Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
May-2017 Volume 6 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2017 Volume 6 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Biocompatibility of biological material polylactic acid with stem cells from human exfoliated deciduous teeth

  • Authors:
    • Xi Wang
    • Guanghui Li
    • Yiming Liu
    • Weiwei Yu
    • Qiang Sun
  • View Affiliations / Copyright

    Affiliations: Department of Stomatology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450052, P.R. China
    Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 519-524
    |
    Published online on: March 28, 2017
       https://doi.org/10.3892/br.2017.881
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

To investigate the biocompatibility of the biomaterial, polylactic acid (PLA) with stem cells from human exfoliated deciduous teeth (SHED) and its induction of mineralization as a type of scaffold material. To determine the impacts of biomaterial PLA on proliferation and mineralization of SHED, the expression of surface molecules of SHED isolated and cultured in vitro was detected by flow cytometry. In addition, cell proliferation was measured using MTT and Edu assays, and the evaluation of mineralized differentiation was performed using Alizarin Red S staining. In addition, the expression levels of osteogenic marker genes were measured by reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) and western blot analysis. SHED were successfully isolated and identified. The MTT and Edu results indicated that the proliferation of SHED cultured in PLA and normal medium was not significantly different. The Alizarin Red S staining demonstrated that the mineralization capability was significantly higher in the SHED that were cultured in PLA medium. Furthermore, RT‑qPCR and western blot analyses indicated that the expression levels of osteogenic marker genes were higher in the SHED cultured in PLA medium. These results suggested that PLA possesses good biocompatibility with SHED and may effectively induce the mineralization of SHED and serve as a scaffold material.

Introduction

The application of tissue engineering methods to construct biologically active and functional teeth has been the focus of oral medical research. Although the findings are currently insufficient to support their application in tooth regeneration, the intensive research on seed cells and scaffold materials has provided a prospective method for tooth tissue engineering. Duailibi et al (1) seeded tooth bud cells from 4-day-old rats on polyglycolic acid (PGA)-poly-L-lactate-co-glycolate (PLGA) scaffold material and implanted the tooth bud cells in the omenta of adult rat hosts. Dentin-, endodontium- and enamel-like structures were observed to have formed 12 weeks after implantation. Young et al (2) inoculated tooth bud cells from pigs after proliferation onto tooth-shaped bio-scaffold material PGA-PLGA and implanted these in the omenta of athymic rats, and found that tissue-engineered tooth crowns containing dentin and endodontium were formed.

A selection of scaffold materials, in addition to seed cells, are important in the construction of tissue-engineered teeth. Polylactic acid (PLA) is a typical biodegradable synthetic polymer (3). As it has reliable biosafety and is biodegradable and environmentally friendly, PLA has been widely applied as a medical polymer material (4–6) and is a commonly used biological scaffold material in tissue engineering (7,8). In the current study, extracts of PLA were combined with stem cells from human exfoliated deciduous teeth (SHED) to evaluate the biocompatibility, with the aim of providing an experimental basis for subsequent tooth tissue engineering research.

Materials and methods

SHED culture

The present study was reviewed and approved by the Institutional Review Board and the Ethics Committee at Zhengzhou University (Zhengzhou, China) and was conducted following written consent being obtained from the guardians of all participants. Deciduous teeth that needed to be removed due to retention were collected and surface sterilized. Their crowns were carefully split in a sterile bench and their endodontium was removed, rinsed with sterile 0.01 mol/l phosphate-buffered saline (PBS), sliced into small pieces of ~1.0×1.0×1.0 mm and digested with 0.3% type I collagenase (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) at 37°C for 40 min. The cell clumps were then prepared into a single cell suspension, passed through a sieve (pore size, 70 µm) and centrifuged at 120 × g for 5 min at room temperature. The cells were washed again with sterile 0.01 mol/l PBS, resuspended into Gibco α-minimum essential medium (α-MEM; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing Gibco 20% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc.) and cultured in 5-ml flasks in an incubator supplemented with 5% CO2 at 37°C. The culture medium was refreshed every 3 days. Upon reaching 80% confluence, the cells were digested with 2.5 g/l trypsin (Sigma-Aldrich; Merck KGaA) and passaged.

SHED phenotype identification

The P3 SHED at logarithmic phase were prepared as a single cell suspension. Subsequent to three washes with PBS, cells were resuspended in l ml PBS containing 3% FBS, counted and aliquoted into 1.5-ml tubes with 100 µl cell suspension in each tube to ensure that each tube had no less than 105 cells. These cells were then incubated with 5 µl pre-prepared, light-protected, fluorescein isothiocyanate- and phycoerythrin-labeled antibodies against human CD29 (1:500, cat. no. ab52971), CD105 (1:500, cat. no. ab44967), CD146 (1:200, cat. no. ab24577) and STRO-1 (1:100, cat. no. ab214086), all obtained from Abcam (Cambridge, MA, USA). The cells were then incubated for 1 h at room temperature in the dark, washed with PBS three times, resuspended and analyzed using flow cytometry (Beckman Coulter, Inc., Fullerton, CA, USA) according to manufacturer's instructions. Samples incubated with PBS served as the negative controls.

Preparation of PLA

The PLA (~2×1 mm size) was sterilized with ethylene oxide, mixed with α-MEM containing 5% FBS in a sterile tube to 100 g/l, incubated at 37°C for 72 h and stored at 4°C for future use.

Effect of PLA extract on SHED morphology

The P2 SHED were seeded onto 6-well plates and randomly divided into treatment and control groups with three repeats per group. Cells in the treatment and control groups were incubated with 100% PLA extract or with α-MEM containing 5% FBS, respectively, at 37°C in a humidified incubator supplemented with 5% CO2 for 3 days. The cells were observed under an inverted phase contrast microscope (Olympus Corporation, Tokyo, Japan) for changes in cell adhesion and morphology.

Influence of PLA extract on the proliferation activity of SHED

The P3 SHED at logarithmic phase were resuspended in a medium of 100% PLA extract, a medium of 50% PLA extract plus 50% α-MEM supplemented with 5% FBS, and a medium of 100% α-MEM supplemented with 5% FBS, seeded into 96-well plates with 100 μl per well with eight duplicates for each and cultured at 37°C in a humidified incubator supplemented with 5% CO2. At 1, 3, 5 and 7 days after culture, 20 µl tetrazolium dye (MTT; Sigma-Aldrich; Merck KGaA) was added to each well and the cells were further cultured at 37°C for 4 h. Subsequently, 50 µl dimethyl sulfoxide (Sigma-Aldrich; Merck KGaA) was added to each well. The plate was oscillated at 600 rpm for 10 min and the optical density value of each well was measured on a microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA) at a wavelength of 570 nm.

The P3 SHED at logarithmic growth phase were prepared as a single cell suspension, seeded into each well of a 24-well plate with 4×103 cells per well and cultured to normal growth stage (~24 h) at 37°C in a humidified incubator supplemented with 5% CO2. After starving in serum-free α-MEM for 12 h, the cells were cultured in α-MEM containing 10% FBS overnight, stained according to the EdU staining kit (Guangzhou RiboBio Co., Ltd., Guangzhou, China) and photographed with a digital camera mounted on the microscope.

Effect of PLA extract on mineralization ability of SHED

The P3 SHED at logarithmic growth phase were seeded in 12-well plates with 2×104 cells per well and randomly divided into treatment and control groups. Cells in the treatment and control groups were incubated with 100% PLA extract or with α-MEM containing 5% FBS, respectively, and cultured to >80% confluency at 37°C in a humidified incubator supplemented with 5% CO2. The medium was replaced with osteogenic medium, which was α-MEM supplemented with 10% FBS, 100 nM dexamethasone (Sigma-Aldrich; Merck KGaA), 50 µg/ml of ascorbic acid (Sigma-Aldrich; Merck KGaA) and 5 mM β-glycerophosphate (Sigma-Aldrich; Merck KGaA), half of the medium was replaced with osteogenic medium 3 days later and fully refreshed with osteogenic medium every 3 days subsequently. After 14 days of culture with the osteogenic supplements, the cells were fixed in 4% paraformaldehyde, washed twice in PBS and incubated in 0.1% Alizarin Red S solution (Sigma-Aldrich; Merck KGaA) in Tris-HCl (pH 8.3) at 37°C for 30 min. After washing in PBS, the cells were observed and imaged under an inverted microscope. The nodule area per well was measured quantitatively using an image analysis system, Image-Pro plus 5.0 software (Media Cybernetics, Inc., Rockville, MD, USA).

RT-qPCR

The cultured SHED (14 days of osteogenic induction) were washed three times with PBS and sufficiently dried. The cells were cooled on ice and lysed with TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. These RNA were immediately reverse transcribed into cDNA. RT-qPCR was performed in a final reaction volume of 20 μl containing SYBR-Green PCR Master Mix (cat. no. 4309155; Thermo Fisher Scientific, Inc.), DNase-free water, primers and cDNA. The target genes runt-related transcription factor 2 (Runx2) and osterix (Osx) and the internal control, β-actin under the following conditions: Denaturation at 95°C for 3 min; amplification (40 cycles) at 95°C for 15 sec and 60°C for 30 sec. The PCR primer sequences are presented in Table I. Expression of each gene was monitored using an Applied Biosystems® StepOne™ Real-Time PCR system (Thermo Fisher Scientific, Inc.). Differences in gene expression levels were calculated using the 2−ΔΔCq method (9) for relative quantification, and expressed as the fold change relative to the untreated control.

Table I.

Polymerase chain reaction primer sequences.

Table I.

Polymerase chain reaction primer sequences.

GeneDirectionPrimers
Runx2Forward CACTGGCGCTGCAACAAGA
Reverse CATTCCGGAGCTCAGCAGAATAA
OsxForward TGGCGTCCTCCCTGCTTG
Reverse TGCTTTGCCCAGAGTTGTTG
β-actinForward TGGCACCCAGCACAATGAA
Reverse CTAAGTCATAGTCCGCCTAGAAGCA

[i] Runx2, runt-related transcription factor 2; Osx, osterix.

Western blot analysis

Whole cell lysates for western blotting were also extracted with lysis buffer and the total protein concentration was determined with Bradford protein assay kit (P0006; Beyotime Institute of Biotechnology, Shanghai, China) following the manufacturer's instructions. The samples of 50 µg protein were loaded onto SDS gels and transferred to polyvinylidene fluoride membranes (EMD Millipore, Billerica, MA, USA). The membranes were blocked in 5% non-fat dried milk in PBST (PBS+0.1% Tween-20). The membranes were probed overnight with the following primary antibodies: anti-RUNX2 (1:100, cat. no. ab54868), anti-Osx (1:400, cat. no. ab57335) and anti-β-actin (1:800, cat. no. ab3280). All antibodies were obtained from Abcam. The membranes were incubated at 37°C for 30 min with a horseradish peroxidase-conjugated secondary antibody (1:2,000; cat. no. BA1056; Boster Biological Technology, Ltd., Wuhan, China). The membranes were developed using enhanced chemiluminescence (ECL) or ECL plus (GE Healthcare Life Sciences, Chalfont, UK) according to the manufacturer's instructions.

Statistical analysis

Each experiment was repeated three times and data were expressed as means ± standard deviations. Data were analyzed using SPSS 17.0 statistical software (SPSS, Inc., Chicago, IL, USA). Differences between multiple groups were analyzed using Student's t-test following homogeneity test of variance. P<0.05 was considered to indicate a statistically significant difference.

Results

SHED culture and identification

Slow attachment was observed during the primary SHED culture using an enzymatic digestion method; at 4 h of culture, only 60% of cells were attached. At 12 h, cells had begun to stretch and at 48 h, cells were substantially expanded. The passage cells grew well, and were passaged every 3–4 days. Cells at the center of a well exhibited unclear boundaries and were round or irregular, forming a nodular shape, while the majority of cells at the peripheral portion were small, spindle-shaped and fibroblast-like, and had 1–2 protrusions (Fig. 1A and B). Flow cytometry indicated that these cells were positive to mesenchymal stem cell surface markers, STRO-1, CD146, CD29 and CD105 (Fig. 1C-F).

Figure 1.

Cell morphology and FCM analysis of SHED. (A) Cell morphology of SHED incubated with α-MEM containing 5% FBS. (B) Cell morphology of SHED incubated with 100% PLA extract. (C-F) Representative images of FCM data for SHED. Scale bars, 50 µm. FCM, flow cytometric; SHED, stem cells from human exfoliated deciduous teeth; PLA, polylactic acid; α-MEM, α-minimum essential medium; CD146, cluster of differentiation 146.

Effect of PLA extract on SHED morphology

The morphology of cells cultured in PLA extract for 7 days was not significantly different when compared with that of cells cultured in α-MEM supplemented with 5% FBS, only certain cells were short and spindle-shaped, and had a relatively smaller volume (Fig. 1B).

Influence of PLA extract on the proliferation activity of SHED

EdU staining demonstrated that the nuclei of non-proliferating SHED were stained blue by Hoechst, while the nuclei of proliferating SHED were stained red due to incorporation of EdU. Thus, cells with red nuclei were positive, indicating that they were proliferating cells. The experimental results demonstrated that the number of proliferating cells was not significantly different among the three groups (Fig. 2A-D; P>0.1), indicating that PLA extract did not significantly affect the proliferation activity of SHED. Furthermore, comparison of cell growth curves revealed that the proliferation of SHED cultured in PLA extracts was not significantly different from that of SHED cultured in α-MEM supplemented with 5% FBS (Fig. 2E).

Figure 2.

Proliferation ability of SHED cultured in normal medium and media with PLA extract. (A-C) Representative EdU staining of SHED cultured in normal medium and media with varying quantities of PLA extract. Cells with red nuclei are proliferating cells. (D) Percentage of EdU-positive cells (number of red nuclei). (E) Growth curves for SHED cultured in different media were analyzed using the MTT assay. The experimental results demonstrated that the number of proliferating cells was not significantly different between the three groups (P>0.1). The data shown represent mean ± standard deviation. Scale bars, 50 µm. SHED, stem cells from human exfoliated deciduous teeth; PLA, polylactic acid; α-MEM, α-minimum essential medium; OD, optical density.

Effect of PLA extract on mineralization ability of SHED

Alizarin Red S staining of cells after 14 days of culture under osteogenic culture conditions resulted in red mineralized nodules in irregular lumps or elongated shapes as observed under an optical microscope. In SHED cultured in α-MEM supplemented with 5% FBS, there were fewer mineralized nodules, which were scattered and darker in color. By contrast, there were significantly more mineralized nodules following culture in the medium with PLA extract, the nodules were larger, more concentrated, and lighter in color (Fig. 3A and B). Quantitative analysis of the Alizarin Red S staining results indicated that the number of mineralized nodules of SHED cultured in PLA extract was significantly higher than that of SHED cultured in α-MEM supplemented with 5% FBS (Fig. 3C; P<0.05). The expression levels of osteogenesis-associated genes at 14 days of osteogenic induction were detected using RT-qPCR. The results demonstrated that following osteogenic induction, the expression levels of RUNX2 and Osx were increased in the treatment groups, although these increases were significantly higher in SHED cultured in medium containing PLA extract (Fig. 3D and E; P<0.05). Similarly, western blot analysis also indicated that the expression levels of these proteins were increased following osteogenic induction, although these increases were also significantly higher in cells cultured in medium containing PLA extract (Fig. 3F; P<0.05). These results indicated that the osteogenic differentiation ability was significantly greater in SHED cultured in medium containing PLA extract.

Figure 3.

Osteogenic differentiation ability of SHED cultured in normal medium and medium with PLA extract. (A and B) Mineralization nodules formed in SHED cultured in normal medium and medium with PLA extract. Scale bars, 50 µm. (C) The graph presents the statistically significant difference in the number of mineralization nodules between the groups. (D and E) The osteogenesis-associated gene expression profiles of SHED cultured in various media were detected using reverse transcription-quantitative polymerase chain reaction. The results indicated that following osteogenic induction, the expression levels of RUNX2 and osterix were increased in all treatment groups; however, these increases were significantly higher in SHED cultured in media containing PLA extract. The data are presented as means ± standard deviation. (F) The expression of RUNX2 and osterix of SHED cultured in various media were analyzed by western blotting. Western blot analysis indicated that the expression levels of these proteins were increased following osteogenic induction; however, these increases were significantly higher in cells cultured in medium containing PLA extract. (G and H) Quantification of these data. *P<0.05 vs. SHED. SHED, stem cells from human exfoliated deciduous teeth; PLA, polylactic acid; RUNX2, runt-related transcription factor 2; os, osteogenesis.

Discussion

The key issues in tissue engineering are seed cells, scaffold biomaterials and cytokines. For tissue engineering research, it is particularly important to select the appropriate seed cells and scaffold biomaterials (10). PLA is an excellent biocompatible and biodegradable polymer. In an aqueous environment, PLA is degraded by simply hydrolyzing the ester bond to form its final degradation product, lactic acid, which is converted into pyruvate in the tricarboxylic acid cycle and eventually excreted in the form of CO2 and H2O (11,12). Effective stem cell proliferation and culture on biodegradable material PLA scaffolds have been reported (13,14). Using PLA as a tissue-engineering scaffold provides a porous structure inside the stent for cell growth and nutrient transport, as well as the mechanical strength and geometric shape to support and guide cell growth (15,16).

Adult stem cells refer to specific stem cells present in adult tissues and organs. Under normal circumstances, these cells are in a resting state, and used to regenerate cells and maintain cellular homeostasis. When tissues are damaged, these stem cells proliferate and differentiate to the cell types in the tissue, participating in tissue repair and reconstruction. In 2000, Gronthos et al (17) isolated cells with characteristics of stem cells from the endodontium. Later, Shi and Gronthos subcutaneously implanted a mix of single cell suspension and hydroxyapatite/tricalcium phosphate (HA/TCP) powder into immunodeficient mice, forming the dentin-endodontium complex-like structures (18), and first proposed the concept of dental pulp stem cells. In 2003, Miura et al (19) found pluripotent SHED, which revealed a novel field for dental pulp stem cell research. Furthermore, studies have shown that SHED are superior to the permanent dental pulp stem cells in terms of proliferation and mineralization (20,21). SHED provide an improved source of seed cells for tooth tissue engineering. In the current study, SHED were isolated using an in vitro enzymatic digestion method and flow cytometry identified that these cells are positive to STRO-1, CD146, CD29 and CD105, and possess the phenotypic characteristics of mesenchymal stem cells.

Morphological observation results indicated that SHED cultured in vitro in PLA extraction properly attach, grow and reproduce, and demonstrated that biomaterial PLA has good biocompatibility, and is not toxic and inhibitory to cells, as well as being conducive to cell growth. In the present study, PLA extract at 100 g/l displayed improved characteristics for cell proliferation. MTT and EdU analyses demonstrated that SHED were capable of normal growth and proliferation in PLA extract, further proving that PLA is not toxic to cells and has good biocompatibility. SHED secrete calcium matrix and aggregate further, forming mineralized nodules, which is the foundation for forming osteogenic/dentogenic dentin (22). Thus, the ability of forming mineralized nodules is an important indicator for evaluating the function of dental pulp stem cells. Alizarin Red S staining revealed that the quantity of mineralized nodules was significantly greater in cells cultured in PLA extract than in cells cultured in α-MEM supplemented with 5% FBS, indicating that PLA has improved mineralization induction ability for SHED. Furthermore, RT-qPCR and western blot analyses indicated that the expression levels of osteogenic marker genes were increased in SHED cultured in PLA medium. Adhered stem cells with strong mineralization ability significantly promote the formation of tissue-engineered teeth. As obtaining SHED is relatively convenient and noninvasive, their application is more simple and feasible compared with the other adult stem cells.

In conclusion, the application of the biomaterial, PLA in tooth tissue engineering is feasible due to its good histocompatibility and ability to improve the mineralization rate of SHED. However, its construction form requires improvement in order to increase cell attachment rate and cell proliferation. Since the simulation of complex biological environments has not yet been fully achieved, human tooth tissue engineering remains in its infancy. The present study may provide an experimental basis upon which human tooth regeneration using tissue engineering techniques may be achieved. As PLA is biodegradable and discharged to the environment in the form of CO2 and H2O, the current study hypothesizes that the material may be applied in the restoration of deciduous teeth following root canal treatment.

Acknowledgements

The present study was funded by the National Natural Science Foundation of China (grant nos. 31400839 and 81402231).

References

1 

Duailibi MT, Duailibi SE, Young CS, Bartlett JD, Vacanti JP and Yelick PC: Bioengineered teeth from cultured rat tooth bud cells. J Dent Res. 83:523–528. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Young CS, Terada S, Vacanti JP, Honda M, Bartlett JD and Yelick PC: Tissue engineering of complex tooth structures on biodegradable polymer scaffolds. J Dent Res. 81:695–700. 2002. View Article : Google Scholar : PubMed/NCBI

3 

Liu X, Holzwarth JM and Ma PX: Functionalized synthetic biodegradable polymer scaffolds for tissue engineering. Macromol Biosci. 12:911–919. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Gao W and Wang J: Synthetic micro/nanomotors in drug delivery. Nanoscale. 6:10486–10494. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Wiebe J, Nef HM and Hamm CW: Current status of bioresorbable scaffolds in the treatment of coronary artery disease. J Am Coll Cardiol. 64:2541–2551. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Vanaman M and Fabi SG: Décolletage: Regional Approaches with Injectable Fillers. Plast Reconstr Surg. 136:276S–281S. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Gentile P, Chiono V, Carmagnola I and Hatton PV: An overview of poly(lactic-co-glycolic) acid (PLGA)-based biomaterials for bone tissue engineering. Int J Mol Sci. 15:3640–3659. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Venkatesan J and Kim SK: Nano-hydroxyapatite composite biomaterials for bone tissue engineering--a review. J Biomed Nanotechnol. 10:3124–3140. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

10 

Langer R and Vacanti JP: Tissue engineering. Science. 260:920–926. 1993. View Article : Google Scholar : PubMed/NCBI

11 

Jeong W, Shin EJ, Culkin DA, Hedrick JL and Waymouth RM: Zwitterionic polymerization: A kinetic strategy for the controlled synthesis of cyclic polylactide. J Am Chem Soc. 131:4884–4891. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Castro-Aguirre E, Iñiguez-Franco F, Samsudin H, Fang X and Auras R: Poly(lactic acid)-Mass production, processing, industrial applications, and end of life. Adv Drug Deliv Rev. 107:333–366. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Sudwilai T, Ng JJ, Boonkrai C, Israsena N, Chuangchote S and Supaphol P: Polypyrrole-coated electrospun poly(lactic acid) fibrous scaffold: Effects of coating on electrical conductivity and neural cell growth. J Biomater Sci Polym Ed. 25:1240–1252. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Vuornos K, Björninen M, Talvitie E, Paakinaho K, Kellomäki M, Huhtala H, Miettinen S, Seppänen-Kaijansinkko R and Haimi S: Human Adipose Stem Cells Differentiated on Braided Polylactide Scaffolds Is a Potential Approach for Tendon Tissue Engineering. Tissue Eng Part A. 22:513–523. 2016. View Article : Google Scholar : PubMed/NCBI

15 

Kim IG, Hwang MP, Du P, Ko J, Ha CW, Do SH and Park K: Bioactive cell-derived matrices combined with polymer mesh scaffold for osteogenesis and bone healing. Biomaterials. 50:75–86. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Salerno A, Guarino V, Oliviero O, Ambrosio L and Domingo C: Bio-safe processing of polylactic-co-caprolactone and polylactic acid blends to fabricate fibrous porous scaffolds for in vitro mesenchymal stem cells adhesion and proliferation. Mater Sci Eng C. 63:512–521. 2016. View Article : Google Scholar

17 

Gronthos S, Mankani M, Brahim J, Robey PG and Shi S: Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci USA. 97:13625–13630. 2000. View Article : Google Scholar : PubMed/NCBI

18 

Shi S and Gronthos S: Perivascular niche of postnatal mesenchymal stem cells in human bone marrow and dental pulp. J Bone Miner Res. 18:696–704. 2003. View Article : Google Scholar : PubMed/NCBI

19 

Miura M, Gronthos S, Zhao M, Lu B, Fisher LW, Robey PG and Shi S: SHED: Stem cells from human exfoliated deciduous teeth. Proc Natl Acad Sci USA. 100:5807–5812. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Galler KM, Cavender A, Yuwono V, Dong H, Shi S, Schmalz G, Hartgerink JD and D'Souza RN: Self-assembling peptide amphiphile nanofibers as a scaffold for dental stem cells. Tissue Eng Part A. 14:2051–2058. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Cordeiro MM, Dong Z, Kaneko T, Zhang Z, Miyazawa M, Shi S, Smith AJ and Nör JE: Dental pulp tissue engineering with stem cells from exfoliated deciduous teeth. J Endod. 34:962–969. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Yamaza T, Miura Y, Bi Y, Liu Y, Akiyama K, Sonoyama W, Patel V, Gutkind S, Young M, Gronthos S, et al: Pharmacologic stem cell based intervention as a new approach to osteoporosis treatment in rodents. PLoS One. 3:e26152008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang X, Li G, Liu Y, Yu W and Sun Q: Biocompatibility of biological material polylactic acid with stem cells from human exfoliated deciduous teeth. Biomed Rep 6: 519-524, 2017.
APA
Wang, X., Li, G., Liu, Y., Yu, W., & Sun, Q. (2017). Biocompatibility of biological material polylactic acid with stem cells from human exfoliated deciduous teeth. Biomedical Reports, 6, 519-524. https://doi.org/10.3892/br.2017.881
MLA
Wang, X., Li, G., Liu, Y., Yu, W., Sun, Q."Biocompatibility of biological material polylactic acid with stem cells from human exfoliated deciduous teeth". Biomedical Reports 6.5 (2017): 519-524.
Chicago
Wang, X., Li, G., Liu, Y., Yu, W., Sun, Q."Biocompatibility of biological material polylactic acid with stem cells from human exfoliated deciduous teeth". Biomedical Reports 6, no. 5 (2017): 519-524. https://doi.org/10.3892/br.2017.881
Copy and paste a formatted citation
x
Spandidos Publications style
Wang X, Li G, Liu Y, Yu W and Sun Q: Biocompatibility of biological material polylactic acid with stem cells from human exfoliated deciduous teeth. Biomed Rep 6: 519-524, 2017.
APA
Wang, X., Li, G., Liu, Y., Yu, W., & Sun, Q. (2017). Biocompatibility of biological material polylactic acid with stem cells from human exfoliated deciduous teeth. Biomedical Reports, 6, 519-524. https://doi.org/10.3892/br.2017.881
MLA
Wang, X., Li, G., Liu, Y., Yu, W., Sun, Q."Biocompatibility of biological material polylactic acid with stem cells from human exfoliated deciduous teeth". Biomedical Reports 6.5 (2017): 519-524.
Chicago
Wang, X., Li, G., Liu, Y., Yu, W., Sun, Q."Biocompatibility of biological material polylactic acid with stem cells from human exfoliated deciduous teeth". Biomedical Reports 6, no. 5 (2017): 519-524. https://doi.org/10.3892/br.2017.881
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team