Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
September-October 2014 Volume 2 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-October 2014 Volume 2 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Investigation of toxin gene diversity and antimicrobial resistance of Clostridium difficile strains

  • Authors:
    • Shanshan Zhu
    • Huaping Zhang
    • Xinsheng Zhang
    • Chao Wang
    • Guangming Fan
    • Weifeng Zhang
    • Gang Sun
    • Huihong Chen
    • Liming Zhang
    • Zhaoyun Li
  • View Affiliations / Copyright

    Affiliations: Central Hospital of Taizhou City, Taizhou 318000, P.R. China
  • Pages: 743-748
    |
    Published online on: July 8, 2014
       https://doi.org/10.3892/br.2014.311
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The incidence of Clostridium difficile infection (CDI) has been previously reported in a number of studies. However, data collected from the Chinese population is limited. In the present study, the diversity of the toxin genes, tcdA and tcdB, of 57 Clostridium difficile (C. difficile) isolates from a Chinese population were investigated by polymerase chain reaction (PCR) (38 A+B+, 14 A‑B+ and 5 A‑B‑). Quantitative PCR was used to check the expression of these two genes and it was found that the genes were not expressed by all the strains. The absence of tcdA or tcdB expression in certain strains could be due to the lower expression of tcdD and the higher expression of tcdC, which are positive and negative regulators for these two toxin genes, respectively. In addition, the antimicrobial susceptibilities of 57 isolates were investigated. Therefore, these data would aid in the future prevention of CDI outbreaks and improve the understanding of the infection.

Introduction

Clostridium difficile (C. difficile) has been associated with a wide range of diseases, including toxic megacolon, nosocomial diarrhea and pseudomembranous colitis (1,2). Toxigenic and epidemic C. difficile is a well-established health threat in the nosocomial environment. Several studies have shown that C. difficile causes community-acquired infections and it has been isolated from various human, animal, food and environmental sources, often with similar genetic profiles (3,4). The pathogenicity of C. difficile is associated with its ability to produce two toxins: Toxin A, an enterotoxin; and toxin B, a potent cytotoxin (5), which are responsible for the cellular damage linked to diseases. The tcdA and tcdB genes that encode toxins A and B, respectively, are located in the pathogenicity locus (PaLoc), along with the positive and negative regulator genes, tcdD and tcdC, respectively (6). Several polymerase chain reaction (PCR) methods have been developed to detect the tcdA and tcdB genes and there have been certain studies of the toxin gene diversity, molecular epidemiology and antimicrobial resistance of C. difficile isolated from hospitals. However, thus far, limited data are available on the toxin gene diversity and antimicrobial susceptibilities of the bacterium isolated from C. difficile infection (CDI) patients in China. In the present study, C. difficile isolates were analyzed from patients in the Central Hospital of Taizhou City (Taizhou, China) for the presence of the tcdD, tcdC, cdtA and cdtB genes and the expression patterns were examined via quantitative PCR (qPCR). Additionally, the susceptibility of the C. difficile profiles to 12 antimicrobial agents, including nemonoxacin and tigecycline, were investigated.

Materials and methods

Identification of C. difficile isolates

The faecal samples were collected from various departments of the Taizhou Central Hospital. Isolation of C. difficile was performed on selective Columbia agar supplemented (bioMerieux Co., Ltd., Shanghai, China) with cycloserine-cefoxitin and amphotericin B (Bayer Co., Ltd., Shanghai, China) as described previously (7). Briefly, the plates were incubated in an anaerobic chamber at 37°C for 72 h. The C. difficile isolates were identified by colony morphology, Gram staining, odor and green-yellow fluorescence under UV light (365 nm).

PCR assays

All the PCR reactions were performed with a positive and negative control using the primers (Table I) described by previous studies (8,9). PCR was conducted with 2.5 pl cDNA and 15 pmol of each primer pair in a total volume of 50 p1 with 1 unit of Taq DNA polymerase (Takara Bio, Inc., Shiga, Japan) in a standard reaction mixture. Amplification was achieved by denaturing at 95°C (1 min), primer annealing at 52°C (1 min) and extension at 72°C (1 min), which were repeated for 30 cycles.

Table I

Primers used in the present study.

Table I

Primers used in the present study.

PrimersOligonucleotide sequence (5′→3′)
tcdA-PCR-F CCCAATAGAAGATTCAATATTAAGCTT
tcdA-PCR-R GGAAGAAAAGAACT
TCTGGCTCACTCAGGT
tcdB-PCR-F GGTGGAGCTGCTTCATTGGAGAG
tcdB-PCR-R GTGTAACCTACTTTCATAACACCA
tcdA-qPCR-F TCTACCACTGAAGCATTAC
tcdA-qPCR-R TAGGTACTGTAGGTTTATTG
tcdB-qPCR-F ATATCAGAGACTGATGAG
tcdB-qPCR-R TAGCATATTCAGAGAATATTG
tcdC-qPCR-F TCTCTACAGCTATCCCTGGT
tcdC-qPCR-R AAAAATGAGGGTAACGAATTT
tcdD-qPCR-F CTCAGTAGATGATTTGCAAGAA
tcdD-qPCR-R TTTTAAATGCTCTATTTTTAGCC

[i] qPCR, quantitative polymerase chain reaction; F, forward; R, reverse.

RNA extraction, cDNA synthesis and qPCR assays

cDNA synthesis was performed as described previously by Frias-Lopez et al (9). RNA was extracted from cultured bacterial cells using AllPrep DNA/RNA mini kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions and 2–3 μg RNA was expected to be obtained. To eliminate the potential contamination by DNA, the TURBO DNA-free™ kit was utilized (Applied Biosystems, Foster City, CA, USA) following the manufacturer’s instructions. Subsequently, RNA was reverse transcribed into first strand cDNA using the SuperScript III First-Stand Synthesis SuperMix kit (Invitrogen Life Technologies, Carlsbad, CA, USA) and random hexamer priming. qPCR was performed using the KAPA SYBR FAST qPCR kit (Kapa Biosystems, Woburn, MA, USA) following the manufacturer’s instructions: Denaturing at 95°C (1 min), primer annealing at 52°C (1 min) and extension at 72°C (1 min), repeated for 30 cycles. The increase in fluorescence was measured in real-time during the extension step. The primers used are listed in (Table I). The ΔCt values for each sample between the toxin genes and 16S rRNA were calculated and are listed in Table II. The relative expression levels of tcdC and tcdD were calculated based on the ΔCt values between the two genes and 16S rRNA.

Table II

PCR and qPCR detection of the tcdA and tcdB genes.

Table II

PCR and qPCR detection of the tcdA and tcdB genes.

qPCR

PCRtcdAtcdB



IsolatesUnittcdAtcdBΔCt1ΔCt2ΔCt3ΔCt1ΔCt2ΔCt3
1DN++2.902.752.665.765.335.53
2DN++2.112.232.834.324.364.57
3DN++1.561.581.635.235.555.34
4DN++2.522.672.542.982.752.54
5DN++2.702.652.634.874.544.34
6DN++2.552.442.483.213.453.65
7DN++2.332.352.373.353.453.37
8DN++3.643.703.723.343.753.44
9DN++2.312.112.345.435.465.67
10DN++1.061.050.914.834.924.44
11DN++1.011.091.135.435.555.57
12ICU++0.050.030.026.716.326.43
13ICU++2.132.142.235.315.215.55
14DN++2.372.392.305.735.775.78
15DN++3.683.723.714.324.334.37
16DN++2.972.952.923.213.223.34
17DN++3.213.243.262.342.372.39
18DN++1.091.111.131.291.271.25
19DN++1.211.221.192.322.352.42
20DN++1.241.291.272.552.572.60
21DD++0.360.340.393.212.983.02
22DD++1.021.031.054.564.574.58
23DD++2.012.071.982.222.252.29
24DD++3.033.053.074.594.544.56
25DD++4.514.554.523.373.413.21
26DD++2.722.712.692.212.292.31
27DD++1.671.721.693.983.963.92
28DD++1.791.781.786.536.526.32
29DD++0.770.780.805.905.785.32
30DD++0.340.350.364.904.934.53
31DH++0.560.570.593.983.773.63
32DH++2.312.342.353.293.273.25
33DH++3.413.423.424.534.524.50
34DH++2.792.782.772.982.972.93
35DH++1.561.581.541.951.921.93
36DH++1.961.941.934.784.794.70
37DH++NANANA4.564.674.98
38DH++NANANA3.323.453.56
39DPE−+NANANA5.975.675.88
40DPE−+NANANA2.602.702.66
41ICU−+NANANA3.013.042.34
42ICU−+NANANA3.773.583.60
43ICU−+NANANA3.623.643.65
44DH−+NANANA4.214.224.23
45DH−+NANANA5.325.335.34
46DRO−+NANANA5.295.295.27
47DRO−+NANANA3.553.573.59
48DRO−+NANANA3.113.123.17
49DRO−+NANANA4.194.174.16
50DRO−+NANANA2.482.472.39
51DRO−+NANANANANANA
52DRO−+NANANANANANA
53ICU−−NANANANANANA
54ICU−−NANANANANANA
55DRO−−NANANANANANA
56DRO−−NANANANANANA
57DRO−−NANANANANANA

[i] qPCR, quantitative polymerase chain reaction; DN, Department of Neurosurgery; ICU, Intensive Care Unit; DD, Department of Infectious Diseases; DH, Department of Hematology; NA, not applicable; DPE, Department of Physical Examination; DRO, Department of Radiation Oncology.

Antimicrobial susceptibility testing

The antimicrobial susceptibility tests were performed with 57 C. difficile isolates as described previously (10). Briefly, an inoculum of 105 CFU bacteria was applied to each plate with a glass replicator on supplemented Brucella blood agar (11). The plates were incubated in an anaerobic chamber for 48 h at 37°C. The minimal inhibitory concentration (MIC) was defined as the lowest concentration of each antimicrobial agent that inhibited the growth of the tested isolate. The antimicrobial agents (Sigma-Aldrich, St. Louis, MO, USA) used are listed in Table III.

Table III

Minimal inhibitory concentrations (MICs) of 12 antimicrobial agents for the 57 Clostridium difficile isolates.

Table III

Minimal inhibitory concentrations (MICs) of 12 antimicrobial agents for the 57 Clostridium difficile isolates.

MIC (mg/l)

Antimicrobial agentMIC50MIC90RangeResistant, %
Vancomycin0.401.500.28–2.000.00
Piperacillin4.2026.000.92–33.007.02
Ampicillin-sulbactam1.6560.24–10.008.77
Imipenem10.0018.201.9–32.0010.00
Meropenem3.2010.200.95–15.008.77
Metronidazole0.802.560.125–5.5017.54
Tigecycline0.080.100.03–0.3617.54
Cefotetan35.00168.001.8–185.0021.05
Moxifloxacin2.8037.000.9–175.0063.15
Ertapenem4.0039.000.03–67.0087.7
Cefoxitin101.00145.0045–156.00100.00
Clindamycin95.00267.004–333.00100.00

Results

Analysis of the toxin genes, tcdA and tcdB

C. difficile were isolated from various departments of the hospital: 20 from the Department of Neurosurgery, 7 from the Intensive Care Unit, 10 from the Department of Infectious Diseases, 10 from the Department of Hematology and 10 from the Department of Radiation Oncology (Table II). The PCR assay was used to differentiate toxin A-negative and B-positive (toxin A−, toxin B+) strains from the toxin-positive (toxin A+, toxin B+) strains and the toxin-negative (toxin A−, toxin B−) strains. The primers used are listed in Table I. As shown in Table II, 38 and 14 isolates of the A+B+ and A-B+ strains were identified, respectively, which were the toxigenic strains. The recovery rates of the toxigenic strains were 85–100% according to the hospital studied. By contrast, 5 isolates were A-B−. To investigate the expression levels of tcdA and tcdB genes, qPCR was performed. The Ct values were summarized in Table II. Of the total 38 tcdA PCR-positive isolates, 36 could be detected for the expression of this gene and the expression level varied slightly between the 36 transcripts. Of the total 52 tcdB PCR-positive isolates, the expression of this gene could be identified in 50 qPCR transcripts and they showed slight variations in the expression level as well. No transcription could be detected in the A-B− isolates.

Detection of the tcdC and tcdD genes

Based on these results, the transcription of tcdA could not be detected in isolates 37 and 38, and the transcription of tcdB could not be detected in isolates 51 and 52. As mentioned above, TcdD and TcdC have been indicated as the positive and negative regulators of toxin A and B expression, respectively (6). In order to investigate why the tcdA or tcdB genes are not expressed in isolates 37, 38, 51 and 52, qPCR was performed to detect the expression of tcdC and tcdD. Isolate 1, which showed a high expression of the tcdA and tcdB genes, was used as a positive control. The results (Fig. 1) showed that the mRNA level of tcdD was lower in isolates 37 and 38 compared to isolate 1, and by contrast, the tcdC mRNA level was relatively higher. Furthermore, the mRNA level of tcdD was notably lower in isolates 51 and 52, whereas no transcription of tcdC was detected in these two isolates.

Figure 1

Quantitative polymerase chain reaction detection of the tcdC and tcdD genes in the Clostridium difficile isolates.

Antimicrobial susceptibilities

The MIC ranges, MIC50s, MIC90s and the percentages of the susceptibility of 57 C. difficile isolates to 12 antimicrobial agents are summarized in Table III. All the isolates were susceptible to vancomycin (MIC, ≤2 μg/ml). Susceptibility to piperacillin, ampicillin-sulbactam, imipenem, meropenem, metronidazole and tigecycline was shown in >80% isolates. The resistance rates to cefotetan, moxifloxacin and ertapenem were >70%. However, no isolates were susceptible to cefoxitin or clindamycin. Tigecycline demonstrated the lowest MIC50 (0.08 mg/l) and inhibited all the strains at 0.36 mg/l, whereas cefoxitin showed the highest MIC50 (101 mg/l). Tigecycline was also the most active with regards to MIC90 (0.1 mg/l), whereas clindamycin had the highest MIC90 (267 mg/l).

Discussion

The toxin gene diversity has been investigated in numerous studies by PCR (10). For example, the multiplex PCR method by Persson et al (14) allowed the simultaneous identification of the tcdA, tcdB, cdtA and cdtB toxin genes. In addition, a multiplex qPCR method for the detection of toxigenic C. difficile from stools and the presumptive identification of the NAP-1 strain was developed by Jayaratne et al (15). In the present study, PCR and qPCR were carried out to identify the tcdA and tcdB toxin genes in 57 isolated samples from the Central Hospital of Taizhou City, and the study was a systematic survey of the types of the C. difficile toxin genes in China. The results showed that of the 57 isolates, 38 (66.67%) were A+B+, which plays a major role in CDI. A total of 14 (24.56%) isolates were A-B+ strains, which have been reported to be significantly increased during recent years (16). In studies from various global locations, different proportions of the A-B+ strains have been reported (17,18). In the present study, based on the PCR results, the A-B− strain accounted for only 5 (8.77%) of the isolates. However, according to the qPCR results, not all the A+ or B+ isolates showed detectable expression of these genes. This can be explained by the inhibition of tcdA or tcdB transcription by regulators in certain strains. By contrast, it has also been reported that there are certain activators, including σ factors and the positive regulator TcdD, which are necessary for the expression of TcdA and TcdB (19). Therefore, the absence of these types of activators may be another reason why these two genes are not expressed. However, this requires further investigation.

Certain studies (20) have focused on the regulation of the tcdA and tcdB toxin genes. Earlier studies (21) indicated that TcdC has a negative influence on the transcription of the other genes in PaLoc, consisting of the tcdA-E genes, and TcdD has a positive regulatory function on the transcription of the tcdD, tcdB, tcdE and tcdA genes. In the present study, the mRNA levels of the tcdC and tcdD genes were detected in isolates 1, 37, 38, 51 and 52 to identify why tcdA or tcdB are not transcribed. Consistent with previous studies (22), the mRNA level of tcdC was significantly higher in isolates 37 and 38, in which the toxin tcdA was not detectable, indicating that the transcription of tcdA could be inhibited by TcdC. Notably, no transcription of tcdC could be detected in isolates 51 and 52, possibly due to the absence of this gene in the strains. Spigaglia et al (23) have previously reported the deletion of tcdC in C. difficile clinical isolates. By contrast, another reason why tcdA is not expressed in isolates 37, 38, 51 and 52 could be due to the low expression of tcdD.

The susceptibility of the 57 C. difficile isolates to 12 antimicrobial agents was also investigated. All the isolates of C. difficile showed susceptibility to vancomycin, which is consistent with the fact that it is an effective agent against C. difficile infection (24). In addition, the C. difficile isolates in the present study were universally susceptible to piperacillin, ampicillin-sulbactam, imipenem and meropenem. Based on the study by Settle et al (25), it has been proved that piperacillin, regarding its broad-spectrum activity particularly against anaerobes, was relatively more likely to induce C. difficile colonization or diarrhea. Thus, it is not widely used in hospitals. Notably, 90% of the isolates in the present study were susceptible to imipenem, which varies from the results of previous studies (12,26). In an investigation of the inhibitory activity of antimicrobial agents against clinical isolates of C. difficile by Cheng et al (26), found resistance to imipenem in the majority of tested strains. Ampicillin-sulbactam has been reported to be active against C. difficile in numerous studies (27,28). Similar to the results in the present study, Lin et al (28) and Hecht et al (29) also demonstrated that meropenem had low MIC90 values (4 and 2 μg/ml, respectively). Tigecycline had the lowest MIC90 value for C. difficile isolates and was followed by vancomycin and metronidazole (all, >3 mg/l), which is similar to previous studies (30,31). Tigecycline has been proved to not induce proliferation or cytotoxin production by epidemic C. difficile strains, and patients with severe refractory CDI were successfully treated with tigecycline (32,33). Clindamycin showed the highest MIC90 of all the antimicrobial agents tested, consistent with the study by Lin et al (28) and as previously reported by Critchley (34), the use of clindamycin was independently associated with the infection of C. difficile.

In conclusion, the present study identified the presence of the tcdA and tcdB toxin genes in the isolates of 57 C. difficile isolates from Chinese patients, using PCR and qPCR. Similar to previous studies, the A+B+ was the dominant ribotype. Certain isolates were shown to be lacking tcdA or the tcdB gene expression, possibly due to the absent or higher expression of tcdC and lower expression of tcdD. The susceptibility of the genes to 12 agents was also investigated. The isolates showed similar susceptibility to specific agents, as reported previously, such as ampicillin-sulbactam. However, certain agents appeared to be more active against the isolates in the present study compared to in previous studies, such as imipenem. These data provide novel information on the characteristics of C. difficile isolated from Chinese patients and would aid in the future prevention of outbreaks.

Acknowledgements

The present study was supported by the Science and Technology Plan of Medicine and Health of Zhejiang (grant no. 2010KYA186). The authors are grateful to Dr Lin Liu, Mrs. Beijia Zheng, Mrs. Jinfeng Li and Mr. Xueyong Li for providing the clinical samples in the study and to Caixia Zhu for critical reading of the manuscript.

References

1 

Bartlett JG, Chang TW, Gurwith M, et al: Antibiotic-associated pseudomembranous colitis due to toxin-producing clostridia. N Engl J Med. 298:531–534. 1978. View Article : Google Scholar : PubMed/NCBI

2 

McFarland LV, Surawicz CM and Stamm WE: Risk factors for Clostridium difficile carriage and C. difficile-associated diarrhea in a cohort of hospitalized patients. J Infect Dis. 162:678–684. 1990.

3 

Freeman J, Bauer MP, Baines SD, et al: The changing epidemiology of Clostridium difficile infections. Clin Microbiol Rev. 23:529–549. 2010. View Article : Google Scholar

4 

Arroyo LG1, Kruth SA, Willey BM, Staempfli HR, Low DE and Weese JS: PCR ribotyping of Clostridium difficile isolates originating from human and animal sources. J Med Microbiol. 54:163–166. 2005.PubMed/NCBI

5 

Hatheway CL: Toxigenic clostridia. Clin Microbiol Rev. 3:66–98. 1990.

6 

Spigaglia P and Mastrantonio P: Comparative analysis of Clostridium difficile clinical isolates belonging to different genetic lineages and time periods. J Med Microbiol. 53:1129–1136. 2004.

7 

Martirosian G: Recovery of Clostridium difficile from hospital environments. J Clin Microbiol. 44:1202–1203. 2006.

8 

Samie A, Obi CL, Franasiak J, et al: PCR detection of Clostridium difficile triose phosphate isomerase (tpi), toxin A (tcdA), toxin B (tcdB), binary toxin (cdtA, cdtB), and tcdC genes in Vhembe District, South Africa. Am J Trop Med Hyg. 78:577–585. 2008.

9 

Frias-Lopez J, Shi Y, Tyson GW, et al: Microbial community gene expression in ocean surface waters. Proc Natl Acad Sci USA. 105:3805–3810. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Zhu S, Zhang L, Zhang C, et al: Comparison of polymerase chain reaction ribotyping, toxinotyping and nutritional aspects of toxin production of Clostridium difficile strains. Biomed Rep. 2:477–480. 2014.PubMed/NCBI

11 

Bélanger SD, Boissinot M, Clairoux N, et al: Rapid detection of Clostridium difficile in feces by real-time PCR. J Clin Microbiol. 41:730–734. 2003.

12 

John R and Brazier JS: Antimicrobial susceptibility of polymerase chain reaction ribotypes of Clostridium difficile commonly isolated from symptomatic hospital patients in the UK. J Hosp Infect. 61:11–14. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Clinical and Laboratory Standards Institute (CLSI). Methods for antimicrobial susceptibility testing of anaerobic bacteria, approved standard M11-A7. 7th edition. CLSI; Wayne, PA: pp. 309–315. 2007

14 

Persson S, Jensen JN and Olsen KE: Multiplex PCR method for detection of Clostridium difficile tcdA, tcdB, cdtA, and cdtB and internal in-frame deletion of tcdC. J Clin Microbiol. 49:4299–4300. 2011.PubMed/NCBI

15 

Jayaratne PA, Monkman L, Broukhanski G, et al: Real-time polymerase chain reaction method for detection of toxigenic Clostridium difficile from stools and presumptive identification of NAP1 clone. Diagn Microbiol Infect Dis. 75:121–123. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Du P, Cao B, Wang J, et al: Sequence variation in tcdA and tcdB of Clostridium difficile: ST37 with truncated tcdA is a potential epidemic strain in China. J Clin Microbiol. June.23–2014.(Epub ahead of print).

17 

Geric B, Rupnik M, Gerding DN, et al: Distribution of Clostridium difficile variant toxinotypes and strains with binary toxin genes among clinical isolates in an American hospital. J Med Microbiol. 53:887–894. 2004.

18 

Kim H, Riley TV, Kim M, et al: Increasing prevalence of toxin A-negative, toxin B-positive isolates of Clostridium difficile in Korea: impact on laboratory diagnosis. J Clin Microbiol. 46:1116–1117. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Saujet L, Monot M, Dupuy B, et al: The key sigma factor of transition phase, SigH, controls sporulation, metabolism, and virulence factor expression in Clostridium difficile. J Bacteriol. 193:3186–3196. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Gerding DN, Johnson S, Rupnik M and Aktories K: Clostridium difficile binary toxin CDT: mechanism, epidemiology, and potential clinical importance. Gut Microbes. 5:15–27. 2014. View Article : Google Scholar

21 

Goldenberg SD and French GL: Lack of association of tcdC type and binary toxin status with disease severity and outcome in toxigenic Clostridium difficile. J Infect. 62:355–362. 2011.

22 

Antunes A and Dupuy B: Molecular methods to study transcriptional regulation of Clostridium difficile toxin genes. Methods Mol Biol. 646:93–115. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Spigaglia P, Barbanti F, Dionisi AM and Mastrantonio P: Clostridium difficile isolates resistant to fluoroquinolones in Italy: emergence of PCR ribotype 018. J Clin Microbiol. 48:2892–2896. 2010. View Article : Google Scholar

24 

Gerding DN, Muto CA and Owens RC Jr: Treatment of Clostridium difficile infection. Clin Infect Dis. 46(Suppl 1): S32–S42. 2008.

25 

Settle CD, Wilcox MH, Fawley WN, et al: Prospective study of the risk of Clostridium difficile diarrhoea in elderly patients following treatment with cefotaxime or piperacillin-tazobactam. Aliment Pharmacol Ther. 12:1217–1223. 1998.PubMed/NCBI

26 

Cheng SH, Chu FY, Lo SH and Lu JJ: Antimicrobial susceptibility of Clostridium difficile by E test. J Microbiol Immunol Infect. 32:116–120. 1999.

27 

Ednie LM, Jacobs MR and Appelbaum PC: Activities of gatifloxacin compared to those of seven other agents against anaerobic organisms. Antimicrob Agents Chemother. 42:2459–2462. 1998.PubMed/NCBI

28 

Lin YC, Huang YT, Tsai PJ, et al: Antimicrobial susceptibilities and molecular epidemiology of clinical isolates of Clostridium difficile in Taiwan. Antimicrob Agents Chemother. 55:1701–1705. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Hecht DW, Galang MA, Sambol SP, et al: In vitro activities of 15 antimicrobial agents against 110 toxigenic Clostridium difficile clinical isolates collected from 1983 to 2004. Antimicrob Agents Chemother. 51:2716–2719. 2007.PubMed/NCBI

30 

Larson KC, Belliveau PP and Spooner LM: Tigecycline for the treatment of severe Clostridium difficile infection. Ann Pharmacother. 45:1005–1010. 2011. View Article : Google Scholar : PubMed/NCBI

31 

Wilcox MH: Evidence for low risk of Clostridium difficile infection associated with tigecycline. Clin Microbiol Infect. 13:949–952. 2007.PubMed/NCBI

32 

Baines SD, Saxton K, Freeman J, et al: Tigecycline does not induce proliferation or cytotoxin production by epidemic Clostridium difficile strains in a human gut model. J Antimicrob Chemother. 58:1062–1065. 2006. View Article : Google Scholar : PubMed/NCBI

33 

Herpers BL, Vlaminckx B, Burkhardt O, et al: Intravenous tigecycline as adjunctive or alternative therapy for severe refractory Clostridium difficile infection. Clin Infect Dis. 48:1732–1735. 2009. View Article : Google Scholar : PubMed/NCBI

34 

Critchley IA, Green LS, Young CL, et al: Spectrum of activity and mode of action of REP3123, a new antibiotic to treat Clostridium difficile infections. J Antimicrob Chemother. 63:954–963. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhu S, Zhang H, Zhang X, Wang C, Fan G, Zhang W, Sun G, Chen H, Zhang L, Li Z, Li Z, et al: Investigation of toxin gene diversity and antimicrobial resistance of Clostridium difficile strains. Biomed Rep 2: 743-748, 2014.
APA
Zhu, S., Zhang, H., Zhang, X., Wang, C., Fan, G., Zhang, W. ... Li, Z. (2014). Investigation of toxin gene diversity and antimicrobial resistance of Clostridium difficile strains. Biomedical Reports, 2, 743-748. https://doi.org/10.3892/br.2014.311
MLA
Zhu, S., Zhang, H., Zhang, X., Wang, C., Fan, G., Zhang, W., Sun, G., Chen, H., Zhang, L., Li, Z."Investigation of toxin gene diversity and antimicrobial resistance of Clostridium difficile strains". Biomedical Reports 2.5 (2014): 743-748.
Chicago
Zhu, S., Zhang, H., Zhang, X., Wang, C., Fan, G., Zhang, W., Sun, G., Chen, H., Zhang, L., Li, Z."Investigation of toxin gene diversity and antimicrobial resistance of Clostridium difficile strains". Biomedical Reports 2, no. 5 (2014): 743-748. https://doi.org/10.3892/br.2014.311
Copy and paste a formatted citation
x
Spandidos Publications style
Zhu S, Zhang H, Zhang X, Wang C, Fan G, Zhang W, Sun G, Chen H, Zhang L, Li Z, Li Z, et al: Investigation of toxin gene diversity and antimicrobial resistance of Clostridium difficile strains. Biomed Rep 2: 743-748, 2014.
APA
Zhu, S., Zhang, H., Zhang, X., Wang, C., Fan, G., Zhang, W. ... Li, Z. (2014). Investigation of toxin gene diversity and antimicrobial resistance of Clostridium difficile strains. Biomedical Reports, 2, 743-748. https://doi.org/10.3892/br.2014.311
MLA
Zhu, S., Zhang, H., Zhang, X., Wang, C., Fan, G., Zhang, W., Sun, G., Chen, H., Zhang, L., Li, Z."Investigation of toxin gene diversity and antimicrobial resistance of Clostridium difficile strains". Biomedical Reports 2.5 (2014): 743-748.
Chicago
Zhu, S., Zhang, H., Zhang, X., Wang, C., Fan, G., Zhang, W., Sun, G., Chen, H., Zhang, L., Li, Z."Investigation of toxin gene diversity and antimicrobial resistance of Clostridium difficile strains". Biomedical Reports 2, no. 5 (2014): 743-748. https://doi.org/10.3892/br.2014.311
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team