Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
December-2016 Volume 5 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2016 Volume 5 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Dysregulated circulating miRNAs in preeclampsia

  • Authors:
    • Carine Munaut
    • Linda Tebache
    • Silvia Blacher
    • Agnès Noël
    • Michelle Nisolle
    • Frédéric Chantraine
  • View Affiliations / Copyright

    Affiliations: Laboratory of Tumor and Development Biology, GIGA‑R, University of Liège, B‑4000 Liège, Belgium, Department of Obstetrics and Gynecology, University of Liège, Hôpital de la Citadelle, B‑4000 Liège, Belgium
  • Pages: 686-692
    |
    Published online on: October 14, 2016
       https://doi.org/10.3892/br.2016.779
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Preeclampsia (PE) is a pregnancy-related disease with potentially severe consequences with respect to foeto-maternal morbidity and mortality. However, the molecular pathogenesis of PE remains largely unknown. Recent reports have shown that microRNAs (miRNAs or miRs) may play important roles in the development of PE. Analysing the miRNAs in sera from preeclamptic women may improve our understanding of the pathophysiological mechanisms of the disease. The aim of this retrospective study was to identify whether circulating miRNAs were differentially expressed in PE patients compared with controls. Serum samples from 23 women who developed PE were compared with samples from 44 pregnant controls. Seventeen circulating miRNAs previously described in PE were chosen for evaluation of their expression by reverse transcription quantitative polymerase chain reaction (RT‑qPCR). In the maternal serum, the miR‑210‑3p, miR‑210‑5p, miR‑1233‑3p, and miR‑574‑5p levels were found to be significantly higher in the PE patients than in the controls (P<0.05). Using a logistic regression model, we evaluated the discriminant power of those differentially expressed miRNAs, and the combination of miR‑210‑5p and miR‑574‑5p yielded an area under the curve of 0.7223 for discriminating PE patients from the controls. In conclusion, the fact that four circulating miRNAs (miR‑210‑3p, miR‑210‑5p, miR‑1233‑3p, and miR‑574‑5p) were differentially expressed in the sera of women who developed PE compared with controls confirms the possible pathophysiological role of miRNAs in PE.

Introduction

Preeclampsia (PE) is a pregnancy-specific syndrome associated with hypertension and proteinuria or thrombocytopenia, renal insufficiency, impaired liver function, pulmonary oedema, cerebral symptoms, and visual symptoms (1). PE affects 2–5% of pregnancies worldwide (2–4). It can lead to severe maternal and perinatal morbidity, including uterine growth restriction and prematurity. PE is responsible for an elevated perinatal mortality rate and causes 10–15% of maternal deaths (3,5).

The placenta plays a key role in the initiation and progression of the disorders caused by PE (6). As commonly described, PE has a combined genetic, immune, and angiogenic aetiology. The origin of PE seems to be the impaired invasion of maternal spiral arteries by trophoblast cells in the context of local abnormal immune interactions between the fetoplacental unit and mother (7–9). Placental underperfusion induces a chronic hypoxic state (10). Combined with the reoxygenation that occurs, it creates increased local oxidative stress, resulting in apoptosis and necrosis of the placenta. Placental pro-inflammatory and antiangiogenic mediators and apoptotic bodies, released in the maternal circulation, cause maternal systemic endothelial cell dysfunction and systemic inflammation (5,11). Although several hypotheses have been suggested to explain this vascular, multi-systemic pregnancy-related disease, its complete pathogenesis remains poorly understood (12,13), and PE prevention, diagnosis, and treatment remain an important challenge.

MicroRNAs (miRNAs or miRs) are small non-coding RNAs (20–24 nucleotides) that regulate gene expression through post-transcriptional repression or degradation of messenger RNA (14,15). miRNAs are present in animals and plants and have been detected in several human fluids (16). They are critical in many biological processes, including the regulation of cell differentiation, proliferation, apoptosis, angiogenesis, and metabolism (17). Specific plasma-related miRNAs were identified in maternal plasma or serum in normal pregnancies, as well as in pathological pregnancy conditions, such as PE (18,19). Several recent reports described the significant dysregulation of specific miRNA expression in the maternal circulation of PE patients compared with controls (miR-24, miR-26a, miR-29a, miR-103, miR-130b, miR-141, miR-144, miR-152, miR-181a, miR-210, miR-342-3p, miR-520, miR-574-5p, and miR-1233) (20–23).

We hypothesized that the expression levels of specific miRNAs in maternal blood could be dysregulated before the onset of PE and be used to enhance screening, diagnosis, or prognosis. We aimed to analyse, in a case-control study, several miRNAs that were previously described as differentially expressed in PE.

Materials and methods

miRNA selection

After performing a review on PubMed until 26 February, 2015, using the key words, ‘miRNA, pregnancies, preeclampsia, placenta, circulating’, and consulting the miRNA database, 17 miRNAs were selected (Table I).

Table I.

Primers used in quantitative PCR.

Table I.

Primers used in quantitative PCR.

miRNAmiRBaseReference QiagenSequence of primer (5′-3′)
hsa-miR-144-3pMIMAT0000436MS00020328 TACAGTATAGATGATGTACT
hsa-miR-29a-3pMIMAT0000086MS00003262 TAGCACCATCTGAAATCGGTTA
hsa-miR-210-3pMIMAT0000267MS00003801 CTGTGCGTGTGACAGCGGCTGA
hsa-miR-210-5pMIMAT0026475MS00045836 AGCCCCTGCCCACCGCACACTG
hsa-miR-1233-3pMIMAT0005588MS00008512 TGAGCCCTGTCCTCCCGCAG
hsa-miR-1233-5pMIMAT0022943MS00045213 AGTGGGAGGCCAGGGCACGGCA
hsa-miR-24-3pMIMAT0000080MS00006552 TGGCTCAGTTCAGCAGGAACAG
hsa-miR-26a-5pMIMAT0000082MS00029239 TTCAAGTAATCCAGGATAGGCT
hsa-miR-130b-3pMIMAT0000691MS00003451 CAGTGCAATGATGAAAGGGCAT
hsa-miR-130b-5pMIMAT0004680MS00008610 ACTCTTTCCCTGTTGCACTAC
hsa-miR-181a-5pMIMAT0000256MS00008827 AACATTCAACGCTGTCGGTGAGT
hsa-miR-181a-3pMIMAT0000270MS00006692 ACCATCGACCGTTGATTGTACC
hsa-miR-342-3pMIMAT0000753MS00004011 TCTCACACAGAAATCGCACCCGT
hsa-miR-574-5pMIMAT0004795MS00043617 TGAGTGTGTGTGTGTGAGTGTGT
hsa-miR-16-2-3pMIMAT0004518MS00008813 CCAATATTACTGTGCTGCTTTA
hsa-miR-124-3pMIMAT0000422MS00006622 TAAGGCACGCGGTGAATGCC
hsa-miR-155-5pMIMAT0000646MS00031486 TTAATGCTAATCGTGATAGGGGT
c-miR-39MIMAT0000010MS00019789 TCACCGGGTGTAAATCAGCTTG
RNU6-2 MS00033740

[i] RNU6, U6 small nuclear RNA; hsa, Homo sapiens; c, Caenorhabditis elegans.

Study population

In this retrospective study, 67 pregnant women, aged 19–44 years, with a gestational age of 24–36 weeks and 6 days of amenorrhea, were selected among a prospective cohort of pregnant women presenting, at 24 to <37 weeks' gestation, clinical suspicion of, but not manifesting preeclampsia/eclampsia/HELLP syndrome. Suspicion of PE was assessed on the basis of the following criteria: New elevation of blood pressure (<140/90 mmHg), with or without pre-existing essential hypertension; de novo or major proteinuria (<30 mg/dl or <2+ on a urine dipstick); and clinical (epigastric pain, headache, visual disturbances, and excessive weight gain), biological (thrombocytopenia or elevation of transaminases), and ultrasonic (intrauterine growth restriction, elevation of the uterine artery pulsatility index, or uterine artery notch) characteristics favouring PE. Manifestation of PE at selection was an exclusion criterion.

In each patient presenting with the aforementioned signs and symptoms who agreed to participate, blood was collected and further pregnancy follow-up was performed. Retrospectively, the PE and control cohorts were defined based on the diagnosis of PE at delivery.

The present study was approved by the Ethics Committee of the CHR Citadelle Hospital, Liège, Belgium, and informed consent was obtained from all the patients.

Sample collection

Blood samples were immediately centrifuged at 1,000 × g for 15 min, and sediment-free serum samples were collected. The serum aliquots were frozen at −80°C until further analysis and were thawed only once thereafter.

miRNA extraction

Total RNA, including miRNA, was extracted from 200 µl of serum using the miRNeasy Serum/Plasma kit (Qiagen; Hilden, Germany) according to the manufacturer's instructions, and it was then eluted in 30 µl of nuclease-free water. A synthetic spike-in control miRNA (C. elegans miR-39 mimic, Qiagen) was added for subsequent normalisation.

Quantitative polymerase chain reaction (qPCR) for miRNAs

Total miRNA (2 µl) from each sample was reverse-transcribed with the miScript II TR kit (Qiagen) according to the manufacturer's instructions. The miRNAs were subsequently quantified using the miScript SYBR-Green PCR kit (Qiagen) and specific forward primers. The reaction mixture included 2.5 µl of cDNA, 12.5 µl of QuantiTect SYBR-Green PCR Master Mix (Qiagen), 2.5 µl of forward primer, 2.5 µl of miScript Universal Primer (Qiagen), and 5 µl of RNase-free water for a final reaction volume of 25 µl. The thermal cycling consisted of an initial denaturation at 95°C for 15 min, followed by 45 cycles at 95°C for 15 sec, 55°C for 30 sec, and 70°C for 30 sec.

The reactions were run in duplicate. Threshold cycle (Cq) and melting curves were acquired using the quantification and melting curve programs of the LightCycler® 96 Real-Time System (Roche Diagnostics GmbH, Mannheim, Germany). U6 small nuclear RNA (RNU6) and c-miR-39 were used to determine relative miRNA expression with the 2-ΔCq method (24–26). The miRNA-specific primer sequences are listed in Table I.

Statistical analysis

Quantitative parameters are presented as the means ± standard errors or medians. The statistical significance of differences in the expression levels of serum miRNAs between PE patients and controls was determined by the non-parametric Mann-Whitney U-Wilcoxon test. To determine the diagnostic accuracy of the miRNA expression levels, we generated receiver operating characteristic (ROC) curves and calculated the area under the ROC curves (AUC) (27). An evaluation of the diagnostic power of multiple combinations of the miRNA serum levels was performed using a logistic regression model. For all the statistical analyses, we used the statistics toolbox of Matlab R2024a software (MathWorks Inc., Natick, MA, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Clinical characteristics

Table II shows the main features of the patients in each group. The median of gestational ages at inclusion (min-max) of the pregnant women were 32.1 (25.3–36.6) (PE patients) and 31.1 (24.3–36.5) weeks (controls). There were no significant differences between the subjects and controls with respect to gestational age, maternal age, body mass index, smoking status, parity, gestity, ethnicity, personal and family history of PE, previous hypertension, proteinuria, and mean uterine artery pulsatility index. The median of gestational ages (min-max) at delivery were 36.4 (30.0–39.3) (PE patients) and 39.1 (35.2–41.3) weeks (controls) (P<0.0001).

Table II.

Demographic and clinical characteristics of controls and preeclamptic (PE) pregnancies.

Table II.

Demographic and clinical characteristics of controls and preeclamptic (PE) pregnancies.

CharacteristicsControls (n=44)PE (n=23)P-value
Maternal age (years)30 (19–38)29 (19–44)0.82701
Gestational age at inclusion (weeks)31.1 (24.3–36.5)32.1 (25.3–36.6)0.51313
Gestational age at delivery (weeks)39.1 (35.2–41.3)36.4 (30.0–39.3)<0.0001
Body mass index27.2 (16.1–39.30)27.40 (19–41.5)0.85331
Gestity2 (1–6)2 (1–7)0.19814
Parity1 (0–5)0 (0–3)0.13570
Smoking status
  Previous smokers6 (13.6%)3 (13%)0.66976
  Smokers4 (9%)3 (13%)
Previous HTA3 (6.8%)2 (8.7%)0.79403
Family history of PE7 (16%)6 (26%)0.31431
Proteinuria36 (81.8%)19 (82.6%)0.68365
Mean artery pulsatility index0.77 (0.36–1.50)0.86 (0.37–1.88)0.27001
Systolic blood pressure (mmHg)129 (105–160)134 (120–159)0.01763
Diastolic blood pressure (mmHg)80 (60–100)85 (70–100)0.01551

[i] Values are presented as median (min-max) or numbers (percentage). Statistical analyses were performed by the Mann-Whitney U-Wilcoxon test.

Differential expression of circulating miRNAs

The expression levels of the 17 miRNAs (miR-16-2-3p, miR-24-3p, miR-26a-5p, miR-29a-3p, miR-124-3p, miR-130b-5p miR-130b-3p, miR-144-3p, miR-155-5p, miR-181a-3p, miR-181a-5p, miR-210-3p, miR-210-5p, miR-342-3p, miR-574-5p, miR-1233-3p, and miR-1233-5p) from the serum samples in the two groups (PE patients and controls) were analysed with reverse transcription quantitative polymerase chain reaction (RT-qPCR). According to RT-qPCR analysis, there was a significant upregulation of 4 miRNAs: miR-210-3p, miR-210-5p, miR-1233-3p, and miR-574-5p, in the serum of PE patients compared with controls (P<0.05) (Table III, Fig. 1).

Figure 1.

miRNAs differentially expressed in the sera of control pregnant women (NP) and preeclamptic women (PE). The expression of levels of miR-210-3p, miR-210-5p, miR-1233-3p and miR-574-5p were higher in preeclamptic women. Data are presented by box-and-whisker plots. Boxes indicate the 25th and 75th percentiles. The solid line within the box indicates the median value. *P<0.05 and **P<0.001.

Table III.

Circulating miRNA expression levels in controls and preeclamptic pregnancies.

Table III.

Circulating miRNA expression levels in controls and preeclamptic pregnancies.

miRNAControls (n=44)PE (n=23)P-value (Wilcoxon)
miR-210-3p2.25±0.514.10±1.300.005
miR-210-5p5.46±1.789.18±2.000.006
miR-1233-3p3.73±0.964.97±0.980.021
miR-574-5p2.47±0.595.84±1.300.005
miR-144-3p2.47±0.493.56±1.050.187
miR-29a-3p2.84±0.462.85±0.300.129
miR-1233-5p3.23±0.862.91±0.420.129
miR-24-1-3p2.99±0.463.15±0.350.088
miR-26a-5p2.63±0.362.41±0.330.736
miR-130b-3p3.55±0.693.22±0.400.352
miR-130b-5p14.39±0.874.92±0.920.113
miR-181a-5p2.04±0.272.27±0.320.222
miR-181a-3p2.63±1.172.28±0.610.113
miR-342-3p3.06±0.393.18±0.340.282
miR-16-2-3p2.14±0.363.27±0.900.124
miR-124-3p3.51±0.722.97±0.350.362
miR-155-5p3.58±0.623.76±0.650.402
Assessment of the screening value of circulating miRNAs in PE

We constructed and examined the ROC curves of the 4 miRNAs that were upregulated in PE serum to evaluate their potential utility as biomarkers (Fig. 2). The AUCs of miR-210-3p, miR-210-5p, miR-1233-3p, and miR-574-5p were 0.7090 [95% confidence interval (CI), 0.582–0.836], 0.7040 (95% CI, 0.568–0.840), 0.673 (95% CI, 0.543–0.803), and 0.710 (95% CI, 0.578–0.842), respectively (Table IV). To improve the diagnostic power of the miRNA expression levels, we applied a logistic regression model to the data from PE patients and controls. Different combinations were added to the model, and a maximum AUC of 0.7223 was found for miR-210-5p and miR-574-5p (Fig. 3). The fitted logistic regression model is as follows:

Figure 2.

Receiver operating characteristic (ROC) curves of different microRNAs.

Figure 3.

Receiver operating characteristic (ROC) curves of combined microRNAs. Logistic regression model.

Table IV.

ROC results for several miRs.

Table IV.

ROC results for several miRs.

miRsArea under the ROC curve (SE)95% CIP-value
miR-210-3p0.7090 (0.06496)0.5816–0.83630.005
miR-210-5p0.7041 (0.06918)0.5684–0.83970.006
miR-1233-3p0.6729 (0.06632)0.5429–0.80290.021
miR-574-5p0.7100 (0.06717)0.5783–0.84170.005

[i] CI, confidence interval; SE, standard error; miRs, microRNAs.

logitP(Y=1)1–P(Y=1)=–1.3036+0.05773*miR210–5p+0.1279*miR574–5p

where P(Y=1) is the probability that the sample is a preeclamptic sample.

Discussion

Recently, the aberrant expression of miRNAs has been documented in different pregnancy-related conditions, such as PE, ectopic pregnancy, gestational diabetes mellitus, small for gestational age, recurrent pregnancy loss, and preterm delivery (28). These findings may be useful to improve our understanding of the underlying pathophysiology of these conditions.

In the present study, we confirmed the differential expression of several miRNAs that were identified in previous studies (20–23). Of the 17 miRNAs selected, miR-210-3p, miR-210-5p, miR-1233-3p, and miR-574-5p were upregulated in the sera of women who later developed PE compared with the controls who did not develop PE according to RT-qPCR. By performing logistic regression analysis of the differentially expressed miRNAs, we found that the combination of miR-210-5p and miR-574-5p had the best diagnostic power with an AUC of 0.7223.

In our selection of miRNAs based on the data published in previous studies, we found very little overlap between the reported studies. This may be due to differences in the sample collection (sera versus plasma) or methods used for the analyses (RT-qPCR versus microarrays). Even results obtained from the same platform using products from different companies may be responsible for this low correlation of results (29,30). RT-qPCR is often considered as the ‘gold standard’ for the detection and quantification of gene expression. As a result, we chose to validate previously identified miRNA results using this procedure. However, one important step of RT-qPCR is normalisation of the miRNA expression level. Using improper reference genes for normalisation can result in evaluation bias during data analysis. To the best of our knowledge, there has been no consensus regarding a reliable housekeeping miRNA for analysing circulating miRNAs. Therefore, it becomes difficult to directly compare the results from different studies. In the present study, we used a double normalisation procedure, including the use of the synthetic c-miR-39 and RNU6B. The same amount of c-miR-39 was added to each sample before the extraction procedure, and the c-miR-39 expression level reflected differences at the same time in the extraction, reverse transcription, and PCR amplification procedures (31). However, the use of RNU6B complements technical bias with biological bias. Although RNU6B does not necessarily represent the ‘best’ reference, it has been previously used to analyse miRNAs in the sera of preeclamptic women (23,32).

The selection of the patients included in different studies may also introduce some bias. To identify new biomarkers for PE, a common strategy is to analyse a few samples or a pool of samples when performing miRNA profiling. This step is further followed by a validation procedure, frequently RT-qPCR, with additional samples from PE cases and controls. Usually, the second step does not completely validate the profiling step (18,20,21). Thus, in order to evaluate previously differentially reported miRNAs in PE, we performed a case-control study with 23 PE patients and 44 controls. The two groups were found to be comparable with respect to their maternal age, gestational age at inclusion, gestity, and parity. However, the retrospective nature of the investigation was one limitation of the study. A second limitation is that we were unable to separately analyse early- and late-onset PE due to the small sample size.

There is currently no consensus regarding a set of differentially expressed miRNAs in PE that may be used as biomarkers. Our approach was to collect several potentially interesting miRNAs that were previously described in the literature and test them in our set of case-control samples.

Notably, miR-210, which is one of the more commonly recurring miRNAs overexpressed in PE (22,32–36), was also elevated in our PE cohort. This particular miR-210 has been identified as a hypoxia-induced miRNA in many cell types and tissues and is consistently upregulated by hypoxia in both physiological and malignant conditions (37,38). Several target genes with roles in mitochondrial metabolism, angiogenesis, and DNA repair have been identified, and most of them may be involved in the pathogenesis of PE. However, it remains unclear whether the differential expression of miR-210 is the consequence or origin of PE even though this particular miRNA has been described as a serum biomarker for PE (32).

There was also a higher level of circulating miR-1233 in the group of women who developed PE compared with the group of women with a normal pregnancy. Our results confirmed those of Ura et al (23), who were the first researchers to identify a potential role for miR-1233, which has already been described in renal carcinoma, in predicting PE. It is important to note that both miR-1233 and miR-210, which are upregulated in PE, are also upregulated in renal cell carcinoma. Of note, in patients with renal cell carcinoma, only miR-1233 was found to be increased (39). Information on the function of miR-1233, located on chromosome 15q14, is incomplete. Several potential target genes have been predicted using TargetScan 6.0 (40), but they have not been validated. The expression level of miR-574-5p was also elevated in the blood of women with PE (21). However, the expression of miR-574-5p has been poorly investigated.

Although there are many studies on PE screening, a biologically predictive and prognostic test with high accuracy for routine clinical use has yet to be identified (41–43). The most promising strategies are multiparametric approaches that include a combination of maternal factors, biophysical tests (mean blood pressure, uterine artery Doppler), and biochemical markers (44–50). Sequential multiparametric testing is superior to screening in the first trimester alone (51). Nevertheless, a panel of tests is necessary to effectively identify women early in pregnancy who are at the highest risk for developing PE.

Although the prevalence of PE is relatively low and miRNA analysis is technically challenging, further studies with larger cohorts are mandatory. Discriminating between the different phenotypes of PE is also important because they may involve different sets of miRNA expression.

Furthermore, patients were sampled before the onset of PE and delivery (mean:one month before). Indeed, cases were enrolled when there was suspicion of PE, but manifest PE was an exclusion criterion. This protocol may partially explain the reason for only 4 of the 17 selected miRNAs being significantly upregulated.

The fact that four circulating miRNAs (miR-210-3p, miR-210-5p, miR-1233-3p, and miR-574-5p) were differentially expressed in the sera of women who later developed PE compared with women who did not develop PE, confirms the possible pathophysiological role of miRNAs in PE, as previously suggested (19,52,53). Particularly, exploring the role of miR-1233 and miR-574 in PE could enrich our understanding of this disease.

Future research on the biological pathway of circulating miRNAs may enhance our understanding of the pathogenesis of PE and aid in the development of new biomarkers for clinical application. Using these miRNAs in a multiparametric test may also provide a new clinical strategy for identifying women who are at risk for developing PE.

Acknowledgements

The authors acknowledge Nathalie Lefin and Sophie Kessler for their excellent technical assistance. C.M. is a Research Associate from the Fonds de la Recherche Scientifique-FNRS (F.R.S.-FNRS, Belgium). This study was supported by grants from the Fonds de la Recherche Scientifique-FNRS (F.R.S.-FNRS, Belgium), the Fonds spéciaux de la Recherche (University of Liège), the Fonds Léon Fredericq (University of Liège), the Direction Générale Opérationnelle de l'Economie, de l'Emploi et de la Recherche from the S.P.W. (Région Wallonne, Belgium).

Glossary

Abbreviation

Abbreviations:

PE

preeclampsia

References

1 

American College6 of Obstetricians and Gynecologists, . Task Force on Hypertension in Pregnancy: Hypertension in pregnancy. Report of the American College of Obstetricians and Gynecologists' Task Force on Hypertension in Pregnancy. Obstet Gynecol. 122:1122–1131. 2013.PubMed/NCBI

2 

Redman CW and Sargent IL: Latest advances in understanding preeclampsia. Science. 308:1592–1594. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Duley L: The global impact of pre-eclampsia and eclampsia. Semin Perinatol. 33:130–137. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Report of the National High Blood Pressure Education Program Working Group on High Blood Pressure in Pregnancy. Am J Obstet Gynecol. 183:S1–S22. 2000. View Article : Google Scholar

5 

Sibai B, Dekker G and Kupferminc M: Pre-eclampsia. Lancet. 365:785–799. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Huppertz B: Placental origins of preeclampsia: Challenging the current hypothesis. Hypertension. 51:970–975. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Foidart JM, Noël A, Chantraine F, Lorquet S, Petit P, Munaut C, Berndt S, Pequeux C and Schaaps JP: Defective placental implantation and its effects on maternal endothelial function. Bull Acad Natl Med. 193:1059–1064; discussion 1064–1066, 1067–1068. 2009.(In French). PubMed/NCBI

8 

Foidart JM, Schaaps JP, Chantraine F, Munaut C and Lorquet S: Dysregulation of anti-angiogenic agents (sFlt-1, PLGF, and sEndoglin) in preeclampsia-a step forward but not the definitive answer. J Reprod Immunol. 82:106–111. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Redman CW, Sargent IL and Staff AC: IFPA Senior Award Lecture: Making sense of pre-eclampsia - two placental causes of preeclampsia? Placenta. 35:S20–S25. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Munaut C, Lorquet S, Pequeux C, Blacher S, Berndt S, Frankenne F and Foidart JM: Hypoxia is responsible for soluble vascular endothelial growth factor receptor-1 (VEGFR-1) but not for soluble endoglin induction in villous trophoblast. Hum Reprod. 23:1407–1415. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Roberts JM and Hubel CA: The two stage model of preeclampsia: Variations on the theme. Placenta. 30:(Suppl A). S32–S37. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Redman CW and Sargent IL: Immunology of pre-eclampsia. Am J Reprod Immunol. 63:534–543. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Dechend R and Staff AC: Placenta messages to the mother: Not just debris. Hypertension. 59:191–193. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Bartel DP: MicroRNAs: Target recognition and regulatory functions. Cell. 136:215–233. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Lai EC: Micro RNAs are complementary to 3 UTR sequence motifs that mediate negative post-transcriptional regulation. Nat Genet. 30:363–364. 2002. View Article : Google Scholar : PubMed/NCBI

16 

Weber JA, Baxter DH, Zhang S, Huang DY, Huang KH, Lee MJ, Galas DJ and Wang K: The microRNA spectrum in 12 body fluids. Clin Chem. 56:1733–1741. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Ong SG, Lee WH, Kodo K and Wu JC: MicroRNA-mediated regulation of differentiation and trans-differentiation in stem cells. Adv Drug Deliv Rev. 88:3–15. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Miura K, Miura S, Yamasaki K, Higashijima A, Kinoshita A, Yoshiura K and Masuzaki H: Identification of pregnancy-associated microRNAs in maternal plasma. Clin Chem. 56:1767–1771. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Tsochandaridis M, Nasca L, Toga C and Levy-Mozziconacci A: Circulating microRNAs as clinical biomarkers in the predictions of pregnancy complications. BioMed Res Int. 2015:2949542015. View Article : Google Scholar : PubMed/NCBI

20 

Li H, Ge Q, Guo L and Lu Z: Maternal plasma miRNAs expression in preeclamptic pregnancies. Biomed Res Int. 2013:9702652013.PubMed/NCBI

21 

Wu L, Zhou H, Lin H, Qi J, Zhu C, Gao Z and Wang H: Circulating microRNAs are elevated in plasma from severe preeclamptic pregnancies. Reproduction. 143:389–397. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Gunel T, Zeybek YG, Akçakaya P, Kalelioğlu I, Benian A, Ermis H and Aydınlı K: Serum microRNA expression in pregnancies with preeclampsia. Genet Mol Res. 10:4034–4040. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Ura B, Feriotto G, Monasta L, Bilel S, Zweyer M and Celeghini C: Potential role of circulating microRNAs as early markers of preeclampsia. Taiwan J Obstet Gynecol. 53:232–234. 2014. View Article : Google Scholar : PubMed/NCBI

24 

Zhang Y, Jia Y, Zheng R, Guo Y, Wang Y, Guo H, Fei M and Sun S: Plasma microRNA-122 as a biomarker for viral-, alcohol-, and chemical-related hepatic diseases. Clin Chem. 56:1830–1838. 2010. View Article : Google Scholar : PubMed/NCBI

25 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Kok MG, Halliani A, Moerland PD, Meijers JC, Creemers EE and Pinto-Sietsma SJ: Normalization panels for the reliable quantification of circulating microRNAs by RT-qPCR. FASEB J. 29:3853–3862. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Hanley JA and McNeil BJ: The meaning and use of the area under a receiver operating characteristic (ROC) curve. Radiology. 143:29–36. 1982. View Article : Google Scholar : PubMed/NCBI

28 

Zhao Z, Moley KH and Gronowski AM: Diagnostic potential for miRNAs as biomarkers for pregnancy-specific diseases. Clin Biochem. 46:953–960. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Chen Y, Gelfond JA, McManus LM and Shireman PK: Reproducibility of quantitative RT-PCR array in miRNA expression profiling and comparison with microarray analysis. BMC Genomics. 10:4072009. View Article : Google Scholar : PubMed/NCBI

30 

Sato F, Tsuchiya S, Terasawa K and Tsujimoto G: Intra-platform repeatability and inter-platform comparability of microRNA microarray technology. PLoS One. 4:e55402009. View Article : Google Scholar : PubMed/NCBI

31 

Roberts TC, Coenen-Stass AML and Wood MJA: Assessment of RT-qPCR normalization strategies for accurate quantification of extracellular microRNAs in murine serum. PLoS One. 9:e892372014. View Article : Google Scholar : PubMed/NCBI

32 

Anton L, Olarerin-George AO, Schwartz N, Srinivas S, Bastek J, Hogenesch JB and Elovitz MA: miR-210 inhibits trophoblast invasion and is a serum biomarker for preeclampsia. Am J Pathol. 183:1437–1445. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Pineles BL, Romero R, Montenegro D, Tarca AL, Han YM, Kim YM, Draghici S, Espinoza J, Kusanovic JP, Mittal P, et al: Distinct subsets of microRNAs are expressed differentially in the human placentas of patients with preeclampsia. Am J Obstet Gynecol. 196:261.e1–261.e6. 2007. View Article : Google Scholar

34 

Enquobahrie DA, Abetew DF, Sorensen TK, Willoughby D, Chidambaram K and Williams MA: Placental microRNA expression in pregnancies complicated by preeclampsia. Am J Obstet Gynecol. 204:178.e12–178.e21. 2011. View Article : Google Scholar

35 

Muralimanoharan S, Maloyan A, Mele J, Guo C, Myatt LG and Myatt L: miR-210 modulates mitochondrial respiration in placenta with preeclampsia. Placenta. 33:816–823. 2012. View Article : Google Scholar : PubMed/NCBI

36 

Zhang Y, Fei M, Xue G, Zhou Q, Jia Y, Li L, Xin H and Sun S: Elevated levels of hypoxia-inducible microRNA-210 in pre-eclampsia: New insights into molecular mechanisms for the disease. J Cell Mol Med. 16:249–259. 2012. View Article : Google Scholar : PubMed/NCBI

37 

Camps C, Buffa FM, Colella S, Moore J, Sotiriou C, Sheldon H, Harris AL, Gleadle JM and Ragoussis J: hsa-miR-210 Is induced by hypoxia and is an independent prognostic factor in breast cancer. Clin Cancer Res. 14:1340–1348. 2008. View Article : Google Scholar : PubMed/NCBI

38 

Fasanaro P, D'Alessandra Y, Di Stefano V, Melchionna R, Romani S, Pompilio G, Capogrossi MC and Martelli F: MicroRNA-210 modulates endothelial cell response to hypoxia and inhibits the receptor tyrosine kinase ligand Ephrin-A3. J Biol Chem. 283:15878–15883. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Wulfken LM, Moritz R, Ohlmann C, Holdenrieder S, Jung V, Becker F, Herrmann E, Walgenbach-Brünagel G, von Ruecker A, Müller SC, et al: MicroRNAs in renal cell carcinoma: Diagnostic implications of serum miR-1233 levels. PLoS One. 6:e257872011. View Article : Google Scholar : PubMed/NCBI

40 

Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP and Burge CB: Prediction of mammalian microRNA targets. Cell. 115:787–798. 2003. View Article : Google Scholar : PubMed/NCBI

41 

Grill S, Rusterholz C, Zanetti-Dällenbach R, Tercanli S, Holzgreve W, Hahn S and Lapaire O: Potential markers of preeclampsia-a review. Reprod Biol Endocrinol. 7:702009. View Article : Google Scholar : PubMed/NCBI

42 

Meads CA, Cnossen JS, Meher S, Juarez-Garcia A, ter Riet G, Duley L, Roberts TE, Mol BW, van der Post JA, Leeflang MM, et al: Methods of prediction and prevention of pre-eclampsia: systematic reviews of accuracy and effectiveness literature with economic modelling. Health Technol Assess. 12:1–270. 2008. View Article : Google Scholar

43 

Zakiyah N, Postma MJ, Baker PN and van Asselt AD: IMPROvED Consortium: Pre-eclampsia diagnosis and treatment options: A review of published economic assessments. Pharmacoeconomics. 33:1069–1082. 2015. View Article : Google Scholar : PubMed/NCBI

44 

Poon LC, Stratieva V, Piras S, Piri S and Nicolaides KH: Hypertensive disorders in pregnancy: Combined screening by uterine artery Doppler, blood pressure and serum PAPP-A at 11–13 weeks. Prenat Diagn. 30:216–223. 2010.PubMed/NCBI

45 

Poon LC, Maiz N, Valencia C, Plasencia W and Nicolaides KH: First-trimester maternal serum pregnancy-associated plasma protein-A and pre-eclampsia. Ultrasound Obstet Gynecol. 33:23–33. 2009. View Article : Google Scholar : PubMed/NCBI

46 

Scazzocchio E, Figueras F, Crispi F, Meler E, Masoller N, Mula R and Gratacos E: Performance of a first-trimester screening of preeclampsia in a routine care low-risk setting. Am J Obstet Gynecol. 208:203.e1–203.e10. 2013. View Article : Google Scholar

47 

Park FJ, Leung CH, Poon LC, Williams PF, Rothwell SJ and Hyett JA: Clinical evaluation of a first trimester algorithm predicting the risk of hypertensive disease of pregnancy. Aust N Z J Obstet Gynaecol. 53:532–539. 2013. View Article : Google Scholar : PubMed/NCBI

48 

Akolekar R, Syngelaki A, Poon L, Wright D and Nicolaides KH: Competing risks model in early screening for preeclampsia by biophysical and biochemical markers. Fetal Diagn Ther. 33:8–15. 2013. View Article : Google Scholar : PubMed/NCBI

49 

Akolekar R, Syngelaki A, Sarquis R, Zvanca M and Nicolaides KH: Prediction of early, intermediate and late pre-eclampsia from maternal factors, biophysical and biochemical markers at 11–13 weeks. Prenat Diagn. 31:66–74. 2011. View Article : Google Scholar : PubMed/NCBI

50 

Foidart JM, Munaut C, Chantraine F, Akolekar R and Nicolaides KH: Maternal plasma soluble endoglin at 11–13 weeks' gestation in pre-eclampsia. Ultrasound Obstet Gynecol. 35:680–687. 2010.PubMed/NCBI

51 

Kusanovic JP, Romero R, Chaiworapongsa T, Erez O, Mittal P, Vaisbuch E, Mazaki-Tovi S, Gotsch F, Edwin SS, Gomez R, et al: A prospective cohort study of the value of maternal plasma concentrations of angiogenic and anti-angiogenic factors in early pregnancy and midtrimester in the identification of patients destined to develop preeclampsia. J Matern Fetal Neonatal Med. 22:1021–1038. 2009. View Article : Google Scholar : PubMed/NCBI

52 

Lycoudi A, Mavreli D, Mavrou A, Papantoniou N and Kolialexi A: miRNAs in pregnancy-related complications. Expert Rev Mol Diagn. 15:999–1010. 2015. View Article : Google Scholar : PubMed/NCBI

53 

Morales Prieto DM and Markert UR: MicroRNAs in pregnancy. J Reprod Immunol. 88:106–111. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Munaut C, Tebache L, Blacher S, Noël A, Nisolle M and Chantraine F: Dysregulated circulating miRNAs in preeclampsia. Biomed Rep 5: 686-692, 2016.
APA
Munaut, C., Tebache, L., Blacher, S., Noël, A., Nisolle, M., & Chantraine, F. (2016). Dysregulated circulating miRNAs in preeclampsia. Biomedical Reports, 5, 686-692. https://doi.org/10.3892/br.2016.779
MLA
Munaut, C., Tebache, L., Blacher, S., Noël, A., Nisolle, M., Chantraine, F."Dysregulated circulating miRNAs in preeclampsia". Biomedical Reports 5.6 (2016): 686-692.
Chicago
Munaut, C., Tebache, L., Blacher, S., Noël, A., Nisolle, M., Chantraine, F."Dysregulated circulating miRNAs in preeclampsia". Biomedical Reports 5, no. 6 (2016): 686-692. https://doi.org/10.3892/br.2016.779
Copy and paste a formatted citation
x
Spandidos Publications style
Munaut C, Tebache L, Blacher S, Noël A, Nisolle M and Chantraine F: Dysregulated circulating miRNAs in preeclampsia. Biomed Rep 5: 686-692, 2016.
APA
Munaut, C., Tebache, L., Blacher, S., Noël, A., Nisolle, M., & Chantraine, F. (2016). Dysregulated circulating miRNAs in preeclampsia. Biomedical Reports, 5, 686-692. https://doi.org/10.3892/br.2016.779
MLA
Munaut, C., Tebache, L., Blacher, S., Noël, A., Nisolle, M., Chantraine, F."Dysregulated circulating miRNAs in preeclampsia". Biomedical Reports 5.6 (2016): 686-692.
Chicago
Munaut, C., Tebache, L., Blacher, S., Noël, A., Nisolle, M., Chantraine, F."Dysregulated circulating miRNAs in preeclampsia". Biomedical Reports 5, no. 6 (2016): 686-692. https://doi.org/10.3892/br.2016.779
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team