-67 index (<15%) cancerous tissues compared with the BRCA1 non-methylation (60% vs. 40%). The high Ki-67 index (≥15%), which is one of the important parameters for luminal phenotype, has been proven to correlate with a greater carcinogenic aggressiveness and worse prognosis. The reasons underlying the phenomenon of BRCA1 methylation were not elucidated, but some evidence was found correlating BRCA1 hypermethylation and favorable disease characteristics in a study by Li et al (38). On the basis of a smaller sample the study demonstrated high survival rates associated with BRCA1 hypermethylation. Krasteva et al (39) also reported that breast cancer with BRCA1 hypermethylation was associated with improved overall survival rates. Those evidences may partly explain the present findings. Following cautious consideration, the findings from the present study do not appear to be contradictory to previous studies. By contrast, the present study results once again manifested that breast cancer was a type of heterogeneous disease from one aspect.

In conclusion, the present study revealed that BRCA1 expression was expressed at low levels in the majority of sporadic breast cancerous tissues, and DNA promoter hypermethylation may be the potential mechanism accounting for BRCA1 expression silence. Secondly, the reduced BRCA1 expression and BRCA1 hypermethylation did not correlate with any clinicopathological features. Finally, partial sporadic breast cancer with BRCA1 hypermethylation may exhibit favorable clinicopathological status. It is thus reasonable to explore BRCA1 epigenetic inactive mechanism and identify a subset of sporadic breast cancer with a specific epigenetic phenotype. Further studies to observe whether a specific BRCA1-related sporadic breast cancer can indicate a favorable prognosis would be beneficial.

Acknowledgements

This study was supported by funds from the Natural Scientific Foundation of Guangxi (no. 2011GXNSFB018102).

References

1 

Hall JM, Lee MK, Newman B, et al: Linkage of early-onset familial breast cancer to chromosome 17q21. Science. 250:1684–1689. 1990. View Article : Google Scholar : PubMed/NCBI

2 

Deng CX and Wang RH: Roles of BRCA1 in DNA damage repair: a link between development and cancer. Hum Mol Genet. 12(Spec No 1): R113–R123. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Xu B, St K and Kastan MB: Involvement of BRCA1 in S-phase and G(2)-phase checkpoints after ionizing irradiation. Mol Cell Biol. 21:3445–3450. 2001. View Article : Google Scholar : PubMed/NCBI

4 

Ralhan R, Kaur J, Kreienberg R and Wiesmüller L: Links between DNA double strand break repair and breast cancer: accumulating evidence from both familial and nonfamilial cases. Cancer Lett. 248:1–17. 2007. View Article : Google Scholar

5 

Miki Y, Swensen J, Shattuck-Eidens D, et al: A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science. 266:66–71. 1994. View Article : Google Scholar : PubMed/NCBI

6 

Easton DF, Bishop DT, Ford D and Crockford GP: Genetic linkage analysis in familial breast and ovarian cancer: results from 214 families. The Breast Cancer Linkage Consortium. Am J Hum Genet. 52:678–701. 1993.PubMed/NCBI

7 

Narod SA, Ford D, Devilee P, et al: An evaluation of genetic heterogeneity in 145 breast-ovarian cancer families. Breast Cancer Linkage Consortium. Am J Hum Genet. 56:254–264. 1995.PubMed/NCBI

8 

Ford D, Easton DF, Stratton M, et al: Genetic heterogeneity and penetrance analysis of the BRCA1 and BRCA2 genes in breast cancer families. The Breast Cancer Linkage Consortium. Am J Hum Genet. 62:676–689. 1998. View Article : Google Scholar : PubMed/NCBI

9 

Hedenfalk I, Ringner M, Ben-Dor A, et al: Molecular classification of familial non-BRCA1/BRCA2 breast cancer. Proc Natl Acad Sci USA. 100:2532–2537. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Thompson ME, Jensen RA, Obermiller PS, Page DL and Holt JT: Decreased expression of BRCA1 accelerates growth and is often present during sporadic breast cancer progression. Nat Genet. 9:444–450. 1995. View Article : Google Scholar : PubMed/NCBI

11 

Magdinier F, Ribieras S, Lenoir GM, Frappart L and Dante R: Down-regulation of BRCA1 in human sporadic breast cancer; analysis of DNA methylation patterns of the putative promoter region. Oncogene. 17:3169–3176. 1998. View Article : Google Scholar

12 

Bianco T, Chenevix-Trench G, Walsh DC, Cooper JE and Dobrovic A: Tumour-specific distribution of BRCA1 promoter region methylation supports a pathogenetic role in breast and ovarian cancer. Carcinogenesis. 21:147–151. 2000. View Article : Google Scholar : PubMed/NCBI

13 

Jones PA and Baylin SB: The fundamental role of epigenetic events in cancer. Nat Rev Genet. 3:415–428. 2002.PubMed/NCBI

14 

Franco R, Schoneveld O, Georgakilas AG and Panayiotidis MI: Oxidative stress, DNA methylation and carcinogenesis. Cancer Lett. 266:6–11. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Herman JG and Baylin SB: Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med. 349:2042–2054. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Das PM and Singal R: DNA methylation and cancer. J Clin Oncol. 22:4632–4642. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Feinberg AP and Vogelstein B: Hypomethylation distinguishes genes of some human cancers from their normal counterparts. Nature. 301:89–92. 1983. View Article : Google Scholar : PubMed/NCBI

18 

Choi JY, James SR, Link PA, et al: Association between global DNA hypomethylation in leukocytes and risk of breast cancer. Carcinogenesis. 30:1889–1897. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Robertson KD: DNA methylation and chromatin-unraveling the tangled web. Oncogene. 21:5361–5379. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Baylin SB and Ohm JE: Epigenetic gene silencing in cancer-a mechanism for early oncogenic pathway addiction. Nat Rev Cancer. 6:107–116. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Esteller M, Silva JM, Dominguez G, et al: Promoter hypermethylation and BRCA1 inactivation in sporadic breast and ovarian tumors. J Natl Cancer Inst. 92:564–569. 2000. View Article : Google Scholar : PubMed/NCBI

22 

Birgisdottir V, Stefansson OA, Bodvarsdottir SK, Hilmarsdottir H, Jonasson JG and Eyfjord JE: Epigenetic silencing and deletion of the BRCA1 gene in sporadic breast cancer. Breast Cancer Res. 8:R382006. View Article : Google Scholar : PubMed/NCBI

23 

Rice JC, Massey-Brown KS and Futscher BW: Aberrant methylation of the BRCA1 CpG island promoter is associated with decreased BRCA1 mRNA in sporadic breast cancer cells. Oncogene. 17:1807–1812. 1998. View Article : Google Scholar : PubMed/NCBI

24 

Catteau A, Harris WH, Xu CF and Solomon E: Methylation of the BRCA1 promoter region in sporadic breast and ovarian cancer: correlation with disease characteristics. Oncogene. 18:1957–1965. 1999. View Article : Google Scholar : PubMed/NCBI

25 

Turner N, Tutt A and Ashworth A: Hallmarks of ‘BRCAness’ in sporadic cancers. Nat Rev Cancer. 4:814–819. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar

27 

Chu D, Zhang Z, Li Y, et al: Prediction of colorectal cancer relapse and prognosis by tissue mRNA levels of NDRG2. Mol Cancer Ther. 10:47–56. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Zhang J and Powell SN: The role of the BRCA1 tumor suppressor in DNA double-strand break repair. Mol Cancer Res. 3:531–539. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Ting NS and Lee WH: The DNA double-strand break response pathway: becoming more BRCAish than ever. DNA Repair (Amst). 3:935–944. 2004. View Article : Google Scholar

30 

De Vargas Roditi L and Michor F: Evolutionary dynamics of BRCA1 alterations in breast tumorigenesis. J Theor Biol. 273:207–215. 2011. View Article : Google Scholar : PubMed/NCBI

31 

Valentin MD, da Silva SD, Privat M, Alaoui-Jamali M and Bignon YJ: Molecular insights on basal-like breast cancer. Breast Cancer Res Treat. 134:21–30. 2012. View Article : Google Scholar : PubMed/NCBI

32 

Warmoes M, Jaspers JE, Pham TV, et al: Proteomics of mouse BRCA1-deficient mammary tumors identifies DNA repair proteins with potential diagnostic and prognostic value in human breast cancer. Mol Cell Proteomics. 11:M111.0133342012. View Article : Google Scholar : PubMed/NCBI

33 

Esteller M, Silva JM, Dominguez G, et al: Promoter hypermethylation and BRCA1 inactivation in sporadic breast and ovarian tumors. J Natl Cancer Inst. 92:564–569. 2000. View Article : Google Scholar : PubMed/NCBI

34 

Rice JC, Ozcelik H, Maxeiner P, Andrulis I and Futscher BW: Methylation of the BRCA1 promoter is associated with decreased BRCA1 mRNA levels in clinical breast cancer specimens. Carcinogenesis. 21:1761–1765. 2000. View Article : Google Scholar : PubMed/NCBI

35 

Krasteva ME, Bozhanov SS, Antov GG, Gospodinova ZI and Angelov SG: Breast cancer patients with hypermethylation in the promoter of BRCA1 gene exhibit favorable clinical status. Neoplasma. 59:85–91. 2012. View Article : Google Scholar

36 

Xu X, Gammon MD, Zhang Y, et al: BRCA1 promoter methylation is associated with increased mortality among women with breast cancer. Breast Cancer Res Treat. 115:397–404. 2009. View Article : Google Scholar :

37 

Matros E, Wang ZC, Lodeiro G, Miron A, Iglehart JD and Richardson AL: BRCA1 promoter methylation in sporadic breast tumors: relationship to gene expression profiles. Breast Cancer Res Treat. 91:179–186. 2005. View Article : Google Scholar : PubMed/NCBI

38 

Li S, Rong M and Iacopetta B: DNA hypermethylation in breast cancer and its association with clinicopathological features. Cancer Lett. 237:272–280. 2006. View Article : Google Scholar

39 

Krasteva ME, Bozhanov SS, Antov GG, Gospodinova ZI and Angelov SG: Breast cancer patients with hypermethylation in the promoter of BRCA1 gene exhibit favorable clinical status. Neoplasma. 59:85–91. 2012. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li Q, Wei W, Jiang Y, Yang H and Liu J: Promoter methylation and expression changes of BRCA1 in cancerous tissues of patients with sporadic breast cancer. Oncol Lett 9: 1807-1813, 2015.
APA
Li, Q., Wei, W., Jiang, Y., Yang, H., & Liu, J. (2015). Promoter methylation and expression changes of BRCA1 in cancerous tissues of patients with sporadic breast cancer. Oncology Letters, 9, 1807-1813. https://doi.org/10.3892/ol.2015.2908
MLA
Li, Q., Wei, W., Jiang, Y., Yang, H., Liu, J."Promoter methylation and expression changes of BRCA1 in cancerous tissues of patients with sporadic breast cancer". Oncology Letters 9.4 (2015): 1807-1813.
Chicago
Li, Q., Wei, W., Jiang, Y., Yang, H., Liu, J."Promoter methylation and expression changes of BRCA1 in cancerous tissues of patients with sporadic breast cancer". Oncology Letters 9, no. 4 (2015): 1807-1813. https://doi.org/10.3892/ol.2015.2908
Copy and paste a formatted citation
x
Spandidos Publications style
Li Q, Wei W, Jiang Y, Yang H and Liu J: Promoter methylation and expression changes of BRCA1 in cancerous tissues of patients with sporadic breast cancer. Oncol Lett 9: 1807-1813, 2015.
APA
Li, Q., Wei, W., Jiang, Y., Yang, H., & Liu, J. (2015). Promoter methylation and expression changes of BRCA1 in cancerous tissues of patients with sporadic breast cancer. Oncology Letters, 9, 1807-1813. https://doi.org/10.3892/ol.2015.2908
MLA
Li, Q., Wei, W., Jiang, Y., Yang, H., Liu, J."Promoter methylation and expression changes of BRCA1 in cancerous tissues of patients with sporadic breast cancer". Oncology Letters 9.4 (2015): 1807-1813.
Chicago
Li, Q., Wei, W., Jiang, Y., Yang, H., Liu, J."Promoter methylation and expression changes of BRCA1 in cancerous tissues of patients with sporadic breast cancer". Oncology Letters 9, no. 4 (2015): 1807-1813. https://doi.org/10.3892/ol.2015.2908
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team