Low molecular weight sulfated galactan attenuates imiquimod‑induced psoriasis via suppression of proinflammatory cytokines and keratinocyte hyperproliferation

Introduction

Psoriasis is a chronic immune-mediated inflammatory skin disease characterized by keratinocyte hyperproliferation and infiltration of inflammatory cells, including CD4+ T and mast cells, into the skin (1). Although the precise molecular mechanisms underlying psoriasis pathogenesis are not completely understood, accumulating evidence highlights a key role for T helper 17 (Th17) cells as the primary source of IL-17, a key cytokine in psoriasis development (2,3). Th17 cells differentiate from naïve CD4+ T cells primarily in response to IL-23 through activation of the JAK2/STAT3 signaling pathway (4,5). Thus, the IL-23/IL-17 axis is key to the immunopathogenesis of psoriasis (4). During disease onset, proinflammatory cytokines such as tumor necrosis factor (TNF)-α and IL-1β promote abnormal keratinocyte proliferation and differentiation (6). These cytokines suppress keratin 10 expression while upregulating involucrin and keratins 6, 16 and 17, which serve as molecular markers of psoriatic lesions (7). This dysregulation reflects keratinocyte activation and contributes to hallmark histopathological features of psoriasis, including epidermal hyperplasia, parakeratosis and acanthosis (8).

Although various therapeutic agents for psoriasis such as methotrexate, cyclosporine, retinoic acid, vitamin D3 analogs and biological agents such as alefacept are widely used, a definitive cure remains elusive (2,3). Moreover, long-term use of certain agents, including cyclosporine and retinoic acid, is associated with significant adverse effects (9). As a result, alternative strategies, including combination therapies involving conventional and biological agents, have been explored. However, these approaches are limited by cumulative toxicity and safety concerns (10). Therefore, the development of novel, safe and effective therapeutic options for psoriasis remains a clinical need.

Marine algae are regarded as the ‘plant-based therapy of the future’ due to their abundance of health-promoting compounds with activity against various diseases and disorders (11). One of the most notable components of seaweeds is their high content of sulfated polysaccharides (SPs). SPs derived from seaweeds exhibit a broad spectrum of biological activities, including anti-inflammatory, immunomodulatory, antioxidant and antiviral effects, making them promising candidates for pharmaceutical and nutraceutical applications (12). Gracilaria fisheri, a species commonly found in Thailand, is rich in sulfated galactan (SG), a type of SP known for its diverse biological properties, especially its anti-inflammatory and immunomodulatory effects (13). Determining molecular characteristics such as molecular weight is key for enhancing the biological activity of SPs (14). Our previous study prepared low molecular weight SG (LSG) from G. fisheri and demonstrated its superior antioxidant activity compared with SG (15). Oligosaccharides derived from G. fisheri modulate immune responses by inhibiting proinflammatory cytokines such as TNF-α and IL-1β, which are key mediators in psoriasis pathogenesis (13). Moreover, SG has been shown to interfere with signaling pathways such as NF-κB and JAK/STAT, which serve central roles in the regulation of inflammatory gene expression (16,17).

Given these properties, LSG derived from G. fisheri presents a promising candidate for the development of novel anti-psoriatic agents. The present study employed an imiquimod (IMQ)-induced psoriasis-like mouse model to evaluate the therapeutic potential of LSG from G. fisheri.

Materials and methods

LSG

LSG was prepared using a previously established method (18). SG was isolated from the red seaweed G. fisheri using a cold-water extraction method as described by Wongprasert et al (19). SG was stirred in 0.1 M HCl (RCI Labscan Ltd.; ratio 10:1) for 6 h at room temperature. The mixture was neutralized to pH 8 and precipitated with 95% ethanol (RCILabscan). The resulting pellet was collected, re-suspended in distilled water and dialyzed against distilled water in a dialysis bag for 24 h. LSG was obtained by freeze-drying overnight at -60˚C. The chemical structure and molecular weight of LSG were confirmed by fourier transform infrared (FTIR), nuclear magnetic resonance (NMR) and gel permeation chromatography (GPC) analyses. LSG (2 mg) was analyzed using FTIR spectroscopy with an IRAffinity-1S (IR) and MIRacle 10 (ATR; Shimadzu). The compound was transferred to a film and analyzed. Spectral baselines were corrected to the 400-4,000 cm-¹ range. For NMR analysis, LSG (10 mg) was dissolved in deuterium oxide (D2O, 99.9%; 0.5 ml) in 5 mm NMR tubes and analyzed using a Varian Bruker 400 MHz spectrometer. For GPC, LSG was dissolved in deionized water (1:1 w/v), and 20 µl of the solution was analyzed using a Shimadzu LC-20AD system with an LC-20A oven column and a RID-10A detector, equipped with a TSKgel Guard PWH Size Exclusion Guard column. The column temperature was maintained at 60.0±0.1˚C.

Animal model

Male BALB/c mice (n=48; age, 6-8 weeks; average weight, 23.96±1.34 grams) were purchased from Nomura International Siam (Bangkok, Thailand). All animals were housed under SPF conditions with controlled humidity (50-70%), temperature (25±2˚C) and a 12/12-h light/dark cycle. Mice had free access to a standard pellet diet and water ad libitum throughout the experiment. All experimental procedures were approved by the Ethical Committee of the University of Phayao, Phayao, Thailand (approval no. 1-024-65).

IMQ-induced psoriasis and experimental design

The dorsal hair of BALB/c mice was removed 1 day before starting the experiment. IMQ cream (5% IMQ; Aldara™, Ensign Laboratories Pty Ltd.) was applied daily at a topical dose of 62.5 mg for 7 consecutive days to establish an IMQ-induced psoriasis mouse model characterized by moderate-to-severe psoriasis-like skin lesions, including pronounced erythema, scale formation, epidermal thickening and inflammatory cell infiltration, corresponding to Psoriasis Area and Severity Index (PASI) scores of 2-3 for each parameter (20,21). MTX was used as a positive control because it is commonly used as a first-line treatment for moderate-to-severe plaque psoriasis (22). The concentration of 5.0 mg/kg LSG was selected based on previous studies (23,24). The mice were randomly divided into six groups (n=8/group) as follows: i) Normal control (NC), mice were intraperitoneally injected with 200 µl normal saline, followed by the topical application of petroleum cream (Chemipan Corporation Co., Ltd.); ii) methotrexate (MTX) control, mice were intraperitoneally injected with 200 µl 1.0 mg/kg MTX, followed by the topical application of petroleum cream; iii) LSG control, mice were intraperitoneally injected with 200 µl 5.0 mg/kg LSG, followed by the topical application of petroleum cream; iv) IMQ, mice were intraperitoneally injected with 200 µl normal saline, followed by the topical application of IMQ cream; v) MTX + IMQ, mice were intraperitoneally injected with 200 µl 1.0 mg/kg MTX, followed by the topical application of IMQ cream; and vi) LSG + IMQ, mice were intraperitoneally injected with 200 µl 5.0 mg/kg LSG, followed by the topical application of IMQ cream (Fig. S1). After 7 days of treatment, all mice were anesthetized with 5% isoflurane in oxygen and maintained at 1.5-3%, followed by cervical dislocation. The thoracic cavity was opened, and blood was collected via cardiac puncture. Skin lesions, lymph nodes, spleen, kidney and liver were harvested for further analysis.

Assessment of PASI

The severity of skin lesions was assessed using a modified human scoring system based on PASI (21,25). Mice were evaluated daily for erythema, scaling and thickening. Each parameter was scored independently on a scale from 0 to 4 (0, none; 1, mild; 2, moderate; 3, marked; 4, obvious; Table I) (21). The cumulative score was used to evaluate the overall severity of skin inflammation.

Table I Descriptive Psoriasis Area and Severity Index scores in a mouse model following imiquimod induction.

Table I

Descriptive Psoriasis Area and Severity Index scores in a mouse model following imiquimod induction.

	Score
Sign	0	1	2	3	4
Erythema (redness)	Normal flesh tone (faint cuts may be visible but not prominent)	Slight redness over the skin surface	Noticeable uniform redness	Pronounced redness with scattered dark red areas	Intense, dark red coloration
Thickness	No thickening, skin remains soft and flexible	Mild puckering with no measurable increase in thickness (~1 mm)	Thickness of 1-2 mm upon pinching, with ridges visible in some regions	Thickness >2 mm upon pinching, with ridges easily noticeable	Thickness >2 mm without pinching; ridges appear tight and distinct
Scaling (desquamation)	No evidence of flaking	Small, localized dry spots without peeling	Dry patches covering most of the surface, with flaking in creases	Moderate flaking affecting a large portion of the surface	Extensive and severe flaking over a wide surface area, particularly pronounced involvement in certain regions

Body and lymphatic organ weight

Body weight was recorded on days 1, 3, 5 and 7 of administration. On day 8, the mice were euthanized, and right axillary lymph nodes and spleens were removed, cleaned and weighed. The weights of the right axillary lymph nodes and spleens were normalized to body weight to calculate the organ index.

Histopathological analysis

Skin lesions were collected, fixed in 4% paraformaldehyde for 48 h at 4˚C and embedded in paraffin. Paraffin blocks were sectioned at 4 µm thickness using a rotary microtome. Tissue sections were deparaffinized with xylene and rehydrated through a descending graded ethanol series. Sections were stained with Mayer's hematoxylin (cat. no. 05-06002/L) and Eosin Y alcoholic solution (cat. no. 05-11007/L; both Bio Optica Milano SpA). Sections were dehydrated, cleared, mounted and cover slipped for histopathological observation under a light microscope. Epidermal and dermal thickness were measured in four randomly selected areas of view/section at 10X magnification using ImageJ software version 1.32j (National Institutes of Health). To visualize blood vessels in the skin lesions, Periodic Acid-Schiff (PAS) staining was performed using a PAS staining kit (cat. no. 1.01646.0001, Sigma-Aldrich; Merck KGaA) according to the manufacturer's protocol (26). Additionally, Giemsa staining was performed using Giemsa solution (cat. no. RA-002-05, Biotechnical Co., Ltd.), following the method described by Pudgerd et al (27). Stained sections were observed and photographed under a light microscope. Mast cells were counted manually in four randomly selected fields of view/section at 10X magnification.

Immunohistochemistry analysis

Skin lesions were fixed in 4% paraformaldehyde for 48 h at 4˚C and embedded in paraffin. Paraffin blocks were sectioned at 4 µm thickness. Tissue sections were deparaffinized with xylene and rehydrated through a descending graded ethanol series. Tissue sections were incubated in 3% H2O2 for 15 min to block endogenous peroxidase activity, followed by antigen retrieval using Tris-EDTA buffer (pH 9.0) at 100˚C for 20 min, and washed with 1X PBS-T (0.05% Tween 20). Tissue sections were incubated with protein blocking solution (0.5% BSA, 0.5% casein in PBS; cat. no. AB64226, Abcam) for 1 h at room temperature. Sections were incubated with primary antibodies against CD4+ (rabbit monoclonal anti-CD4+, cat. no. ab183685, Abcam; 1:50) and Ki67 (rabbit polyclonal anti-Ki67, cat. no. ab15580, Abcam; 1:100) for 3 h at room temperature. Following washing with 1X PBS-T, sections were incubated with peroxidase-conjugated secondary antibody (AffiniPure goat anti-rabbit IgG H&L, cat. no. 111-035-003, Jackson ImmunoResearch Laboratories, Inc.; 1:500) for 1 h at room temperature. Positive signals were developed using NOVA Red substrate (cat. no. SK-4800, Vector Laboratories, Inc.; Maravai LifeSciences) and counterstained with Mayer's hematoxylin for 20 sec at room temperature. For quantitative analysis, slides were imaged at 10X magnification under a light microscope. CD4+ and Ki67-positive cells were counted manually in four randomly selected areas of view/section.

Cytokine ELISA

Skin tissue and blood serum samples were collected to assess cytokine levels using ELISA kits. Dorsal skin was excised and any attached connective tissue was removed. A 0.1 cm2 section of tissue was homogenized in 1 ml normal saline using a tissue homogenizer. The homogenate was centrifuged at 2,500 x g for 15 min at 4˚C. The supernatant was collected and stored at -20˚C until analysis. For blood serum, samples were allowed to clot at room temperature for 30 min, followed by centrifugation at 2,500 x g for 15 min at 4˚C. The serum was separated and stored at -20˚C until use (27). Cytokine concentrations including IL-1β (ELISA MAX™ Deluxe Set Mouse IL-1β kit, cat. no. 432604), TNF-α (cat. no. 430904), IL-17A (cat. no. 432504), and IL-23 (cat. no. 433704), were measured using commercial ELISA kits, according to the manufacturer's protocols (all BioLegend, Inc.). Absorbance was measured at 450 nm using a VersaMax™ microplate reader and data were analyzed with SoftMax Pro software version 6 (Molecular Devices, LLC).

Reverse transcription-quantitative (RT-q)PCR

Total RNA was extracted from skin tissue using TRI Reagent® (Molecular Research Center, Inc., cat. no. TR118) according to the manufacturer's instructions. A total of 1 µg total RNA was reverse-transcribed into cDNA using the iScript™ Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Inc.; cat. no. 1708840). All RT-qPCR assays were conducted using the QIAquant Real-Time PCR Thermal Cycler (Qiagen, Inc.) with the SensiFAST™ SYBR® No-ROX Kit (Bioline, cat. no. BIO-98050), according to the manufacturer's protocols. Thermocycling conditions were as follows: Initial denaturation at 95˚C for 2 min, followed by 40 cycles of 95˚C for 5 sec, 60˚C for 10 sec of annealing, and 72˚C for 20 sec of extension. Relative gene expression of IL-1β, TNF-α, keratin 6, 16 and 17, involucrin, JAK1, 2 and 3, STAT1, 2 and 3, BCL2 and CCND1 was normalized to β-actin and calculated using the 2-ΔΔCq method (28). Primer sequences for all target genes are listed in Table II.

Table II Primer sequences.

Table II

Primer sequences.

Gene	Primer	Sequence, 5'→3'	Accession no.	(Refs.)
Keratin 6	Forward	GTGGCCTCAGCTCTTCTACC	BC080820.1	(27)
	Reverse	TCTGAGCACGGGATTCTGC
Keratin 16	Forward	TGGATGGCGAGAATATCCACAG	AF064006.1	(27)
	Reverse	GCTCCTTGAGGATGGACCG
Keratin 17	Forward	GCCCACCTGACTCAGTACAA	BC032161.2	(27)
	Reverse	GGAGCTGAGTCCTTAACGGG
Involucrin	Forward	ATGTCCCATCAACACACACTG	NM_008412.3	(27)
	Reverse	TGGAGTTGGTTGCTTTGCTTG
JAK1	Forward	CTCCGAACCGAATCATCACT	NM_146145.2	(55)
	Reverse	GCCGTTTTTCTGCTTCTTTG
JAK2	Forward	TTGTGGTATTACGCCTGTGTATC	L16956.1	(56)
	Reverse	ATGCCTGGTTGACTCGTCTAT
JAK3	Forward	CCATCACGTTAGACTTTGCCA	L40172.1	(56)
	Reverse	GGCGGAGAATATAGGTGCCTG
STAT1	Forward	TCACAGTGGTTCGAGCTTCAG	NM_001205313.1	(56)
	Reverse	GCAAACGAGACATCATAGGCA
STAT2	Forward	TCCTGCCAATGGACGTTCG	NM_019963.2	(56)
	Reverse	GTCCCACTGGTTCAGTTGGT
STAT3	Forward	AGCAGAATCTCAACTTCAGACC	NM_213660.4	(57)
	Reverse	TTCGTGGTAAACTGGACACC
BCL2	Forward	AGGAGCAGGTGCCTACAAGA	AH001858.2	(55)
	Reverse	GCATTTTCCCACCACTGTCT
CCND1	Forward	GCGTACCCTGACACCAATCT	NM_007631.3	(55)
	Reverse	ATCTCCTTCTGCACGCACTT
β-actin	Forward	GGCTGTATTCCCCTCCATCG	NM_007393.5	(27)
	Reverse	CCAGTTGGTAACAATGCCATGT

Western blot analysis

Total protein from skin tissue was extracted using lysis buffer containing 20 mM Tris-HCL, 100 mM NaCl, 5 mM phenylmethylsulfonyl fluoride and 100X protease inhibitor solution. Protein concentration was determined with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). A total of 50 µg protein/lane was separated on a 12.5% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was blocked with 2% BSA (cat. no. 112018, Merck KGaA) in TBS-T (100 mM Tris-base, 150 mM NaCl, 0.1% Tween 20) for 2 h at room temperature and incubated overnight at 4˚C with primary antibodies (1:1,000) against mouse anti-Ki67 (cat. no. 14569982, Invitrogen, Thermo Fisher Scientific, Inc.), rabbit anti-TNF-α (cat. no. 3707S), mouse anti-IL-6 (cat. no. 12019S), rabbit anti-IL-10 (cat. no. 12163S; all Cell Signaling Technology Inc.) and rabbit anti-β-actin (cat. no. 4970S, Cell Signaling Technology, Inc.). After three washes with TBS-T for 10 min each, the membranes were incubated with HRP-conjugated secondary antibody (1:2,000; cat. nos. 31460 and 626520; Invitrogen, Thermo Fisher Scientific, Inc.) for 1 h at room temperature. Membranes were washed with TBS-T and immunoreactivity was visualized using the Clarity™ Western ECL substrate kit (Bio-Rad Laboratories, Inc.). Protein bands were detected using the Amersham™ ImageQuant™ 800 biomolecular imager (Cytiva). Relative protein expression was quantified using ImageJ software version 1.32j (National Institutes of Health), with band intensities normalized to β-actin.

Statistical analysis

All data are presented as mean ± SD of triplicate experiments. Statistical analysis was performed using one-way ANOVA followed by Tukey's post hoc multiple comparison test. P<0.05 was considered to indicate a statistically significant difference. All statistical analyses were performed using GraphPad Prism software, version 10.3.1.509 (Dotmatics).

Results

Effect of LSG on psoriatic skin lesions in IMQ-induced mouse model of psoriasis

LSG had a molecular weight of 7.87 kDa and consisted of complex structures with alternating 3-linked β-D-galactopyranose and 4-linked 3,6-anhydro-α-L-galactopyranose or α-L-galactopyranose-6- sulfate units (Fig. S2) (18).

To investigate whether LSG ameliorated skin lesions in psoriasis, IMQ was applied to induce a psoriasis-like mouse model, with and without LSG treatment, and compared with MTX treatment. Mice treated with IMQ exhibited rapid proliferation of immune cells and keratinocytes, leading to increased cytokine production. This mimics the features of human plaque psoriasis, which is characterized by erythema, skin thickening, scaling, and epidermal changes associated with increased inflammation and vascular alterations (29). Symptoms of the psoriatic condition were observed over 7 days of continuous IMQ application in the IMQ group. However, LSG + IMQ group showed a decrease in IMQ-induced psoriatic traits, similar to MTX + IMQ group (Figs. 1A and S3).

Figure 1 LSG ameliorates psoriasis-like skin lesions in IMQ-induced psoriatic mice. Mice were treated daily with IMQ, MTX or LSG for 7 consecutive days and sacrificed on day 8 for macroscopic and microscopic evaluation of the skin (n=8). (A) Gross morphology showing the macroscopic appearance of mouse skin. (B) Microscopic appearance of psoriatic lesions, highlighting visible blood vessels. (C) PAS-stained skin sections with blood vessels (arrow). (D) Psoriasis Area and Severity Index scores assessing erythema, scaling, thickness and cumulative disease severity. *P<0.05 and ***P<0.001. LSG, Low molecular weight sulfated galactan; IMQ, imiquimod; MTX, Methotrexate; PAS, Periodic Acid-Schiff; NC, Normal control.

Subcutaneous vasculature in the lesional area was visualized post-mortem to evaluate inflammatory angiogenesis. Mice in the IMQ group displayed dense and complex vascular networks, characterized by prominent branching and bifurcation, indicative of increased neovascularization and vascular remodeling commonly associated with psoriatic inflammation (8,29). By contrast, both the MTX + IMQ and LSG + IMQ groups exhibited decreased vascular complexity, suggesting that these treatments effectively suppressed IMQ-induced angiogenic responses. NC, MTX and LSG groups exhibited sparse and minimally branched vasculature, consistent with normal skin lacking inflammatory stimulation (Fig. 1B and C).

PASI scores were calculated to provide a qualitative assessment of disease progression and therapeutic efficacy (Figs. 1D and S4). Mice in the LSG + IMQ group showed significantly lower PASI scores in all parameters compared with the IMQ group, indicating a marked decrease in psoriatic severity. There were significant differences between the LSG + IMQ and MTX + IMQ groups. Collectively, the PASI data supported the protective effect of LSG against IMQ-induced psoriatic skin inflammation.

Psoriatic mice treated with LSG exhibit decreased keratinocyte proliferation and differentiation

Histopathological analysis of dorsal skin was performed to evaluate the effect of LSG in IMQ-induced psoriasis. Mice in the IMQ group developed typical psoriasis-like changes, including hyperkeratosis, parakeratosis and thickening of the epidermal stratum spinosum, whereas the LSG + IMQ group showed decreased psoriasis-like alterations (Fig. 2A). Quantitative analysis confirmed that epidermal thickness was significantly decreased in the LSG + IMQ group compared with the IMQ group (Fig. 2B). No significant difference in epidermal thickness was observed between the LSG + IMQ and MTX + IMQ groups. Although dermal thickness did not differ significantly between the IMQ-treated groups, both the MTX + IMQ and LSG + IMQ groups showed decreased dermal thickness compared with the IMQ group (Fig. 2C).

Figure 2 Effect of LSG on keratinocyte proliferation and differentiation. (A) Representative H&E-stained sections and Ki67 immunostaining of dorsal skin. Arrows indicate Ki67-positive cells. Magnification, x10 (scale bar, 200 µm) and x40 (scale bar, 50 µm). Quantification of (B) epidermal and (C) dermal thickness and (D) Ki67-positive cells (n=8). (E) Ki67 protein expression assessed by western blot and quantified relative to β-actin (n=3). Reverse transcription-quantitative PCR analysis of keratinocyte differentiation markers keratin (F) 6, (G) 16 and (H) 17 and (I) involucrin (n=4). *P<0.05, **P<0.01 and ***P<0.001. LSG, low molecular weight sulfated galactan; H&E, Hematoxylin and Eosin; NC, Normal control; MTX, Methotrexate; IMQ, Imiquimod.

Epidermal thickening in psoriasis results from increased keratinocyte proliferation, with Ki67 serving as a proliferation marker (30). Immunohistochemistry showed fewer Ki67-positive cells in the epidermis of the MTX + IMQ and LSG + IMQ groups compared with the IMQ group (Fig. 2A and D). Ki67 protein expression was significantly decreased in the LSG + IMQ compared with the IMQ group (Fig. 2E). To assess keratinocyte differentiation, the expression of keratin 6, 16 and 17 and involucrin (established biomarkers of keratinocyte differentiation) (7) was evaluated by RT-qPCR. Expression levels of keratin 6, 16 and 17 were significantly decreased in the LSG + IMQ compared with the IMQ group. No significant differences were observed between the LSG + IMQ and MTX + IMQ groups (Fig. 2F-H). Expression of involucrin, a structural protein involved in psoriatic plaque formation, was also decreased in the LSG + IMQ group compared with the IMQ group (Fig. 2I). Taken together, these findings indicated that LSG treatment reduces keratinocyte proliferation and differentiation.

LSG decreases cutaneous inflammation in IMQ-induced psoriatic mice

Psoriasis is a T cell-mediated autoimmune skin disease characterized by overexpression of proinflammatory cytokines (31). TNF-α and IL-1β serve key roles in regulating inflammation and promoting Th17 cell development, which is central to the pathogenesis of psoriasis (32). In addition, IL-23 activates CD4+ T cells and promotes the release of IL-17A, which drives keratinocyte proliferation in psoriasis (4). ELISA and western blot analyses were performed to determine whether LSG modulates inflammatory cytokine expression during psoriasis development. ELISA showed that levels of TNF-α, IL-1β, IL-17A, and IL-23 were significantly decreased in the skin lesions of the LSG + IMQ group compared with the IMQ group. These effects were consistent with those observed in the MTX + IMQ group (Fig. 3A-H). Western blotting further demonstrated that protein expression of TNF-α and IL-6 proinflammatory cytokines was significantly decreased in the LSG + IMQ compared with the IMQ group. By contrast, IL-10, an anti-inflammatory cytokine, showed increased expression in the LSG + IMQ group (Fig. 3I-L). These findings highlight the efficacy of LSG in attenuating cutaneous inflammation in psoriatic mice.

Figure 3 Effect of LSG on cutaneous inflammation in IMQ-induced psoriatic mice. Cytokine levels in skin tissue and blood serum were evaluated by ELISA and western blotting (n=5). ELISA quantification of (A) TNF-α, (B) IL-1β, (C) IL-17A and (D) IL-23 in skin tissue. Serum levels of (E) TNF-α, (F) IL-1β, (G) IL-17A and (H) IL-23. (I) Protein expression of (J) TNF-α, (K) IL-6 and (L) IL-10 in skin tissue, normalized to β-actin. *P<0.05, **P<0.01 and ***P<0.001. LSG, Low molecular weight sulfated galactan; NC, Normal control; MTX, methotrexate; IMQ, Imiquimod.

LSG decreases CD4+ and mast cell recruitment in IMQ-induced psoriatic mice

By reducing levels of TNF-α, IL-1β, and IL-17A, LSG decreased the recruitment of inflammatory Th17 cells. To assess the effect of LSG on inflammatory cell infiltration in psoriatic skin lesions, immunohistochemical staining for CD4+ cells was performed. IMQ group demonstrated accumulation of CD4+ cells in psoriatic skin lesions. By contrast, CD4+ cell infiltration was significantly decreased in both the MTX + IMQ and LSG + IMQ groups compared with the IMQ group (Fig. 4A and B). Giemsa staining of skin sections revealed that mast cell infiltration was significantly lower in the MTX + IMQ and LSG + IMQ groups compared with the IMQ group (Fig. 5A and B). These findings suggested that LSG reduces inflammatory cell infiltration in psoriatic skin.

Figure 4 Effect of LSG on CD4+ cell infiltration in IMQ-induced psoriatic mice. (A) Representative immunohistochemical images of CD4+ cells (arrow) in dorsal skin. Magnification, x10 (scale bar, 100 µm) and x40 (scale bar, 50 µm). (B) Quantification of CD4+ cells. *P<0.05. LSG, Low molecular weight sulfated galactan; NC, Normal control; MTX, Methotrexate; IMQ, Imiquimod.

Figure 5 Effect of LSG on mast cell infiltration in IMQ-induced psoriatic mice. (A) Representative Giemsa-stained dorsal skin showing mast cells (arrow). Magnification, x10 (scale bar, 100 µm) and x40 (scale bar, 50 µm). (B) Quantification of mast cells in each group. ***P<0.001. LSG, Low molecular weight sulfated galactan; NC, Normal control; MTX, Methotrexate; IMQ, Imiquimod.

LSG alleviates inflammatory cytokine production by inhibiting the JAK/STAT pathway in IMQ-induced psoriatic mice

Proinflammatory cytokines are mediated by IL-17A and IL-23 via activation of the JAK/STAT signaling pathway (5). The decreased expression of IL-17A and IL-23 in the LSG + IMQ group may affect JAK/STAT pathway activation. To investigate this, RT-qPCR was used to analyze mRNA expression of JAK/STAT pathway components, demonstrating downregulation of JAK2, STAT2 and STAT3 (Fig. 6A-F). Consistent with these findings, expression of the JAK/STAT target genes BCL2 and CCND1 was also decreased in the LSG + IMQ group to similar levels observed in the MTX + IMQ group, compared with the IMQ group (Fig. 6G and H).

Figure 6 Effect of LSG on JAK/STAT pathway activation in IMQ-induced psoriatic mice. Reverse transcription-quantitative PCR analysis was used to measure mRNA expression levels of (A) STAT1, (B) STAT2, (C) STAT3, (D) JAK1, (E) JAK2 and (F) JAK3 and JAK/STAT target genes (G) BCL2 and (H) CCND1 (n=4). *P<0.05, **P<0.01 and ***P<0.001. LSG, Low molecular weight sulfated galactan; NC, normal control; MTX, Methotrexate; IMQ, Imiquimod.

LSG suppresses IMQ-induced enlargement of lymph node and spleen without causing toxicity to other vital organs

Psoriasis, as an inflammatory disease, leads to immune system activation and is associated with increased lymph node and spleen weight (33). To assess systemic inflammation, lymph nodes and spleens were collected and weighed. IMQ treatment resulted in increased size and weight of lymph nodes and spleens in the IMQ group compared with controls (NC, MTX, and LSG; Fig. 7). By contrast, the LSG + IMQ group showed a significant decrease in both lymph node (Fig. 7A and B) and spleen (Fig. 7C and D) size and weight compared with the IMQ group. No significant differences were observed between the MTX + IMQ and LSG + IMQ groups. These findings suggested LSG decreased systemic inflammation by suppressing IMQ-induced organomegaly.

Figure 7 Effect of LSG on IMQ-induced organomegaly in psoriatic mice. (A) Representative right axillary lymph node. (B) Relative weights of right axillary lymph node. (C) Representative spleen. (D) Relative spleen weight. n=8. *P<0.05, **P<0.01 and ***P<0.001. LSG, Low molecular weight sulfated galactan; NC, Normal control; MTX, Methotrexate; IMQ, Imiquimod.

To evaluate the potential toxicity of LSG on major internal organs, histopathological examination of the kidney and liver was performed using H&E staining (Fig. 8). Representative micrographs of renal (Fig. 8A) and hepatic tissue (Fig. 8B) showed preserved normal architecture without evidence of degeneration, necrosis, inflammatory infiltration or vascular congestion. Renal histology revealed intact glomeruli and renal tubules with no morphological abnormalities across all groups, including those receiving MTX or LSG with or without IMQ. Similarly, hepatic tissue exhibited normal lobular architecture with well-preserved hepatocyte morphology and no signs of hepatocellular damage. These findings suggested that LSG at the administered dose did not induce detectable hepatic or renal toxicity in IMQ-induced psoriatic mice, supporting its safety for systemic use.

Figure 8 Histological evaluation of kidney and liver tissues following LSG treatment in IMQ-induced psoriatic mice. (A) Kidney and (B) liver sections stained with hematoxylin and eosin. Scale bar, 50 µm. LSG, Low molecular weight sulfated galactan; NC, Normal control; MTX, Methotrexate; IMQ, Imiquimod.

Discussion

There is increasing research on seaweed-derived SPs for the treatment of numerous ailments (11,12), particularly inflammatory conditions, due to their efficacy and minimal side effects. Studies have shown that oligosaccharides derived from G. fisheri modulate immune responses by inhibiting proinflammatory cytokines such as TNF-α and IL-1β, key mediators in psoriasis pathogenesis (13,34). Furthermore, modification of SG to obtain LSG from G. fisheri has been found to significantly enhance its biological activity (15,18). To the best of our knowledge, the present study is the first to provide in vivo evidence that intraperitoneal administration of LSG exerts potent anti-inflammatory and anti-psoriatic effects in an IMQ-induced psoriasis-like mouse model. Administration methods include oral, injectable and topical routes. Intraperitoneal administration allows rapid absorption of large volumes of substances and is the preferred injection route for non-irritant, isotonic solutions (35). Numerous studies have investigated the intraperitoneal injection of polysaccharides for their anti-inflammatory and anti-psoriatic effects (23,36,37). For example, psoriatic mice that received β-glucan intraperitoneally show decreased psoriatic arthritis-like symptoms (23). In another study, mice treated with intraperitoneal acitretin-dextran nanoparticles for six consecutive days exhibited amelioration of psoriasis-like skin disease (36). Additionally, the intraperitoneal injection of fucoidans at doses of 10, 50 and 250 mg/kg significantly reduced inflammation induced by sodium carboxymethyl cellulose in mice (37).

The IMQ-induced psoriasis animal model is used as it replicates key features of human psoriatic lesions, including epidermal thickening, erythema, scaling, vascular proliferation and infiltration of T and other immune cells (38). The PASI score is a standard tool for evaluating disease severity and treatment response, with a reduction >50% generally considered a significant improvement (39). Administration of LSG significantly decreased erythema, scaling and skin thickening, as reflected by decreased PASI scores throughout the treatment period, indicating its anti-psoriatic effect. An additional factor that may have influenced lesion severity was hair regrowth during IMQ application. New hair growth appeared earlier in certain treatment groups, particularly in IMQ group, which decreased the effective skin surface area directly exposed to IMQ. Nevertheless, the overall amount of IMQ applied and the treated area remained unchanged; some of the compound may have initially adhered to the hair shafts. However, as the hair was relatively short, the drug was still able to permeate the skin over time. This was supported by the observation that the mice exhibited itching and scratching in these regions, similar to the areas without hair. However, to maintain a fully exposed dorsal skin surface for photographic observation, mice in control groups were re-shaved mid-protocol, whereas IMQ-treated groups were not re-shaved to avoid additional irritation. Hair regrowth in treated groups may also indicate a biological effect of the intervention. IMQ is associated with the activation of Th17 cells, leading to skin inflammation (40), while at the same time Th17-mediated mechanisms have been implicated in alopecia areata (41). The earlier reappearance of hair in treatment groups compared with untreated controls suggests that the treatment may have alleviated local inflammation and restored a skin microenvironment permissive for hair growth. Although hair regrowth was not quantitatively assessed, this supports the hypothesis that the therapeutic regimens not only attenuate psoriasiform inflammation but may also promote recovery of skin homeostasis. Future studies incorporating both surface area control and systematic monitoring of hair regrowth may clarify the dual role of this phenomenon. Histopathological and immunohistochemical staining (Ki67 and CD4+) supported these findings, showing attenuated epidermal hyperplasia, normalized epidermal architecture and decreased vascular development and infiltration of inflammatory cells, including CD4+ T and mast cells in the dermis (27). In psoriatic lesions, CD4+ T cells are typically concentrated in the upper dermis (31). Mast cells also serve a key role in the development and progression of psoriasis, with increased infiltration contributing to heightened inflammation (42). The decrease in dermal CD4+ T and mast cells following LSG treatment suggested LSG may help inhibit disease progression.

Ki67 is a protein used as a marker of cell proliferation, particularly to assess keratinocyte activity in skin conditions (43). In healthy skin, Ki67 expression is typically low but increases in conditions involving active keratinocyte division, such as wound healing or inflammatory skin disorders such as psoriasis (44). Previous studies have shown that Ki67 upregulation in psoriatic epidermis is decreased following treatment with acitretin-conjugated dextran, MTX and oxymatrine (36,45). Consistent with these findings, the present results demonstrated that LSG significantly reduced both the number of Ki67-positive cells and overall Ki67 expression in IMQ-induced psoriatic mice. These effects were comparable with those observed with MTX, a standard anti-psoriatic agent. Additional biomarkers associated with keratinocyte proliferation and differentiation in psoriasis include keratin 6, 16 and 17 and involucrin (7). In the present study, IMQ-induced upregulation of keratin 6, 16 and 17 and involucrin was significantly decreased following LSG treatment. This aligns with previous work demonstrating that tryptophol-containing emulgel, a topical drug delivery system that combines the properties of an emulsion and a gel, ameliorates IMQ-induced psoriasis in mice by reducing the expression of these markers (27).

The pathogenesis and progression of psoriasis involve the activation of immune cells, including T and antigen-presenting cells. Among these, Th cells, particularly Th1 and Th17 subsets, serve a key role in driving the immunological alterations characteristic of the disease (46). Activation of Th1 and Th17 cells leads to the aberrant production of proinflammatory cytokines such as TNF-α, IL-1β, IL-17A, IL-23 and IL-6, all of which are key mediators in psoriasis (6). In IMQ-induced psoriatic mice, LSG exhibited immunomodulatory effects by decreasing both systemic and cutaneous levels of TNF-α, IL-1β, IL-17A, IL-23 and IL-6 (a key cytokine in psoriasis pathogenesis) (3,8). These findings suggest that LSG suppresses inflammatory cytokine expression under psoriatic conditions. Mechanistically, the present findings indicated that LSG administration interferes with key signaling pathways involved in psoriasis. RT-qPCR revealed that LSG significantly decreased mRNA expression of JAK2, STAT2 and STAT3, along with downregulation of downstream targets BCL2 and CCND1 in psoriatic skin. The decreased dermal expression of BCL2 suggests inhibition of the JAK2/STAT3 pathway (27). The downregulation of JAK2, STAT2 and STAT3 mRNA following LSG administration may be a consequence of upstream cytokine suppression, particularly IL-23 and IL-17A, which drive JAK/STAT activation. While direct inhibition of JAK/STAT signaling by LSG cannot be excluded, evidence suggests an indirect mechanism mediated by decreased proinflammatory cytokine levels (47). Future mechanistic studies, including kinase activity assays, are warranted to determine whether LSG directly interacts with JAK/STAT components. This pathway serves a critical role in IL-23-mediated STAT3 activation, which promotes Th17 cell differentiation and subsequent IL-17A production, contributing to psoriatic inflammation and keratinocyte dysfunction (4). Although NF-κB activity was not directly assessed in the present study, its role as a master regulator of psoriatic inflammation is well established (4,48). Notably, SPs from other marine sources inhibit NF-κB activation (49), suggesting that LSG may exert similar effects.

Psoriasis, as an inflammatory disease, leads to immune system activation and is commonly associated with organomegaly, manifested by increased lymph node and spleen weight, which serves as an indicator of disease severity (33). LSG in IMQ-induced psoriatic mice significantly decreased lymph node and spleen size and weight compared with untreated psoriatic mice, suggesting LSG alleviated disease progression driven by immune activation (50). Additionally, no signs of hepatic or renal toxicity were observed in LSG-treated mice during the 7-day treatment period, as assessed by histopathological analysis. Serum biochemical markers for renal and hepatic function (alanine aminotransferase, aspartate transaminase; AST, creatinine) were not measured due to limited serum availability, as the samples were primarily used for inflammatory cytokine analysis. Therefore, potential subclinical organ toxicity cannot be fully excluded, although histological analysis did not reveal any renal or hepatic damage. However, in a previous study, intraperitoneal administration of SP from Caulerpa cupressoides var. lycopodium at a concentration of 9 mg/kg for 14 days produced no signs of systemic toxicity in mice (51). Thus, short-term LSG is unlikely to induce systemic toxicity, but longer-term studies and comprehensive toxicological evaluations are required to confirm the absence of cumulative or delayed adverse effects. This contrasts with conventional treatments such as MTX and cyclosporine, which are associated with cumulative toxicity and systemic side effects (9).

LSG promotes wound healing by promoting fibroblast proliferation, collagen synthesis and re-epithelialization (52). These regenerative effects, combined with its anti-inflammatory properties, suggest LSG may be effective in managing inflammatory skin conditions such as psoriasis. Additionally, LSG derived from G. fisheri exhibits strong free radical scavenging activity and enhances antioxidant capacity via activation of the nuclear factor erythroid 2-related factor 2/antioxidant response element signaling pathway, indicating broader therapeutic potential beyond dermatological applications (15). Previous studies on G. fisheri derived SG have primarily focused on wound-healing models (18,52). An octanoyl-esterified SG accelerates wound closure in rats, improves collagen deposition, increases α-smooth muscle actin (SMA) and vimentin expression and decreases expression of TNF-α at the wound site. Likewise, our recent study reported that a SG derivative improves histopathology and modulates wound healing proteins such as Ki67, α-SMA, E-cadherin and vimentin in a rat excision wound model (52). These findings highlight the regenerative and anti-fibrotic potential of G. fisheri-derived polysaccharides in tissue repair. To the best of our knowledge, the present study is the first to demonstrate that LSG from G. fisheri attenuates IMQ-induced psoriasis, an immune-mediated dermatosis characterized by keratinocyte hyperproliferation and Th17-driven inflammation. This extends the therapeutic scope of G. fisheri derived SG beyond wound repair to the modulation of immune-driven skin inflammation. Bioactivity of Gracilaria-derived polysaccharides is influenced by molecular weight and degree of sulfation, with lower molecular weight fractions exhibiting anti-inflammatory effects (53); consistent with this, the LSG preparation used in the present study displayed potent immunomodulatory effects in vivo. In comparison with standard therapies such as cyclosporine and acitretin, MTX exerts anti-proliferative and immunosuppressive effects primarily via the inhibition of dihydrofolate reductase (54), whereas LSG acts via immunomodulation, downregulation of inflammatory cytokines and suppression of JAK/STAT signaling. Unlike MTX, which can cause cumulative hepatotoxicity and bone marrow suppression with long-term use, LSG demonstrated no detectable hepatic or renal toxicity over the 7-day treatment period. From a pharmacological perspective, LSG represents a class of marine-derived polysaccharides with potent bioactivity and a favorable safety profile, making it a promising candidate for further drug development (12). Collectively, these findings suggest that LSG from G. fisheri exerts strong anti-psoriatic effects by inhibiting key inflammatory pathways and decreasing keratinocyte hyperproliferation and abnormal differentiation. However, the optimal delivery route, long-term efficacy and large-scale production feasibility remain to be further investigated.

In conclusion, the present study demonstrated the efficacy of LSG derived from G. fisheri in alleviating IMQ-induced psoriasis by decreasing psoriatic skin lesions and attenuating inflammatory responses. These effects were evidenced by decreased production of proinflammatory cytokines and infiltration of inflammatory cells in both skin lesions and systemic tissue. In addition, LSG treatment downregulated mRNA expression of key components of the JAK/STAT signaling pathway. Although the precise molecular mechanisms underlying its therapeutic effects remain to be elucidated, the immunomodulatory and anti-inflammatory properties suggest that LSG has potential as a marine-derived therapeutic agent for psoriasis management. Further studies are warranted to clarify the specific signaling pathways involved and validate its clinical applicability in human models.

Supplementary Material

Schematic diagram showing the experimental timeline. PC, Petroleum cream; NS, Normal saline; NC, Normal control; MTX, Methotrexate; LSG, Low molecular weight sulfated galactan; IP, Intraperitoneal; IMQ, Imiquimod.

GPC, FTIR and NMR profiles of LSG from Gracilaria fisheri. GPC, gel permeation chromatography; FTIR, Fourier-transform infrared; NMR, nuclear magnetic resonance; LSG, Low molecular weight sulfated galactan.

Effect of LSG on psoriasis-like skin in IMQ-induced psoriatic mice. Representative dorsal skin on days 1, 3, 5, and 7. LSG treatment visibly decreased the severity of skin lesions from day 5 to 7. LSG, Low molecular weight sulfated galactan; IMQ, Imiquimod; NC, Normal control; MTX, Methotrexate.

Effect of LSG on IMQ-induced psoriasis severity and body weight in mice. Daily evaluation of (A) erythema, (B) scaling and (C) skin thickening using a modified human PASI scoring system. (D) Cumulative PASI score. (E) Body weight. LSG, Low molecular weight sulfated galactan; IMQ, Imiquimod; NC, Normal control; PASI, Psoriasis area and severity index; MTX, Methotrexate.

Acknowledgements

The authors would like to thank the Laboratory Animal Research Center, University of Phayao, for providing the animal facility, and the School of Medical Sciences, University of Phayao, Phayao, Thailand for access to the laboratory facility. The authors would also to thank Dr Dylan Southard for language editing of the manuscript via the Khon Kaen University Publication Clinic (Khon Kaen, Thailand).

Funding

Funding: The present study was supported by the University of Phayao and the Thailand Science Research and Innovation Fund (Fundamental Fund 2024; grant no. 256/2567) and the Faculty of Medicine, Khon Kaen University, Thailand (grant no. IN67066).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

KJ, AP and TR conceived and designed the study. KJ, AP, LP, SJ, TC, PP and TR performed the experiments. KJ, AP, KW and TR analyzed data. KJ, AP and TR wrote the manuscript. KJ, AP, KW, and TR edited the manuscript. KW and TR supervised the study. KJ, AP and TR confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Ethical Committee of the University of Phayao, Phayao, Thailand in accordance with the Ethics of Animal Experimentation guidelines established by the National Research Council (approval no. 1-024-65).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References