Association of nitric oxide synthase 3 gene polymorphism with the risk of type 2 diabetes

Introduction

Previous research has demonstrated that some factors involved in the pathogenesis of obesity-related insulin resistance and T2D cause chronic low-grade inflammation and an activation of the immune system (1). Some of the risk factors for the development of T2D and its macrovascular complications are systemic inflammatory markers. Conversely, in obese individuals, some organs of the body, such as the pancreas, are sites of inflammation (1). Some research suggests that there is an important association between obesity, insulin resistance, and chronic low-grade inflammation (2).

Although several environmental and lifestyle conditions are involved in diabetes, genetic factors are also important determinants (3–9). Several genes have been investigated, and nitric oxide (NO) synthase has attracted the interest of researchers because of its determinative role in production of NO in endothelial cells (10,11).

Patients with diabetes, obesity and some other diseases have defects in endothelial cell function and NO production (12). The Atherosclerosis Risk in Communities Study has reported that obesity is associated with diabetes risk, and has observed that obese individuals have reduced NO bioavailability compared with individuals with normal weight (13,14).

NO synthase (eNOS) (EC: 1.14.13.39) encoded on chromosome 7q35-36 by NOS3 gene produce NO from L-arginine (15). It is necessary to know that single nucleotide polymorphisms (SNPs) in NOS3 gene are associated with inflammation because inflammatory molecules regulate glucose uptake in skeletal muscles (16).

Several analyses have indicated a relationship between different NOS3 gene variants involved in endothelial function, and incidence of type-2 diabetes (17,18). Möllsten et al (19) investigated associations between diabetic nephropathy and seven eNOS3-gene polymorphisms, and they identified a significant association between the rs743507 TT-genotype and diabetic nephropathy.

Li et al (20) evaluated the association of eight SNPs of eNOS in China and reported that rs1799983 and rs891512 SNPs of eNOS were associated with T2D (19). Assuming these findings, the eNOS gene may also be candidate gene of diabetes mellitus.

In the present study, a relationship between the rs1800779(A/G) and T2D was examined in an Iranian sample population.

Materials and methods

Ethics statement

Written informed consent forms were obtained from all subjects. The study was conducted following the guidelines of Iran Medical Research and approved by the local Ethics Committee of Medical University (Zahedan, Iran).

Case and control samples

Samples from 500 unrelated individuals were collected from the Diabetes Center in Ali Asghar Hospital (Zahedan, Iran). All samples were collected following the guidelines of according to the American Diabetes Association (21) and previous works of the authors (7,22,23).

A health questionnaire on the detailed status of the subjects' disease including age, gender, body mass index (BMI), fast blood sugar (FBS), high density lipoprotein-cholesterol (HDL-C), low density lipoprotein-cholesterol (LDL-C), triglyceride (TG) and total cholesterol (TC) was administered for all participants.

Extraction of genomic DNA

A total of 5 ml peripheral blood samples were obtained from all cases and controls in tubes containing EDTA. The standard salting-out protocol was used for extraction of genomic DNA (24). Measuring of DNA concentration was conducted by a spectrophotometer and then stored at −20°C.

Genotyping

The rs1800779(A/G) of NOS3 gene was detected using Tetra ARMS-PCR method. In this technique, four primers are used, in which two primers are external and two are internal; the sequences of these four primers are demonstrated in Table I.

Table I. Polymerase chain reaction primer sequences [NOS3 rs1800779(A/G)].

Table I.

Polymerase chain reaction primer sequences [NOS3 rs1800779(A/G)].

Primer description	Sequence (5′-3′)	Product size (bp)
Forward inner primer (A allele)	TAGTGGCCTTTCTCCAGCCCCTCAGAGGA	208
Reverse inner primer (G allele)	GAGTGCATGCTGGGGTTTGTAGTTCTGGGC	256
Forward outer primer	GCCCACCCCAACCTTATCCTCCACTGCT	405
Reverse outer primer	GCCGCAGGTCAGCAGAGAGACTAGGGCT	–

All PCR reactions were performed in a 20 µl reaction volume, containing 10 µl PCR Master Mix (Ampliqon A/S, Odense, Denmark), 5 µl DNase-free water, 1 µl (10 pmol/ml, Pishgam Biotech Co, Tehran, Iran) of each primer, and 1 µl genomic DNA (~80–100 ng/ml) in an Eppendorf thermocycler (Eppendorf AG, Hamburg, Germany). PCR was performed at 95°C for 5 min (denaturation), and then 30 cycles were performed with the following conditions: 95°C for 1 min (denaturation), 62°C for 45 sec (annealing), 72°C for 1 min (extension) and 72°C for 5 min (final extension). The products were then electrophoresed using 2.5% agarose gel. DNA fragments were stained with ethidium bromide, and then the gels were read using a UV Trans illumination system (Syngene USA, Frederick, MD, USA). The sizes of products are presented in Table I.

Statistical analysis

SPSS software (version, 16.0; SPSS, Inc., Chicago IL, USA) was used for statistical analysis. Pearson's chi-squared test was used for distributions of SNPs and comparing the frequency of heterozygous and homozygous genotypes between the patients and controls. P<0.05 was considered to indicate a statistically significant difference. Odds ratios (OR) and 95% confidence intervals (95% CIs) were also calculated. The Hardy Weinberg equilibrium (HWE) was calculated for both case and control groups.

Results

The study groups included 250 T2D patients with an average age of 54.68±10.19 years (173 females, 77 males) and 250 healthy controls subjects (HCs) with mean age of 49.60±9.99 years (178 females, 72 males). There was no significant difference regarding the age (P=0.554) and gender (P=0.696) of the participants between case and control groups. As demonstrated in Table II, there are significant differences regarding FBS, TC, HDL-C, LDL-C and BMI between patients with T2D and HCs (P<0.05).

Table II. Clinical-demographic characteristics of T2D patients and controls.

Table II.

Clinical-demographic characteristics of T2D patients and controls.

Characteristic	T2D (n=250) (n ± SD)	Controls (n=250) (n ± SD)	P-value
Age (year)	54.68±10.19	49.60±9.99	0.554
Sex (Female/male)	173/77	178/72	0.696
FBS (mg/dl)	200.63±100.58	101.41±30.12	<0.0001
TC (mg/dl)	187.00±48.15	179.39±36.27	0.028
TG (mg/dl)	165.24±81.09	143.13±81.73	0.356
HDL-C (mg/dl)	52.92±19.38	53.41±13.56	0.020
LDL-C (mg/dl)	102.59±38.19	101.50±28.74	0.038
BMI (kg/m2)	27.61±5.49	21.54±2.51	<0.0001

[i] FBS, fasting blood sugar; TC, total cholesterol; TG, triglyceride; HDL-C, High-density lipoprotein-cholesterol; LDL-C, Low-density lipoprotein-cholesterol; BMI, body mass index; T2D, type 2 diabetes.

The genotype and allele frequencies of the rs1800779(A/G) NOS3 polymorphism in both T2D and HCs are presented in Table III. The results indicated that the rs1800779(A/G) NOS3 variant significantly decreased the risk of T2D in AG vs. AA genotype (OR=0.527, 95% CI=0.368–0.756, P<0.001). In addition, the AG+GG vs. AA variant statistically decreased the risk of T2D in the dominant model (OR=0.569 95% CI=0.399–0.811, P=0.002), although rs1800779(A/G) NOS3 was not significantly associated with T2D in GG vs. AA genotype, G vs. A allele, and GG vs. AA+AG genotype in the recessive model (P>0.05).

Table III. Genotypic and allelic frequencies of NOS3 polymorphism (rs1800779(A/G)) in T2D patients and control subjects.

Table III.

Genotypic and allelic frequencies of NOS3 polymorphism (rs1800779(A/G)) in T2D patients and control subjects.

NOS3 polymorphism	T2D (%)	Control, n (%)	OR (95%CI)	P-value
Co-dominant
AA	142 (56.8)	107 (42.8)	1.00	–
AG	98 (39.2)	140 (56)	0.527 (0.368–0.756)	<0.001
GG	10 (4)	3 (1.2)	2.512 (0.675–9.350)	0.170
A	382 (76.4)	354 (70.8)	1.00	–
G	118 (23.6)	146 (29.2)	0.749 (0.564–0.993)	0.052
Dominant
AA	142 (56.8)	107 (42.8)	1.00	–
AG+GG	108 (43.2)	143 (57.2)	0.569 (0.399–0.811)	0.002
Recessive
AA+AG	240 (96)	247 (98.8)
GG	10 (4)	3 (1.2)	3.431 (0.933–12.618)	0.064

[i] CI, confidence interval; OR, odds ratio; T2D, type 2 diabetes.

The association between the rs1800779(A/G) NOS3 genotype in the dominant model (AG+GG vs. AA) and clinical-demographic characteristics of both T2D and HCs groups was conducted. As presented in Table IV, the rs1800779(A/G) NOS3 variant was not associated with clinical-demographic characteristics consisting of age, gender, FBS, TC, TG, HDL-C, LDL-C and BMI (P>0.05).

Table IV. Association between the NOS3 polymorphism [rs1800779(A/G)] and clinical-demographic characteristics of both groups.

Table IV.

Association between the NOS3 polymorphism [rs1800779(A/G)] and clinical-demographic characteristics of both groups.

Genotype	Age (year)	Sex (m/f)	FBS (mg/dl)	TC (mg/dl)	TG (mg/dl)	HDL-C (mg/dl)	LDL-C (mg/dl)	BMI (kg/m2)
T2D
AA	54.92±10.18	39/103	211.14±105.27	188.12±47.44	163.36±73.87	54.09±20.75	104.11±39.88	27.31±4.50
AG+GG	54.37±10.25	38/70	187.01±92.87	185.54±49.24	167.69±89.90	51.40±17.43	100.58±35.91	27.98±6.53
P-value	0.961	0.214	0.237	0.790	0.086	0.168	0.261	0.434
Control
AA	48.80±10.27	33/74	101.11±34.34	178.79±36.63	141.20±72.89	52.30±12.93	101.63±25.85	21.39±2.41
AG+GG	50.20±9.78	39/104	101.64±26.63	179.82±36.14	144.57±87.95	54.31±14.04	101.40±31.09	21.65±2.57
P-value	0.642	0.574	0.403	0.543	0.783	0.686	0.183	0.419

[i] M, male; F, female; FBS, fasting blood sugar; TC, total cholesterol; TG, triglyceride; HDL-C, high density lipoprotein-cholesterol; LDL-C, low density lipoprotein-cholesterol; BMI, body mass index; T2D, type 2 diabetes.

The chi-squared was used for evaluation of the HWE. The genotype of the rs1800779(A/G) NOS3 polymorphism in the case subjects was in HWE (X2=1.89, P=0.1687), but in the controls was not in HWE (X2=31.4. P<0.001).

Discussion

Diabetes and obesity are important risk factors for cardiovascular and inflammatory diseases involved in the risk of diabetes (25,26). Furthermore, endothelial dysfunction, characterized by both diabetes and obesity precede abnormal glucose levels characteristic of diabetes and are already present in individuals at known risk for the disease such as those with a positive family history (14,27–33).

Endothelial cells produce NO implicated in vascular relaxation in response to multiple agents including genetic defects (34). Improving endothelial function and insulin sensitivity occur because of weight loss (35). It is therefore possible to suggest that, in obese individuals, genetic polymorphisms such as NOS3 rs1800779(A/G) that influence the basal level of NO in the endothelial cells contribute to diabetes progression.

Many genes have been researched in T2D susceptibility, and the NOS3 gene has been a candidate as a genetic factor for the risk of T2D (12). Several polymorphisms of the NOS3 gene have been studied, and their association with different diseases including inflammation defects has been identified (36).

In the present study, this polymorphism was related to T2D in codominant (AG vs. AA) and dominant (AG+GG vs. AA) models, although no relationship was identified between this variant and risk/protection of T2D in allele and recessive models. Regarding the association between clinical-demographic characteristics and T2D and HC groups, the results presented no association in T2Ds or HCs with BMI as an obesity index. Furthermore, only very a few studies have investigated NOS3 gene polymorphisms associated with T2D, and research on the association between rs1800779(A/G) in the NOS3 gene and diabetes are very rare, so the results could not be compared with similar studies; however, this gene has been investigated regarding some T2D complications.

Chen et al (37) demonstrated that NOS3 rs3918188 and NOS3 rs3918188 genetic variants were statistically associated with increased susceptibility to T2D in the homozygote comparison and recessive model in the Chinese Han population. However, Conen et al (38) identified no association between NOS3 rs1800779 and NOS3 rs3918226 polymorphisms and occurrence of T2D on a total of 24,309 Caucasian women free of diabetes at baseline in a prospective cohort study (37). In a meta-analysis performed by Zintzaras et al (39), a significant association was revealed between endothelial NO synthase gene polymorphisms (G894T) and diabetic nephropathy on 7,401 cases and 8,046 controls. Makuc et al (40) did not find any association between eNOS Glu298Asp and eNOS 4a/b polymorphisms and diabetic nephropathy in a Slovenian population. In another investigation conducted by Chen et al (41) on two West African countries (Ghana and Nigeria), the b/b genotype of G894T polymorphisms [deletion/insertion (4a/b)] of the eNOS gene was associated with the risk of diabetes retinopathy, while other genotypes and alleles of this polymorphism were not associated with diabetes retinopathy, hypertension or nephropathy. There was a statistically significant association between the alleles/genotype distribution of NOS3 (ecNOS4a/4b) with chronic kidney disease (CKD), so that the 4b/4bb gene polymorphism protected from CKD in comparison between T2D patients with CKD and T2D patients without CKD in a Russian Federation population (42). Zakerjafari et al (43) presented a significant association between the NOS3 gene rs1800779 polymorphism and risk of coronary-heart disease in an Iranian population (39). Thus, the rs1800779 of NOS3 gene polymorphism may be associated with T2D, which is in line with findings of the current study. The differences among the above studies may be related to genetic and environmental differences of the study populations.

The deviation from HWE is not clear in the current study population; it may have some reasons, such as relatively small sample size, migration or consanguineous marriages that are common in this region of the Iran (southeast of Iran).

The current study has several limitations. Firstly, based on the published and Pubmed data (https://www.ncbi.nlm.nih.gov/snp/?term=nos3), several NOS3 polymorphisms have been identified in humans, while only one polymorphism was investigated in the present study. This SNP had previously been associated with other inflammation diseases in a previous study (43). Secondly, the authors did not consider differences by diabetes complications. Thirdly, the present study used a relatively small sample size.

In conclusion, a significant association was detected for the first time between the rs1800779(A/G) polymorphism in the NOS3 gene and T2D in an Iranian population. Different ethnic populations and large sample sizes are recommended for future studies to further assess the relationship between T2D and this variant.

Acknowledgements

The authors would like to thank the Zahedan University of Medical Sciences for funding (grant no. 7224) and supporting this work and the patients and healthy subjects who willingly participated in the present study.

References