Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
July-2016 Volume 5 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2016 Volume 5 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Qing'E formula alleviates the aging process in D-galactose-induced aging mice

  • Authors:
    • Lin Zhong
    • Fei Huang
    • Hailian Shi
    • Hui Wu
    • Beibei Zhang
    • Xiaojun Wu
    • Xiaohui Wei
    • Zhengtao Wang
  • View Affiliations / Copyright

    Affiliations: Shanghai Key Laboratory of Complex Prescription, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine, Shanghai 201203, P.R. China
  • Pages: 101-106
    |
    Published online on: April 28, 2016
       https://doi.org/10.3892/br.2016.667
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Qing'E formula (QEF) is a clinically used prescription with four ingredients, Eucommiae Cortex, Psoraleae Fructus, Juglandis Semen and Garlic Rhizoma, from the Song dynasty (10th century CE). The present study aimed to investigate the anti‑aging effect and mechanisms of QEF on D-galactose-induced aging mice. A mouse subacute aging model was established by subcutaneous injection of D‑galactose at the neck consecutively for 8 weeks. Motor activity and memory impairment of the mice were evaluated by the rotarod test and passive avoidance test, respectively. Serum and liver parameters were analyzed with biochemical kits. Hippocampal mRNA and protein expression levels were examined by reverse transcription-quantitative polymerase chain reaction and western blotting, respectively. QEF administration significantly ameliorated the impaired motor and memory of aging mice. In the serum, QEF reduced blood urea nitrogen, creatinine, nitric oxide (NO) and malondialdehyde (MDA) levels, and inhibited alanine aminotransferase and aspartate aminotransferase activities. In the liver, QEF increased the glutathione level, enhanced total antioxidant capacity and catalase activity, deceased NO and MDA production, and reduced NO synthase activity. In the hippocampus, QEF elevated gene expression levels of Klotho, sirtuin 1 (SIRT1), forkhead box transcription factor O3, peroxisome proliferator-activated receptor γ coactivator 1α (PGC‑1α), insulin‑like growth factor‑1 and peroxiredoxin‑3. QEF increased protein expression levels of Klotho and SIRT1, and decreased that of PGC‑1α in the hippocampus. In conclusion, QEF attenuated the aging process in D-galactose-treated mice, which may be mediated through enhancing the antioxidants in the body, protecting renal and hepatic health, and balancing hippocampal expression levels of the longevity-related genes.

Introduction

Aging is a natural process that increases the vulnerability of an organism to the challenges of environment and diseases. For humans, the aging of a population implicates the rising morbidity and mortality of age-associated disorders, such as Alzheimer's disease, heart failure and stroke, which exert a heavy burden on society. As is known so far, >300 theories (1) of aging have been proposed, suggesting a complex and multifactorial process. For a long time, slowing or delaying the aging process has attracted increasing attention in the field of medicine research. However, there are no supplements or products that are known to stop the aging process (2).

Chronic D-galactose administration has been demonstrated to accelerate the aging process in rodents and Drosophia (3,4). The animals administered with D-galactose exhibited typical symptoms, such as cognitive dysfunction, neurodegeneration, weakened motor function and shortened lifespan that resemble the natural process of aging. Therefore, this model is used widely for the study of the aging process and screening of anti-aging drugs.

Qing'E formula (QEF) is a traditional prescription with four ingredients, Eucommiae Cortex, Psoraleae Fructus, Juglandis Semen and Garlic Rhizoma, in a specified ratio according to the Chinese Pharmacopoeia (5). In China, QEF was used 1,000 years ago from the Song dynasty (10th century CE), and it is associated with invigorating the kidneys, replenishing bone and muscle, causing the body to become slimmer and benefiting complexion. QEF can clinically alleviate osteoporosis in postmenopausal woman (6), and improve menopausal symptoms (7). However, little is known regarding whether QEF has an anti-aging effect. In the present study, the anti-aging function of QEF was assessed on D-galactose-induced aging mice. QEF showed marked attenuation on the impaired motor and memory of mice. Following this, the possible underlying mechanisms were investigated. The study may contribute to the clinical application of QEF as a remedy for anti-aging.

Materials and methods

Materials

QEF was prepared as reported previously (8). Briefly, the four ingredients, Eucommiae Cortex (baked with salt), Psoraleae Fructus (baked with salt), Juglandis Semen and Garlic Rhizoma (steamed and dried) were mixed at the ratio of 16:8:5:4 (w/w) and pulverized to a fine powder following identification by Professor Hong Xu, at the Ministry of Education Key Laboratory for Standardization of Chinese Medicines, Shanghai University of Traditional Chinese Medicine (Shanghai, China). Specimens of the herbs were kept in the laboratory for authentication. The representative components of QEF determined by high-pressure liquid chromatography were as follows: Psoralen (0.0785%), isopsoralen (0.0668%), isobavachalcone (0.098%), bavachin (0.031%), corylifol A (0.036%), neobavaisoflavone (0.056%) and pinoresinol diglucoside (0.024%).

Biochemical kits for measuring glutathione (GSH), catalase (CAT), total antioxidant capacity (T-AOC), total superoxide dismutase (T-SOD), malondialdehyde (MDA), nitric oxide (NO), NO synthase (NOS), blood urea nitrogen (BUN), creatinine (CREA), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). D-galactose was obtained from Sigma-Aldrich (St. Louis, MO, USA). All the other reagents were of analytical grade and commercially available.

Animals and treatment

Three-month-old male mice (Kunming strain), weighing 45±5.0 g, were provided by Shanghai University of Traditional Chinese Medicine. The animals were acclimated to the laboratory environment for 1 week before the experiment. They were housed under standard conditions (25°C; 12-h light and 12-h dark) with free access to food and water. All experimental procedures were carried out in compliance with the Chinese legislation on the use and care of laboratory animals and were approved by the university committees for animal experiments.

The mice were divided randomly into 6 groups (12 mice/group): The control, model, vitamin E (VE), and QEF-low, -middle and -high groups. Mice in the control group were intraperitoneally injected with saline, and the other mice were administered a daily subcutaneous injection of D-galactose (100 mg/kg/day) at the neck consecutively for 8 weeks. Mice also received intragastric gavage with different drugs suspended in 0.5% sodium carboxymethyl cellulose. The control and model group mice were treated with saline. For VE group mice, they were administered with VE (100 mg/kg/day). And for QEF group mice, they were given QEF at doses of 1.62 (QEF-L), 3.24 (QEF-M) or 6.48 (QEF-H) g/kg/day.

Behavioral tests
Rotarod test (RRT)

RRT was carried out with a Rota-Rod Treadmill (Mobiledatum, Inc., Shanghai, China). Subsequent to being trained to walk steadily on a horizontally oriented rod, the mice walked on the rod rotating at 40 rpm for a ≤600 sec on the testing day. The trial for each mouse was repeated three times with an interval longer >1 h. The data were averaged for statistical analysis.

Passive avoidance test (PAT)

PAT was conducted in the shuttle boxes, as described previously (9). Briefly, on day 1, the mice were trained to learn to stay in the bright chamber with a criterion of 300 sec. On day 2, the time for the passive avoidance response of the animals was evaluated in 300 sec. The latency to enter the dark chamber and the number of entries were recorded by a video-tracking system (Mobiledatum, Inc.).

Biochemical analysis

Following behavioral tests, the mice were anesthetized with isoflurane. The orbital blood of mice was collected. Subsequently, the liver, kidney and hippocampus from the mice were dissected on ice. All the tissue samples were snap-frozen in liquid nitrogen and stored at −80°C until further analysis. The activities of T-AOC, ALT, AST, CAT, T-SOD and NOS, and the levels of GSH, MDA, NO, BUN and CREA were determined using the respective kits, following the manufacturers' protocols.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNAs from hippocampal tissues of mice were extracted using TRIzol according to the manufacturer's protocol (Life Technologies, Thermo Fisher Scientific, Inc., Waltham, MA, USA). Subsequent to eliminating the trace amount of DNA contamination with DNase I, the RNA was reverse transcribed into cDNA with the RevertAid First Strand cDNA Synthesis kit (Fermentas, Thermo Fisher Scientific, Inc.). The synthesized cDNA was used as templates for the RT-qPCR reaction using the Taqman SYBR kit (Life Technologies, Thermo Fisher Scientific, Inc.). The primers used [Klotho, sirtuin 1 (SIRT1), forkhead box O transcription factor 3 (FOXO3), peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α), insulin-like growth factor-1 (IGF-1) and peroxiredoxin-3 (PRDX-3)] are listed in Table I. Relative expression levels of the respective genes were normalized to that of glyceraldehyde-3-phosphate dehydrogenase within the same sample.

Table I.

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

GeneForward primerReverse primer
GAPDH ATGTGTCCGTCGTGGATCTGA ATGCCTGCTTCACCACCTTCT
Klotho GGGACACTTTCACCCATCACT ACGTTGTTGTAACTATCGCTGG
SIRT1 GCTGACGACTTCGACGACG TCGGTCAACAGGAGGTTGTCT
PGC-1α TATGGAGTGACATAGAGTGTGCT CCACTTCAATCCACCCAGAAAG
PRDX-3 TCGACGACTTTAAGGGGAAA CCATTCTTTCTTGGCGTGTT
IGF-1 GATGGGGAAAATCAGCAGTC GCTGGTAAAGGTGAGCAAGC
FOXO3 CTGGGGGAACCTGTCCTATG TCATTCTGAACGCGCATGAAG

[i] GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SIRT1, sirtuin 1; PGC-1α, peroxisome proliferator-activated receptor γ coactivator-1α; PRDX-3, peroxiredoxin-3; IGF-1, insulin-like growth factor-1; FOXO3, forkhead box O transcription factor 3.

Western blotting

Hippocampal tissues were homogenized by sonication in CelLytic™ MT mammalian tissue lysis reagent (Sigma-Aldrich) supplemented with protease and phosphatase inhibitor cocktails. After centrifugation at 13,523 × g at 4°C for 10 min, the supernatant of the lysate was collected and subjected to SDS-PAGE. Following this, the proteins were transferred onto polyvinylidene fluoride membranes. Subsequent to blocking with 5% skimmed milk, the membranes were incubated with primary antibodies against SIRT1 (cat. no. ab110304; 1:1,000, mouse monoclonal antibody), PGC-1α (cat. no. ST1202; 1:1,000, mouse monoclonal antibody), KLOTHO (cat. no. ab154163; 1:1,000, rabbit monoclonal antibody) and β-actin (cat. no. 4967; 1:5,000, rabbit polyclonal antibody) overnight at 4°C followed by incubation with respective horseradish peroxide-conjugated secondary antibodies. The bands were visualized with the ECL prime kit (GE Healthcare, Chalfont, UK). Relative quantification of the blots was conducted using ImageJ 1.46r (National Institute of Health, Bethesda, MD, USA).

Statistical analysis

All data are presented as mean ± standard error of the mean. The difference between groups was evaluated by one-way analysis of variance with Dunnett's multiple comparison test. P<0.05 was considered to indicate a statistically significant difference.

Results

Effect of QEF on behavioral parameters

Following treatment with QEF for 8 weeks, the mice were first subjected to RRT. As shown in Fig. 1A, D-galactose-injected mice fell quicker from the rod in the RRT (P<0.001) in comparison with the control group mice. Similar to VE, the positive drug, QEF at all doses significantly prolonged the residence time of mice on the rod (P<0.01).

Figure 1.

Effect of QEF on D-gal-induced aging mice behavior. (A) QEF prolonged residence time of aging mice on rod in RRT. (B) QEF increased latency to the dark chamber of aging mice in PAT. (C) QEF decreased the erroneous entries of aging mice in PAT. All the data are presented as mean ± standard error of the mean. n=10–12/group. *P<0.05; **P<0.01; ***P<0.001 vs. D-gal group. QEF, Qing'E formula; D-gal, D-galactose; L, low dose (1.62 g/kg/day); M, medium dose (3.24 g/kg/day); H, high dose (6.48 g/kg/day); VE, vitamin E; RRT, rotarod test; PAT, passive avoidance test.

In PAT, D-galactose injection impaired the memory of mice as they exhibited shorter latency (Fig. 1B) (P<0.01) but increased entries (Fig. 1C) (P<0.001) into the dark chamber. Although only low dose of QEF significantly extended the latency of D-galactose-treated mice (P<0.05), all doses of QEF on mice markedly reduced their entries into the dark chamber.

The behavioral tests indicated that QEF treatment could enhance motor coordination and alleviate the impairment of memory of the aging mice.

Effect of QEF on serum parameters

Biochemical tests showed that D-galactose increased the serum levels of BUN, CREA, AST, ALT, NO and MDA markedly (P<0.05 or P<0.001) (Fig. 2). QEF treatment at all doses could reverse all the aforementioned indexes, although not in a dose-dependent manner (P<0.05, P<0.01 or P<0.001). By contrast, VE could only decrease serum BUN, CREA and AST levels (P<0.05 or P<0.001). The results implicated that QEF attenuated the aging process in the blood.

Figure 2.

Effect of QEF on the serum parameters of D-gal-induced aging mice. (A) QEF improved the increased BUN level. (B) QEF prevented the elevation of CREA level. (C) QEF reduced the increased AST activity. (D) QEF deceased the increased ALT activity. (E) QEF lessened the elevated NO level. (F) QEF mitigated the increased serum MDA level. All data are presented as mean ± standard error of the mean. n=10–12/group. *P<0.05, **P<0.01, ***P<0.001 vs. D-gal group. QEF, Qing'E formula; D-gal, D-galactose; L, low dose (1.62 g/kg/day); M, medium dose (3.24 g/kg/day); H, high dose (6.48 g/kg/day); VE, vitamin E; BUN, blood urea nitrogen; CREA, creatinine; AST, aspartate aminotransferase; ALT, alanine aminotransferase; NO, nitric oxide; NOS, NO synthase.

Effect of QEF on liver parameters

In the mouse liver, long-term D-galactose treatment decreased GSH level and reduced T-AOC and CAT activities (P<0.05 or P<0.001) (Fig. 3A–C). However, it induced the elevation of NO, MDA levels and NOS activity (P<0.05 or P<0.01) (Fig. 3D–F). Following QEF treatment, all the biochemical parameters in liver were improved. However, the positive control, VE, improved GSH, MDA and NOS in the liver (P<0.05 or P<0.01). These suggested that QEF improved the antioxidative system in liver.

Figure 3.

Effect of QEF on liver parameters of D-gal-induced aging mice. (A) QEF increased GSH level. (B) QEF elevated CAT activity. (C) QEF decreased the elevated NO level. (D) QEF reduced the production of MDA. (E) QEF enhanced T-AOC. (F) QEF inhibited the NOS activity. All data are presented as mean ± standard error of the mean. n=10–12/group. *P<0.05, **P<0.01, ***P<0.001 vs. D-gal group. QEF, Qing'E formula; D-gal, D-galactose; L, low dose (1.62 g/kg/day); M, medium dose (3.24 g/kg/day); H, high dose (6.48 g/kg/day); VE, vitamin E; GSH, glutathione; T-AOC, total antioxidant capacity; CAT, catalase; NO, nitric oxide; MDA, malondialdehyde; NOS, NO synthase.

Effect of QEF on the hippocampal parameters

In the hippocampus, D-galactose did not show significant changes in mRNA expression levels of Klotho, SIRT1, FOXO3, PGC-1α, IGF-1 and PRDX-3 (Fig. 4), the genes that are well known to be actively involved in aging process. However, QEF treatment for 8 weeks could elicit significant upregulation of these genes (P<0.05, P<0.01 or P<0.001), which appeared to be in a dose-dependent manner. By contrast, VE treatment only enhanced the gene expression of Klotho (P<0.01). Consistent with its effect on mRNA expression, QEF treatment induced significant expression of Klotho and SIRT1 at protein levels (P<0.05, P<0.01 or P<0.001) (Fig. 5A–C). In terms of PGC-1α, D-galactose induced marked elevation of the protein (P<0.001), the effect of which could be counteracted by QEF treatment (P<0.01 or P<0.001) (Fig. 5D). For VE, it increased Klotho and SIRT1 levels, but reduced the PGC-1α level (P<0.05, P<0.01 or P<0.001). These results implicated that QEF administration improved the aging process in hippocampus.

Figure 4.

Effect of QEF on hippocampal gene expression levels of D-gal-induced aging mice. QEF increased (A) Klotho, (B) SIRT1, (C) FOXO3, (D) PGC-1α, (E) IGF-1 and (F) PRDX-3 mRNA expression levels. All data are presented as mean ± standard error of the mean. n=4–5/group. *P<0.05, **P<0.01, ***P<0.001 vs. D-gal group. QEF, Qing'E formula; D-gal, D-galactose; L, low dose (1.62 g/kg/day); M, medium dose (3.24 g/kg/day); H, high dose (6.48 g/kg/day); VE, vitamin E; SIRT1, sirtuin 1; FOXO3, forkhead box O transcription factor 3; PGC-1α, peroxisome proliferator-activated receptor γ coactivator-1α; IGF-1, insulin-like growth factor-1; PRDX-3, peroxiredoxin-3.

Figure 5.

Effect of QEF on hippocampal protein expressions of D-gal-induced aging mice. (A) Western blot analysis. Gray intensity analysis of (B) Klotho, (C) SIRT1 and (D) PGC-1α. All data are presented as mean ± standard error of the mean. n=4/group. *P<0.05, **P<0.01, ***P<0.001 vs. D-gal group. QEF, Qing'E formula; D-gal, D-galactose; L, low dose (1.62 g/kg/day); M, medium dose (3.24 g/kg/day); H, high dose (6.48 g/kg/day); VE, vitamin E; SIRT1, sirtuin 1; PGC-1α, peroxisome proliferator-activated receptor γ coactivator-1α.

Discussion

In the present study, the effect of QEF on the D-galactose-induced aging mice was evaluated. The results showed that QEF improved motor coordination and memory impairment in aging mice, indicating its potential application as an anti-aging drug.

As aging occurs, the body loses muscle component, resulting in a loss of strength and more easily fatigued muscle (10), which is accompanied with declined learning and memory capability. In the present study, the motor coordination of mice reflecting one aspect of the strength of muscle was evaluated by RRT (11), while the memory of mice was assessed with PAT (12). In the experiments, D-galactose-treated mice showed typical aging symptoms, as evidenced by reduced endurance in RRT and impaired memory in PAT. By contrast, QEF treatment could reverse the deteriorated behavior of mice, suggesting its alleviative effect on motor and memory of aging mice.

The free radical theory is one of the most popular aging theories. According to the theory, accumulated free radicals, such as reactive oxygen species (ROS), damage lipids, DNA, proteins and tissues in organisms (13). Enzymatic antioxidants, such as superoxide dismutase, CAT and GSH peroxidase, and non-enzymatic antioxidants, such as VE and GSH, can neutralize ROS and prevent against further injury. In the present study, QEF administration enhanced antioxidants, including GSH, T-AOC and CAT, in the serum or liver of D-galactose-induced aging mice. As a result, MDA, the product of lipid peroxidation and marker for oxidative stress (14), was reduced. These results demonstrated the regulatory effect of QEF on the unbalanced oxidants in aging mice.

Klotho, or its secreted form, α Klotho, has been demonstrated to function as an anti-aging and organ protection factor by inhibiting signaling of multiple growth factors, such as insulin, IGF-1 and TGF-β (15–17). SIRT1 is a key protein that controls the aging process by the regulation of energy metabolism (18), and has been shown to benefit the health of aging mice (19). FOXO3 is a potent transcriptional activator that triggers the expression levels of numerous genes involved in cell cycle arrest, DNA repair, hypoxia and apoptosis (20). In humans, single-nucleotide polymorphisms of FOXO3 have been shown to be closely associated with longevity (21) and have an important role in ameliorating senescence and aging (22). PRDX-3 is mainly responsible for the detoxification of 90% of the hydrogen peroxide in the mitochondria (23). By contrast, low IGF-1 signaling is closely associated with improved longevity (24). As aforementioned, QEF improved impaired memory of D-galactose-treated mice, therefore, the expression levels of these genes or their products in hippocampus were investigated. The present results suggested that QEF alleviated memory impairment was associated with balancing the expression levels of longevity-related genes at mRNA or protein levels.

Blood BUN and CREA are the common indicators for kidney health, while ALT and AST are the common parameters for the evaluation of liver health. In the present study, chronic D-galactose administration was shown to increase all the serum parameters significantly. By contrast, QEF treatment could efficiently prevent against the elevation of BUN, CREA, ALT and AST, implicating a protective effect on the liver and kidney. However, its mechanism remains to be elucidated at the current stage and requires further investigation.

In conclusion, QEF counteracted the accelerated aging process induced by D-galactose in mice, which may be due to its effects on enhancing antioxidants, protecting renal and hepatic health, and balancing hippocampal expression levels of the longevity-related genes.

Acknowledgements

The present study was supported by Shanghai Eastern Scholar Program (grant no. 2013-59), Shanghai Three-Year Plan in Advancing Traditional Medicine (grant no. ZYSNXD-GH-FFYJ) and Shanghai E-research Institute of Bioactive Constituent in TCM plan.

Glossary

Abbreviations

Abbreviations:

QEF

Qing'E formula

D-gal

D-galactose

GSH

glutathione

CAT

catalase

T-AOC

total antioxidant capacity

MDA

malondialdehyde

NO

nitric oxide

NOS

nitric oxide synthase

BUN

urea nitrogen

CREA

creatinine

ALT

alanine aminotransferase

AST

aspartate aminotransferase

SIRT1

sirtuin 1

FOXO3

forkhead box O transcription factor 3

PGC-1α

peroxisome proliferator-activated receptor γ coactivator-1α

IGF-1

insulin-like growth factor-1

PRDX-3

peroxiredoxin-3

References

1. 

Jin K: Modern biological theories of aging. Aging Dis. 1:72–74. 2010.PubMed/NCBI

2. 

Lipsky MS and King M: Biological theories of aging. Dis Mon. 61:460–466. 2015. View Article : Google Scholar : PubMed/NCBI

3. 

Ho SC, Liu JH and Wu RY: Establishment of the mimetic aging effect in mice caused by D-galactose. Biogerontology. 4:15–18. 2003. View Article : Google Scholar : PubMed/NCBI

4. 

Cui X, Wang L, Zuo P, Han Z, Fang Z, Li W and Liu J: D-galactose-caused life shortening in Drosophila melanogaster and Musca domestica is associated with oxidative stress. Biogerontology. 5:317–325. 2004. View Article : Google Scholar : PubMed/NCBI

5. 

National Pharmacopoeia Committee: Chinese Pharmacopoeia. Beijing: Chemical Industry Press. 2010.

6. 

Yang YP, Shuai B, Shen L, Xu XJ, Ma C and Lv L: Effect of Qing'e formula on circulating sclerostin levels in patients with postmenopausal osteoporosis. J Huazhong Univ Sci Technolog Med Sci. 35:525–530. 2015. View Article : Google Scholar : PubMed/NCBI

7. 

Xia Y, Zhao Y, Ren M, Zhang J, Wang Y, Chang Y, Fu S, Fan G, Zhu Y, Huang Y, et al: A randomized double-blind placebo-controlled trial of a Chinese herbal medicine preparation (Jiawei Qing'e Fang) for hot flashes and quality of life in perimenopausal women. Menopause. 19:234–244. 2012. View Article : Google Scholar : PubMed/NCBI

8. 

Xu Y, Zhang ZJ, Geng F, Su SB, White KN, Bligh SW, Branford-White CJ and Wang ZT: Treatment with Qing'E, a kidney-invigorating Chinese herbal formula, antagonizes the estrogen decline in ovariectomized mice. Rejuvenation Res. 13:479–488. 2010. View Article : Google Scholar : PubMed/NCBI

9. 

Huang F, Wang T, Lan Y, Yang L, Pan W, Zhu Y, Lv B, Wei Y, Shi H, Wu H, et al: Deletion of mouse FXR gene disturbs multiple neurotransmitter systems and alters neurobehavior. Front Behav Neurosci. 9:702015. View Article : Google Scholar : PubMed/NCBI

10. 

Kim S, Kang IH, Nam JB, Cho Y, Chung DY, Kim SH, Kim JS, Cho YD, Hong EK, Sohn NW, et al: Ameliorating the effect of astragaloside IV on learning and memory deficit after chronic cerebral hypoperfusion in rats. Molecules. 20:1904–1921. 2015. View Article : Google Scholar : PubMed/NCBI

11. 

Jansen EM and Low WC: Long-term effects of neonatal ischemic-hypoxic brain injury on sensorimotor and locomotor tasks in rats. Behav Brain Res. 78:189–194. 1996. View Article : Google Scholar : PubMed/NCBI

12. 

Karimi S, Hejazian SH, Alikhani V and Hosseini M: The effects of tamoxifen on spatial and nonspatial learning and memory impairments induced by scopolamine and the brain tissues oxidative damage in ovariectomized rats. Adv Biomed Res. 4:1962015.PubMed/NCBI

13. 

Harman D: The free radical theory of aging. Antioxid Redox Signal. 5:557–561. 2003. View Article : Google Scholar : PubMed/NCBI

14. 

Uzar E, Koyuncuoglu HR, Uz E, Yilmaz HR, Kutluhan S, Kilbas S and Gultekin F: The activities of antioxidant enzymes and the level of malondialdehyde in cerebellum of rats subjected to methotrexate: Protective effect of caffeic acid phenethyl ester. Mol Cell Biochem. 291:63–68. 2006. View Article : Google Scholar : PubMed/NCBI

15. 

Kurosu H, Yamamoto M, Clark JD, Pastor JV, Nandi A, Gurnani P, McGuinness OP, Chikuda H, Yamaguchi M, Kawaguchi H, et al: Suppression of aging in mice by the hormone Klotho. Science. 309:1829–1833. 2005. View Article : Google Scholar : PubMed/NCBI

16. 

Yahata K, Mori K, Arai H, Koide S, Ogawa Y, Mukoyama M, Sugawara A, Ozaki S, Tanaka I, Nabeshima Y, et al: Molecular cloning and expression of a novel klotho-related protein. J Mol Med Berl. 78:389–394. 2000. View Article : Google Scholar : PubMed/NCBI

17. 

Fon Tacer K, Bookout AL, Ding X, Kurosu H, John GB, Wang L, Goetz R, Mohammadi M, Kuro-o M, Mangelsdorf DJ, et al: Research resource: Comprehensive expression atlas of the fibroblast growth factor system in adult mouse. Mol Endocrinol. 24:2050–2064. 2010. View Article : Google Scholar : PubMed/NCBI

18. 

Wu H, Wang H, Zhang W, Wei X, Zhao J, Yan P and Liu C: rhEPO affects apoptosis in hippocampus of aging rats by upregulating SIRT1. Int J Clin Exp Pathol. 8:6870–6880. 2015.PubMed/NCBI

19. 

Crandall JP and Barzilai N: Exploring the promise of resveratrol: Where do we go from here? Diabetes. 62:1022–1023. 2013. View Article : Google Scholar : PubMed/NCBI

20. 

Renault VM, Thekkat PU, Hoang KL, White JL, Brady CA, Kenzelmann Broz D, Venturelli OS, Johnson TM, Oskoui PR, Xuan Z, et al: The pro-longevity gene FoxO3 is a direct target of the p53 tumor suppressor. Oncogene. 30:3207–3221. 2011. View Article : Google Scholar : PubMed/NCBI

21. 

Anselmi CV, Malovini A, Roncarati R, Novelli V, Villa F, Condorelli G, Bellazzi R and Puca AA: Association of the FOXO3A locus with extreme longevity in a southern Italian centenarian study. Rejuvenation Res. 12:95–104. 2009. View Article : Google Scholar : PubMed/NCBI

22. 

Xiong S, Patrushev N, Forouzandeh F, Hilenski L and Alexander RW: PGC-1α Modulates Telomere Function and DNA Damage in Protecting against Aging-Related Chronic Diseases. Cell Reports. 12:1391–1399. 2015. View Article : Google Scholar : PubMed/NCBI

23. 

Cox AG, Winterbourn CC and Hampton MB: Mitochondrial peroxiredoxin involvement in antioxidant defence and redox signalling. Biochem J. 425:313–325. 2009. View Article : Google Scholar : PubMed/NCBI

24. 

Huffman DM, Farias Quipildor G, Mao K, Zhang X, Wan J, Apontes P, Cohen P and Barzilai N: Central insulin-like growth factor-1 (IGF-1) restores whole-body insulin action in a model of age-related insulin resistance and IGF-1 decline. Aging Cell. 15:181–186. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhong L, Huang F, Shi H, Wu H, Zhang B, Wu X, Wei X and Wang Z: Qing'E formula alleviates the aging process in D-galactose-induced aging mice. Biomed Rep 5: 101-106, 2016.
APA
Zhong, L., Huang, F., Shi, H., Wu, H., Zhang, B., Wu, X. ... Wang, Z. (2016). Qing'E formula alleviates the aging process in D-galactose-induced aging mice. Biomedical Reports, 5, 101-106. https://doi.org/10.3892/br.2016.667
MLA
Zhong, L., Huang, F., Shi, H., Wu, H., Zhang, B., Wu, X., Wei, X., Wang, Z."Qing'E formula alleviates the aging process in D-galactose-induced aging mice". Biomedical Reports 5.1 (2016): 101-106.
Chicago
Zhong, L., Huang, F., Shi, H., Wu, H., Zhang, B., Wu, X., Wei, X., Wang, Z."Qing'E formula alleviates the aging process in D-galactose-induced aging mice". Biomedical Reports 5, no. 1 (2016): 101-106. https://doi.org/10.3892/br.2016.667
Copy and paste a formatted citation
x
Spandidos Publications style
Zhong L, Huang F, Shi H, Wu H, Zhang B, Wu X, Wei X and Wang Z: Qing'E formula alleviates the aging process in D-galactose-induced aging mice. Biomed Rep 5: 101-106, 2016.
APA
Zhong, L., Huang, F., Shi, H., Wu, H., Zhang, B., Wu, X. ... Wang, Z. (2016). Qing'E formula alleviates the aging process in D-galactose-induced aging mice. Biomedical Reports, 5, 101-106. https://doi.org/10.3892/br.2016.667
MLA
Zhong, L., Huang, F., Shi, H., Wu, H., Zhang, B., Wu, X., Wei, X., Wang, Z."Qing'E formula alleviates the aging process in D-galactose-induced aging mice". Biomedical Reports 5.1 (2016): 101-106.
Chicago
Zhong, L., Huang, F., Shi, H., Wu, H., Zhang, B., Wu, X., Wei, X., Wang, Z."Qing'E formula alleviates the aging process in D-galactose-induced aging mice". Biomedical Reports 5, no. 1 (2016): 101-106. https://doi.org/10.3892/br.2016.667
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team