Low type I interferon response in COVID‑19 patients: Interferon response may be a potential treatment for COVID‑19

  • Authors:
    • Ahmed Abdulwahid Salman
    • Mohammed Hussein Waheed
    • Akeel Abd Ali‑Αbdulsahib
    • Zeenah Weheed Atwan
  • View Affiliations

  • Published online on: March 9, 2021     https://doi.org/10.3892/br.2021.1419
  • Article Number: 43
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Interferons (IFN) are antiviral cytokines that mitigate the effects of invading viruses early on during the infection process. SARS‑CoV and MERS induce weak IFN responses; hence, the clinical trials which included recombinant IFN accompanied with other antiviral drugs exhibited improved results in terms of shortening the duration of illness. The aim of the present study was to evaluate the type I IFN response in COVID‑19 patients to determine whether it is sufficient to eliminate or reduce the severity of the infection, and whether it can be recommended as a potential therapy. Total RNA samples were converted to cDNA and used as templates to evaluate the gene expression levels of IFN regulatory factor (IRF)3 and IFN‑β in COVID‑19 patients or control. The results showed that IRF3 gene expression was upregulated ~250‑fold compared with the negative samples. In contrast, IFN‑β expression increased slightly in COVID‑19 patients. Consistent with other coronaviruses, such as SARS‑CoV and MERS, COVID‑19 infection does not induce an efficient IFN response to reduce the severity of the virus. This may be attributed to an incomplete response of IRF3 in activating the IFN‑β promoter in the infected patients. The results suggest IFN‑β or α may be used as potential treatments.

Introduction

The new coronavirus, termed COVID-19, emerged in Wuhan, China in late 2019. Although the newly emerged virus has a mutation in the sequence of the spike protein, its binding affinity for the angiotensin-converting enzyme 2 (ACE2) receptor is identical to that of the severe acute respiratory syndrome (SARS-CoV)-1(1). The cytokine storm is as a group of inflammatory responses, which includes interleukin (IL)-I, IL-2, IL-6, IL-10 and interferon (IFN)-γ (2), is a serious complication of COVID-19 infection (3-6).

Different types of vaccines are being developed to assist in limiting the spread of the virus, and reduce mortality rates going forward, some of which have been approved by the regulatory bodies of several countries, and are being widely distributed. Various companies are currently developing a vaccine introducing mRNA to produce viral proteins, specifically the spike protein, by the host cells. A more stable DNA vaccine is another option to prevent infection with SARS-CoV-2 using adenovirus plasmids encoding the SARS-CoV-2 spike protein (7,8). Another alternative is to use other viral proteins, usually by recombinant DNA. The inactivated whole SARS-CoV-2 vaccine is also a candidate being assessed in preclinical trials. However, using a SARS-CoV-2 live attenuated vaccine carries potential risks, such as the reactivation or the virulence of SARS-CoV-2 in immunocompromised patients (9).

IFNs were named initially due to their role in interfering with viral infections. Influenza-infected chick cells mounted antiviral resistance states by producing secreted cytokines, which were later termed IFNs (10). IFNs are cytokines that are implicated in antiviral responses, immune induction and regulating cell division (11). The gene expression of type I IFN is primarily regulated at the transcriptional stage, and in the absence of stimulators, such as double-stranded RNA, IFNs are not translated. The lack of the IFN-β gene through gene knockout makes mice vulnerable to infection with viruses, such as vaccinia virus and blocks the IFN-α response (12).

To induce the innate immune response during viral infection, it is essential to stimulate the IFN response. The absence of IFN regulatory factor (IRF)3 or defective IRF7 function decreases the gene expression of IFN-α/β, making mice more sensitive to viral infection (13). IRF3 modulates the innate antiviral response that is triggered by the invading virus. IRF3 is primarily modified by hyperphosphorylation when the virus begins replication (14).

IRF3 and IRF7 are the most common regulators of IFN-β. They replace IRF2, serving a key role in type I IFN responses (15-17). IRF3 and IRF7 have specific binding properties that allow them to bind to the type I IFN promoters, and their ratio to the bound elements modulates the IFN type I response during viral infection (18). However, IRF3 degradation has been reported to repress IFN-β rather than the activation of the transcriptional repressors. The lack of transcriptionally active IRF3 abolishes the activation of IFN-β to the Sendai virus in mouse embryonic fibroblasts (19).

Upon activation, IRF3 molecules translocate to the nucleus after phosphorylation and bind to the ornithine cyclodeaminase or P300 to form complexes in the IFN sensitive response element region (20). Most RNA viruses elicit a type I IFN response in toll-like receptors (TLRs) or independent mechanisms (cytosolic recognition system) through retinoic acid-inducible genes (RIG-1), which sense the viral RNA molecules (21). Moreover, RIG-1 is central to the stimulation of the type I IFN response to RNA virus infection via activation of IRF3 through kinases in fibroblasts and dendritic cells (22). Synthetic or natural dsRNAs are differentially recognised by RIG-1 and melanoma differentiation-associated protein 5 (MAD5), as the former induces production of IFNs to paramyxoviruses, the influenza virus and Japanese encephalitis virus, whereas picornavirus is detected by MAD5(23). As a coronavirus model, the mouse hepatitis virus antagonises the type I IFN through the Nucleocapsid protein (24). Previous outbreaks with SARS and MERS revealed that the virus does not increase the expression of IFN-β or its promoter activity. Therefore, treatments with recombinant interferons were used to boost the effects of antiviral drugs (25,26). Infection with respiratory viruses activates the TLR signalling pathways, and eventually leads to the induction of the type I IFN response. The SARS-CoV-2 infection stimulates the TLR downstream pathway to produce mature-IL-1β. An increase in IL-1β causes lung fibrosis and fever. The virus is more highly infectious in adults than children, which may be explained by the high expression levels of aryl hydrocarbon receptors in children compared with the relatively lower expression levels in adults (27).

The present study evaluated the gene expression of IFN and IRF3 in COVID-19-infected patients compared with the control, suggesting a mechanism for the induction of IFNs, and highlighting IFNs as a therapeutic option for treating COVID-19 patients in clinical trials.

Materials and methods

Sample collection, RNA extraction and reverse transcription quantitative PCR

RNA samples were collected from 30 patients suspected of infection with COVID-19 between February and April 2020 at the Public Health Laboratory in Basrah, Iraq. The age range of the patients was 25-55 years old, whereas that of the non-COVID-19 infected individuals was 28-60 years old. The infected patients included 8 females and 12 males whereas the non-infected individuals consisted of were 3 females and 7 males.

Infection was diagnosed using a LightMix SarbecoV E-gene plus EAV control (cat. no. 40-0776-96). The control samples were negative for COVID-19 and were diagnosed with either the common cold or influenza. The present study was approved by the Public Health Department, Basrah Health Directorate (approval no. F112020). All patients provided signed consent to participate in the present study.

The RNA from nasal swabs (total RNA) was extracted using an easy spin™ total RNA extraction kit (Intron; cat. no. 17221) according to the manufacturer's protocol, and used to evaluate the gene expression of IFN-β and IRF3 in COVID-19-infected or uninfected samples using gene-specific primers. An intron HiSenScript™ (RH-)RT-PCR PreMix transcription kit was used to reverse transcribe the RNA, according to the manufacturer's protocol. Quantitative PCR was performed using SYBR-Green MasterMix, according to the manufacturer's protocol (Bioneer; cat. no. K-6210). The reaction consisted of a mixture of 10 µl SYBR-Green, 3 µl cDNA template, 1 µl each of both the forward and reverse primers against IFN-β (forward, CAACTTGCTTGGATTCCTACAAAG and reverse primer, TATTCAAGCCTCCCATTCAATTG); IRF3 (forward, CGGAAAGAAGTGTTGCGGTTAG and reverse primer, TTTGCCATTGGTGTCAGGAGAG); and β-actin (forward, CCTGGCACCCAGCACAAT and reverse primer, GCCGATCCACACGGAGATCT), and 5 µl free deionised diethylpyrocarbonate D.W. to a final volume of 20 µl. The sequences of the primers are based on previous studies (28,29).

The thermocycling conditions were: Initial denaturation at 94˚C for 5 min; followed by 40 cycles of 15 sec of denaturation at 95˚C, annealing at 58˚C for 30 sec, and an extension step at 72˚C for 45 sec; with a final extension at 72˚C for 5 min. The products were subjected to dissociation curve analysis. Using the 2-∆∆Cq method for analysis of mRNA expression, data were normalised to β-actin, which was used as a housekeeping gene (30).

Statistical analysis

Data are presented as the mean ± standard deviation of three technical repeats per patient. All data were analysed using a Student's t-test. Statistical analysis was performed using Microsoft Excel (Office 365; Microsoft Corporation). P<0.05 was considered to indicate a statistically significant difference.

Results

The RNAs of the COVID-19 positive and negative samples were extracted, reverse transcribed, used as the templates and mixed with IRF3 or IFN-β specific primers to assess their relative expression by qPCR. IRF3 gene expression was significantly (P<0.05) upregulated in the COVID-19-infected patients by ~250-fold compared with the control (uninfected samples) (Fig. 1A and B). Interestingly, IFN-β relative expression was ~1.5-fold higher in the COVID-19-infected samples compared with the control samples (P<0.05) (Fig. 2A and B). The 2-∆∆Cq analysis was used to detect the relative expression after subtracting the β-actin value from each sample, and the control was normalised to 1, to express the results as the fold change.

Discussion

Studies have shown that IRF7 is expressed at a very low level physiologically, and requires activation of a type I interferon response for its induction (31,32). Both MERS and SARS trigger a low level of interferon response (33,34). IRF3 is a key regulator of type I IFN, which triggers the host response against the invading viruses. IRF3 also implicated in unwanted inflammatory responses and septic shock response (35-37). Thus, in the present study, the effects of COVID-19 on an innate immune response were determined.

The results showed that the gene expression levels of IRF3 were notably increased by ~250-fold compared with its expression in the virus-free samples. The increase in the IFN-β levels were not consistent with the increase in the expression of its primary regulator. The results agree with a study concerning coronavirus infection and IFN responses; infection with SARS-CoV does not induce IFN-β production or its promoter activity (38). A lower IFN response was detected in the COVID-19-infected lung tissue compared with SARS, which makes the former virus more sensitive to treatment with a type I IFN (22,39). However, in SARS infections, IRF3 is shown to translocate to the nucleus, independent of nay phosphorylation, dimerization or binding to cAMP response element-binding protein (CREB) binding protein. The SARS-CoV virus may block IRF3 hyperphosphorylation-mediated homodimerization CREB after transport of IRF3 to the nucleus (38).

Another hypothesis suggests that coronaviruses use the IFN-inducible transmembrane proteins (IFITM) to enter the cell, and the IFITM structural motifs required for entry inhibit the entry of other viruses. The IFITM theory explains how the virus can invade the lower respiratory tract (40). Coronaviruses, such as SARS, avoid the inhibitory effects of type I IFNs either through induction of double-membrane vesicles to physically hide the viral RNA intermediates from pattern recognition receptors or by expressing open reading frame (ORF)3, ORF6, ORF7, nucleocapsid protein and non-structural RNA binding protein 1, which when combined, abolish the IRF-3-dependent IFN-β pathway (41,42).

Based on the mechanism by which SARS inhibits the IFN response, recombinant IFNs were used to treat SARS-infected patients. The treatment of human corona Erasmus medical centre (HcoV-EMC) human-infected tissues with the type I or III IFN, 1 h post-infection, decreased the replication of the virus (43). In vitro, treating SARS-CoV-infected Vero and Caco2 cells with human recombinant IFN-β inhibited viral replication in the Caco2 cells by ~5 times compared with the Vero cells (44). Replication of HcoV-EMC was notably reduced when treated with type I or type III IFN in the human airway epithelium culture (43,44).

A delay in the induction of the type I IFN response enables SARS-CoV to replicate efficiently in mice and augments the accumulation of inflammatory monocyte-macrophages (45). A lack of type I and type III IFN responses in signal transducer and activator transcription-1 knockout mice resulted in uncontrolled SARS-CoV replication with both liver and neurological consequences (46). Treatment of MERS-CoV-infected patients with IFN-α2a improved the survival rates to a maximum of 14 days (43). The type I IFN and TLR3 agonist were the most effective combined drugs for SARS/MERS CoV treatment (26).

Regarding COVID-19 infections, a clinical trial showed that treating hospitalised patients with IFN-α2b, either alone or in combination with arbidol, shortened the time of detectable viral presence in upper respiratory infections and reduced the IL-6 and C-reactive protein levels (47). Addition of IFNs to the national regime of treating COVID-19 patients reduced the 28-day mortality rate (48). The antiviral effect was augmented when Lopinavir-ritonavir was administered to mild or moderate cases of COVID-19 in combination with IFN-β 1b, and the enhancing effect was associated with a reduction in symptoms, the length of stay in hospital and viral shedding (49). In terms of COVID-19 infections and IFN responses, it was revealed that the reduced type I IFN levels in the peripheral blood system increased the expression of IL-6 and tumour necrosis factor (50). A limited type I IFN response was detected concomitantly with a large chemokine response, including production of IL-6, in the transcriptomes of SARS-CoV2 infected cells (51). In contrast, increased type I IFN and interferon stimulatory gene responses were reported in COVID-19 hospitalised patients. Several factors may underlie these contradictory results, such as the individual immune systems of patients, duration between initial infection and when the samples were obtained, and the severity of the infection (52).

Based on the similarities between the results of the present study and previous studies regarding the pattern of IFN responses, it is hypothesized that IFNs may be used as a potential treatment for management of COVID-19 infections. However, the present study has some limitations. The data assessed was done so irrespective of the severity of infections. Additionally, clinical trials will be required to assess both the safety and efficacy of IFN in managing COVID-19 infections.

In conclusion, increases in the gene expression of the key regulator of type I interferon was not shown to be effective and efficient in mounting an interferon response.

Acknowledgements

Not applicable.

Availability of data and materials

The datasets used and/or analysed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

AAS and MHW completed the RNA extraction and SARS-CoV-2 diagnosis. AAA-A and ZWA achieved the gene expression of the target gene and data analysis. The writing of the study was mainly conducted by ZWA. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Health Directorate (approval no. F112020) and according to an application that was made by the authors. All patients provided signed consent to participate in the present study and gave their written consent to publish any corresponding data.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Docea AO, Tsatsakis A, Albulescu D, Cristea O, Zlatian O, Vinceti M, Moschos SA, Tsoukalas D, Goumenou M, Drakoulis N, et al: A new threat from an old enemy: Re emergence of coronavirus (Review). Int J Mol Med. 45:1631–1643. 2020.PubMed/NCBI View Article : Google Scholar

2 

Tsatsakis A, Petrakis D, Nikolouzakis TK, Docea AO, Calina D, Vinceti M, Goumenou M, Kostoff RN, Mamoulakis C, Aschner M, et al: COVID-19, an opportunity to reevaluate the correlation between long-term effects of anthropogenic pollutants on viral epidemic/pandemic events and prevalence. Food Chem Toxicol. 141(111418)2020.PubMed/NCBI View Article : Google Scholar

3 

Conti P, Caraffa A, Gallenga CE, Ross R, Kritas SK, Frydas I, Younes A and Ronconi G: Coronavirus-19 (SARS-CoV-2) induces acute severe lung inflammation via IL-1 causing cytokine storm in COVID-19: A promising inhibitory strategy. J Biol Regul Homeost Agents. 34:1971–1975. 2020.PubMed/NCBI View Article : Google Scholar

4 

Shi H, Wang W, Yin J, Ouyang Y, Pang L, Feng Y, Qiao L, Guo X, Shi H, Jin R, et al: The inhibition of IL-2/IL-2R gives rise to CD8+ T cell and lymphocyte decrease through JAK1-STAT5 in critical patients with COVID-19 pneumonia. Cell Death Dis. 11(429)2020.PubMed/NCBI View Article : Google Scholar

5 

Del Valle DM, Kim-Schulze S, Huang HH, Beckmann ND, Nirenberg S, Wang B, Lavin Y, Swartz TH, Madduri D, Stock A, et al: An inflammatory cytokine signature predicts COVID-19 severity and survival. Nat Med. 26:1636–1643. 2020.PubMed/NCBI View Article : Google Scholar

6 

Han H, Ma Q, Li C, Liu R, Zhao L, Wang W, Zhang P, Liu X, Gao G, Liu F, et al: Profiling serum cytokines in COVID-19 patients reveals IL-6 and IL-10 are disease severity predictors. Emerg Microbes Infect. 9:1123–1130. 2020.PubMed/NCBI View Article : Google Scholar

7 

Zhu FC, Guan XH, Li YH, Huang JY, Jiang T, Hou LH, Li JX, Yang BF, Wang L, Wang WJ, et al: Immunogenicity and safety of a recombinant adenovirus type-5-vectored COVID-19 vaccine in healthy adults aged 18 years or older: A randomised, double-blind, placebo-controlled, phase 2 trial. Lancet. 396:479–488. 2020.PubMed/NCBI View Article : Google Scholar

8 

Yu J, Tostanoski LH, Peter L, Mercado NB, McMahan K, Mahrokhian SH, Nkolola JP, Liu J, Li Z, Chandrashekar A, et al: DNA vaccine protection against SARS-CoV-2 in rhesus macaques. Science. 369:806–811. 2020.PubMed/NCBI View Article : Google Scholar

9 

Calina D, Docea AO, Petrakis D, Egorov AM, Ishmukhametov AA, Gabibov AG, Shtilman MI, Kostoff R, Carvalho F, Vinceti M, et al: Towards effective COVID-19 vaccines: Updates, perspectives and challenges (Review). Int J Mol Med. 46:3–16. 2020.PubMed/NCBI View Article : Google Scholar

10 

Isaacs A and Lindenmann J: Virus interference. I. The interferon. Proc R Soc Lond B Biol Sci. 147:258–267. 1957.PubMed/NCBI View Article : Google Scholar

11 

Vilcek J and Sen GC: Interferons and other cytokines. In: Fields Virology. Fields BN, Knipe DM and Howley PM (eds). 3rd edition. Lippincott-Raven Publishers, Philadelphia, PA, pp375-399, 1996.

12 

Deonarain R, Alcami A, Alexiou M, Dallman MJ, Gewert DR and Porter AC: Impaired antiviral response and alpha/β interferon induction in mice lacking beta interferon. J Virol. 74:3404–3409. 2000.PubMed/NCBI View Article : Google Scholar

13 

Sato M, Suemori H, Hata N, Asagiri M, Ogasawara K, Nakao K, Nakaya T, Katsuki M, Noguchi S, Tanaka N, et al: Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha/beta gene induction. Immunity. 13:539–548. 2000.PubMed/NCBI View Article : Google Scholar

14 

Collins SE, Noyce RS and Mossman KL: Innate cellular response to virus particle entry requires IRF3 but not virus replication. J Virol. 78:1706–1717. 2004.PubMed/NCBI View Article : Google Scholar

15 

Taniguchi T, Ogasawara K, Takaoka A and Tanaka N: IRF family of transcription factors as regulators of host defense. Annu Rev Immunol. 19:623–655. 2001.PubMed/NCBI View Article : Google Scholar

16 

Garoufalis E, Kwan I, Lin R, Mustafa A, Pepin N, ARoulston A, Lacoste J and Hiscott J: Viral induction of the human beta interferon promoter: modulation of transcription by NF-kappaB/rel proteins and interferon regulatory factors. J Virol. 68:4707–4715. 1994.PubMed/NCBI View Article : Google Scholar

17 

Paun A and Pitha PM: The IRF family, revisited. Biochimie. 89:744–753. 2007.PubMed/NCBI View Article : Google Scholar

18 

Génin P, Vaccaro A and Civas A: The role of differential expression of human interferon - a genes in antiviral immunity. Cytokine Growth Factor Rev. 20:283–295. 2009.PubMed/NCBI View Article : Google Scholar

19 

Ye J and Maniatis T: Negative regulation of interferon-beta gene expression during acute and persistent virus infections. PLoS One. 6(e20681)2011.PubMed/NCBI View Article : Google Scholar

20 

Weaver BK, Kumar KP and Reich NC: Interferon regulatory factor 3 and CREB-binding protein/p300 are subunits of double-stranded RNA-activated transcription factor DRAF1. Mol Cell Biol. 18:1359–1368. 1998.PubMed/NCBI View Article : Google Scholar

21 

Takeuchi O and Akira S: MDA5/RIG-I and virus recognition. Curr Opin Immunol. 20:17–22. 2008.PubMed/NCBI View Article : Google Scholar

22 

Kato H, Sato S, Yoneyama M, Yamamoto M, Uematsu S, Matsui K, Tsujimura T, Takeda K, Fujita T, Takeuchi O, et al: Cell type-specific involvement of RIG-I in antiviral response. Immunity. 23:19–28. 2005.PubMed/NCBI View Article : Google Scholar

23 

Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, Uematsu S, Jung A, Kawai T, Ishii KJ, et al: Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature. 441:101–105. 2006.PubMed/NCBI View Article : Google Scholar

24 

Ye Y, Hauns K, Langland JO, Jacobs BL and Hogue BG: Mouse hepatitis coronavirus A59 nucleocapsid protein is a type I interferon antagonist. J Virol. 81:2554–2563. 2007.PubMed/NCBI View Article : Google Scholar

25 

Huang Z and Tunnacliffe A: Response of human cells to desiccation: comparison with hyperosmotic stress response. J Physiol. 558:181–191. 2004.PubMed/NCBI View Article : Google Scholar

26 

Strayer DR, Dickey R and Carter WA: Sensitivity of SARS/MERS CoV to interferons and other drugs based on achievable serum concentrations in humans. Infect Disord Drug Targets. 14:37–43. 2014.PubMed/NCBI View Article : Google Scholar

27 

Tsatsakis A, Calina D, Falzone L, Petrakis D, Mitrut R, Siokas V, Pennisi M, Lanza G, Libra M, Doukas SG, et al: SARS-CoV-2 pathophysiology and its clinical implications: An integrative overview of the pharmacotherapeutic management of COVID-19. Food Chem Toxicol. 146(111769)2020.PubMed/NCBI View Article : Google Scholar

28 

Nakamura M, Funami K, Komori A, Yokoyama T, Aiba Y, Araki A, Takii Y, Ito M, Matsuyama M, Koyabu M, et al: Increased expression of Toll-like receptor 3 in intrahepatic biliary epithelial cells at sites of ductular reaction in diseased livers. Hepatol Int. 2:222–230. 2008.PubMed/NCBI View Article : Google Scholar

29 

Liu LM, Tu WJ, Zhu T, Wang XT, Tan ZL, Zhong H, Gao DY and Liang DY: IRF3 is an important molecule in the UII/UT system and mediates immune inflammatory injury in acute liver failure. Oncotarget. 7:49027–49041. 2016.PubMed/NCBI View Article : Google Scholar

30 

Xu RH, Schuster DM, Lee JE, Smith M, Potter J, Dhariwal G, Rosenthal K, Nathan M, Gerard GF and Rashtchian A: One-step analysis and quantification of RNA by RT-PCR: Using high-temperature reverse transcription. Focus. 22:3–5. 2000.

31 

Génin P, Morin P and Civas A: Impairment of interferon-induced IRF-7 gene expression due to inhibition of ISGF3 formation by trichostatin A. J Virol. 77:7113–7119. 2003.PubMed/NCBI View Article : Google Scholar

32 

de Lang A, Baas T, Smits SL, Katze MG, Osterhaus AD and Haagmans BL: Unraveling the complexities of the interferon response during SARS-CoV infection. Future Virol. 4:71–78. 2009.PubMed/NCBI View Article : Google Scholar

33 

Chan RW, Chan MC, Agnihothram S, Chan LL, Kuok DI, Fong JH, Guan Y, Poon LL, Baric RS, Nicholls JM, et al: Tropism of and innate immune responses to the novel human betacoronavirus lineage C virus in human ex vivo respiratory organ cultures. J Virol. 87:6604–6614. 2013.PubMed/NCBI View Article : Google Scholar

34 

Tang BS, Chan KH, Cheng VC, Woo PC, Lau SK, Lam CC, Chan TL, Wu AK, Hung IF, Leung SY, et al: Comparative host gene transcription by microarray analysis early after infection of the Huh7 cell line by severe acute respiratory syndrome coronavirus and human coronavirus 229E. J Virol. 79:6180–6193. 2005.PubMed/NCBI View Article : Google Scholar

35 

Au WC, Moore PA, Lowther W, Juang YT and Pitha PM: Identification of a member of the interferon regulatory factor family that binds to the interferon-stimulated response element and activates expression of interferon-induced genes. Proc Natl Acad Sci USA. 92:11657–11661. 1995.PubMed/NCBI View Article : Google Scholar

36 

Atwan Z, Wright J, Woodman A and Leppard KN: Promyelocytic leukemia protein isoform II inhibits infection by human adenovirus type 5 through effects on HSP70 and the interferon response. J Gen Virol. 97:1955–1967. 2016.PubMed/NCBI View Article : Google Scholar

37 

Walker WE, Bozzi AT and Goldstein DR: IRF3 contributes to sepsis pathogenesis in the mouse cecal ligation and puncture model. J Leukoc Biol. 92:1261–1268. 2012.PubMed/NCBI View Article : Google Scholar

38 

Spiegel M, Pichlmair A, Martínez-Sobrido L, Cros J, García-Sastre A, Haller O and Weber F: Inhibition of Beta interferon induction by severe acute respiratory syndrome coronavirus suggests a two-step model for activation of interferon regulatory factor 3. J Virol. 79:2079–2086. 2005.PubMed/NCBI View Article : Google Scholar

39 

Loukugamage KG, Hage A, de Vries M, Valero-Jimenez AM, Schindewolf C, Dittmann M, Rajsbaum R and Menachery VD: SARS-CoV-2 sensitive to type I interferon pretreatment. bioRxiv: Apr 9, 2020 (Epub ahead of print). doi: 10.1101/2020.03.07.982264.

40 

Zhao X, Guo F, Liu F, Cuconati A, Chang J, Block TM and Guo JT: Interferon induction of IFITM proteins promotes infection by human coronavirus OC43. Proc Natl Acad Sci USA. 111:6756–6761. 2014.PubMed/NCBI View Article : Google Scholar

41 

Snijder EJ, van der Meer Y, Zevenhoven-Dobbe J, Onderwater JJ, van der Meulen J, Koerten HK and Mommaas AM: Ultrastructure and origin of membrane vesicles associated with the severe acute respiratory syndrome coronavirus replication complex. J Virol. 80:5927–5940. 2006.PubMed/NCBI View Article : Google Scholar

42 

Stertz S, Reichelt M, Spiegel M, Kuri T, Martinez-Sobrido L, Garcia-Sastre A, Weber F and Koch G: The intracellular sites of early replication and budding of SARS-coronaviru. Virology. 361:304–315. 2007.PubMed/NCBI View Article : Google Scholar

43 

Cinatl J, Morgenstern B, Bauer G, Chandra P, Rabenau H and Doerr HW: Treatment of SARS with human interferons. Lancet. 362:293–294. 2003.PubMed/NCBI View Article : Google Scholar

44 

Mahlakõiv T, Ritz D, Mordstein M, DeDiego ML, Enjuanes L, Müller MA, Drosten C and Staeheli P: Combined action of type I and type III interferon restricts initial replication of severe acute respiratory syndrome coronavirus in the lung but fails to inhibit systemic virus spread. J Gen Virol. 93:2601–2605. 2012.PubMed/NCBI View Article : Google Scholar

45 

Channappanavar R, Fehr AR, Vijay R, Mack M, Zhao J, Meyerholz DK and Perlman S: Dysregulated type I interferon and inflammatory monocyte-macrophage responses cause lethal pneumonia in SARS-CoV-infected mice. Cell Host Microbe. 19:181–193. 2016.PubMed/NCBI View Article : Google Scholar

46 

Zhou Q, Chen V, Shannon CP, Wei XS, Xiang X, Wang X, Wang ZH, Tebbutt SJ, Kollmann TR and Fish EN: Interferon-α2b Treatment for COVID-19. Front Immunol. 11(1061)2020.PubMed/NCBI View Article : Google Scholar

47 

Davoudi-Monfared E, Rahmani H, Khalili H, Hajiabdolbaghi M, Salehi M, Abbasian L, Kazemzadeh H and Yekaninejad MS: A randomized clinical trial of the efficacy and safety of interferon beta-1a in treatment of severe COVID-19. Antimicrob Agents Chemother. 64:e01061–e20. 2020.PubMed/NCBI View Article : Google Scholar

48 

Hung IF, Lung KC, Tso EY, Liu R, Chung TW, Chu MY, Ng YY, Lo J, Chan J, Tam AR, et al: Triple combination of interferon beta-1b, lopinavir-ritonavir, and ribavirin in the treatment of patients admitted to hospital with COVID-19: an open-label, randomised, phase 2 trial. Lancet. 395:1695–1704. 2020.PubMed/NCBI View Article : Google Scholar

49 

Hadjadj J, Yatim N, Barnabei L, Corneau A, Boussier J, Smith N, Péré H, Charbit B, Bondet V, Chenevier-Gobeaux C, et al: Impaired type I interferon activity and inflammatory responses in severe COVID-19 patients. Science. 369:718–724. 2020.PubMed/NCBI View Article : Google Scholar

50 

Blanco-Melo D, Nilsson-Payant BE, Liu WC, Uhl S, Hoagland D, Møller R, Jordan TX, Oishi K, Panis M, Sachs D, et al: Imbalanced Host Response to SARS-CoV-2 Drives Development of COVID-19. Cell. 181:1036–1045.e9. 2020.PubMed/NCBI View Article : Google Scholar

51 

Wilk AJ, Rustagi A, Zhao NQ, Roque J, Martínez-Colón GJ, McKechnie JL, Ivison GT, Ranganath T, Vergara R, Hollis T, et al: A single-cell atlas of the peripheral immune response in patients with severe COVID-19. Nat Med. 26:1070–1076. 2020.PubMed/NCBI View Article : Google Scholar

52 

Lee JS and Shin EC: The type I interferon response in COVID-19: Implications for treatment. Nat Rev Immunol. 20:585–586. 2020.PubMed/NCBI View Article : Google Scholar

Related Articles

Journal Cover

May-2021
Volume 14 Issue 5

Print ISSN: 2049-9434
Online ISSN:2049-9442

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Salman AA, Waheed MH, Ali‑Αbdulsahib AA and Atwan ZW: Low type I interferon response in COVID‑19 patients: Interferon response may be a potential treatment for COVID‑19. Biomed Rep 14: 43, 2021
APA
Salman, A.A., Waheed, M.H., Ali‑Αbdulsahib, A.A., & Atwan, Z.W. (2021). Low type I interferon response in COVID‑19 patients: Interferon response may be a potential treatment for COVID‑19. Biomedical Reports, 14, 43. https://doi.org/10.3892/br.2021.1419
MLA
Salman, A. A., Waheed, M. H., Ali‑Αbdulsahib, A. A., Atwan, Z. W."Low type I interferon response in COVID‑19 patients: Interferon response may be a potential treatment for COVID‑19". Biomedical Reports 14.5 (2021): 43.
Chicago
Salman, A. A., Waheed, M. H., Ali‑Αbdulsahib, A. A., Atwan, Z. W."Low type I interferon response in COVID‑19 patients: Interferon response may be a potential treatment for COVID‑19". Biomedical Reports 14, no. 5 (2021): 43. https://doi.org/10.3892/br.2021.1419