Introduction
Diabetes mellitus (DM) is a sustained metabolic
disorder with a rising global incidence, posing a significant
public health challenge worldwide (1,2). DM is
generally divided into three main types: i) Type 1 DM, formerly
known as juvenile or insulin-dependent diabetes, results from the
body's inability to produce insulin; ii) type 2 DM (T2DM) begins
with insulin resistance, may progress to decreased insulin
production and is mostly related to obesity and physical
inactivity; and iii) gestational diabetes arises in pregnant women
who lack a history of diabetes, resulting in elevated blood glucose
levels (3). The most prevalent form
of the disease is T2DM, which is primarily associated with insulin
resistance and lifestyle habits, including sedentary behavior, poor
dietary choices and irregular sleep patterns (4). In Jordan, the prevalence of T2DM
increased by 14.3% from 1990 to 2020 and is projected to rise by a
further 28.8% between 2020 and 2050(5).
T2DM is commonly associated with low-grade systemic
inflammation, characterized by increased serum cytokine levels,
which is believed to be pivotal in its pathogenesis (6). Low-grade inflammation mediated by
cyclooxygenase (COX) pathways, along with oxidative stress, is
increasingly recognized as an important factor influencing the
development and progression of T2DM (7). COX has two isoforms: COX-2 functions
as the inducible variant, while COX-1 is expressed under normal
physiological conditions. The COX enzymes facilitate the
biosynthesis of prostaglandins using arachidonic acid as a
substrate (8). COX-1 sustains
physiological activities, including gastric protection and platelet
aggregation, whereas COX-2 is upregulated during inflammation and
enhances the synthesis of pro-inflammatory prostaglandins (9,10).
Inflammation associated with diabetes has been linked to IL-1β
(11), which stimulates the
secretion of prostaglandin E2 (PGE2) via increasing COX-2
gene expression (also known as prostaglandin endoperoxide synthase
2) (12). Higher PGE2 levels have
been shown to compromise pancreatic β-cell function, hence lowering
insulin secretion levels and increasing susceptibility to the
development of diabetes (13).
T2DM arises from the intricate interaction of
metabolic, environmental and genetic risk factors. Individuals with
a strong familial predisposition to diabetes, older age, obesity
and sedentary lifestyles are at the highest risk for developing the
disease (14). At the genetic
level, single-nucleotide polymorphisms (SNPs) in multiple genes
have been associated with increased vulnerability to T2DM (15-17).
One of these genes is COX-2 (18,19).
The COX-2 gene includes 10 exons separated by
9 introns, a 3'-untranslated region (3'-UTR) and a 5'-flanking
region (20). Polymorphisms in the
COX-2 gene can affect enzyme expression and activity,
thereby modifying the risk of developing cancer and other
inflammatory-related diseases (21).
Two COX-2 gene variations, rs20417 in the
promoter region and rs2066826 in intron 6, were found to have a
notable association with T2DM in Pima Indians (19). Furthermore, a study conducted in
Turkey found that the rs5275 variant of the COX-2 gene,
located in the 3'-UTR, may contribute to the etiology or influence
the risk of developing T2DM (18).
By contrast, the rs689466 variant of the same gene showed no
significant association with T2DM risk in either Pima Indians or
the Turkish population (18,19).
Building on these findings, the present study aimed to investigate
the association of three key SNPs (rs689466, rs20417 and rs2066826)
with the development of T2DM in the Jordanian population. Although
the rs689466 variant showed no association with T2DM in previous
studies, it was included in the present study to verify these
findings in the Jordanian population and to assess its contribution
to haplotype analysis.
Materials and methods
Study design and patient
recruitment
The present case-control study included 202
participants from King Abdullah University Hospital (teaching
hospital affiliated with Jordan University of Science and
Technology; Irbid, Jordan) between September 2023 and February
2024. All participants were aged ≥25 years with confirmed T2DM
diagnosis [hemoglobin A1c (HbA1c) ≥6.5%] for patients, and HbA1c
<5.7% for healthy individuals who served as controls. Exclusion
criteria included individuals <25 years old, pregnant women and
individuals with HbA1c values between 5.7 and 6.5% (prediabetic
range) to ensure clear metabolic distinction between cases and
controls. Demographic data (age, sex and smoking status) were
recorded, and clinical results (such as kidney and liver function
tests and HbA1c) were collected from electronic medical records.
Participants were divided into two groups: 101 controls and 101
individuals with previously diagnosed T2DM. Controls were matched
to patients with T2DM by sex and age (±5 years). Body mass index
(BMI) was not used as a matching variable, but it was adjusted for
in the multivariate analyses.
Blood sample collection
A venous blood sample (3-4 ml) was obtained from
each participant using sterile tubes containing
ethylenediaminetetraacetic acid (EDTA) as an anticoagulant to
prevent clotting. Immediately after collection, each sample was
gently inverted several times to ensure thorough mixing with EDTA.
The samples were then stored at 4˚C to maintain the integrity and
stability of genomic DNA until further processing and
extraction.
DNA extraction
Genomic DNA was extracted from whole blood samples
using the QIAamp DNA Blood Mini Kit (cat. no. 51104; Qiagen GmbH),
following the manufacturer's protocol. Upon completion of the
extraction process, DNA concentration and purity were measured
using the ND-2000 NanoDrop spectrophotometer (Thermo Fisher
Scientific, Inc.). To ensure long-term preservation and maintain
the integrity of the extracted DNA, all samples were stored at
-20˚C for further analysis.
Genotyping
Three SNPs within the COX-2 gene (rs689466,
rs20417 and rs2066826) were identified using the PCR-restriction
fragment length polymorphism (PCR-RFLP) method.
Each SNP region was amplified by conventional PCR
(Bioer GeneExplorer™ Thermal Cycler; Hangzhou Bioer
Technology Co., Ltd.) using specifically designed primers (Table I). Reactions were prepared in a
total volume of 25 µl using 2X GoTaq® Green Master Mix
(Promega Corporation). The reactions contained 1 µl of each primer
pair (1 µM), 2 µl (10 ng) of DNA template, 8.5 µl of nuclease-free
water and 12.5 µl of 2X PCR Master Mix solution. The PCR conditions
were optimized for each primer set to ensure high specificity and
efficient amplification of the genomic regions flanking the target
SNPs. Thermal cycling included an initial denaturation at 95˚C for
3 min, followed by 34 cycles of 95˚C for 30 sec, 60˚C for 30 sec
and 72˚C for 30 sec, with a final extension at 72˚C for 5 min. PCR
amplification was verified by running the products in a 2% agarose
gel stained with 5 µl RedSafe™ Nucleic Acid Staining
Solution (20,000X; iNtRON Biotechnology, Inc.).
 | Table ICyclooxygenase-2 variants genotyped
using PCR-RFLP. |
Table I
Cyclooxygenase-2 variants genotyped
using PCR-RFLP.
| SNP ID | Region base
change | Primer sequences
(5'-3') | Enzyme and
recognition site | PCR product size
(bp) | RFLP product
(bp) |
|---|
| rs689466 | Promoter
T>C | F:
AATTTGCAGGGACGCTAAA | AluI: 5'-AG/CT-3';
3'-TC/GA-5' | 352 | CC:300/52; TT:352;
TC:352/300/52 |
| | | R:
CCTGAGCACTACCCATGATAGA | | | |
| rs20417 | Promoter
G>C | F:
GACGACGCTTAATAGGCTGTA | AciI: 5'-C/CGC-3';
3'-GGC/G-5' | 307 | GG:307; CC:200/107;
CG:307/200/107 |
| | | R:
CCATCAGAAGGCAGGAAACT | | | |
| rs2066826 | Intron C>T | F:
CTTTGACTGTGGGAGGATACAT | AciI: 5'-C/CGC-3';
3'-GGC/G-5' | 427 | TT: 427; CC:
309/118; CT:427/309/118 |
| | | R:
CAGTTTGTAGCTTTGGTGGATAAA | | | |
The PCR-amplified products for each SNP were
subjected to specific restriction enzyme digestion targeting the
polymorphic sites as listed in Table
I. The reactions were incubated at 37˚C for 6 h following the
enzyme-specific protocol. After restriction enzyme digestion, the
PCR products were resolved on 3% agarose gels stained with RedSafe
Nucleic Acid Staining Solution and visualized under ultraviolet
illumination. A DNA ladder was used to verify fragment sizes.
Genotypes were determined based on the resulting fragment patterns
visualized on agarose gels (Fig.
S1).
To validate the PCR-RFLP results, 10 samples per SNP
(30 samples total) selected to represent all observed genotypes
were confirmed by Sanger sequencing (data not shown), with 100%
concordance observed between the two methods.
Statistical analysis
Statistical analysis was performed using R software
version 4.3.1 (Posit Software, PBC). Categorical variables are
presented as n (%) and group comparisons were performed using the
χ2 test or Fisher's exact test, depending on the
contingency table size and cell count. Specifically, Fisher's exact
test was applied for 2x2 contingency tables or when ≥20% of the
expected cell counts were <5. HbA1c levels are presented as
medians [interquartile ranges (IQR)], and the comparison of their
levels between control and T2DM groups was performed using the
Mann-Whitney U test. Hardy-Weinberg equilibrium (HWE) was assessed
for all SNPs in the control group using an exact test according to
SNPstats (https://snpstats.net/start.htm). Haplotype
construction was conducted using the SHEsisPlus online platform
(http://shesisplus.bio-x.cn/SHEsis.html). Multivariate
logistic regression analysis was performed to assess the
independent association between COX-2 polymorphisms and the
risk of T2DM, while adjusting for potential confounding variables
such as age, sex, BMI, hypertension and triglyceride levels.
Adjusted odds ratios (ORs) and 95% CIs were calculated to estimate
the strength of the associations. Given the hypothesis-driven
selection of candidate SNPs based on the literature, formal
correction for multiple testing (three SNPs tested for genotype and
allele associations plus haplotype analysis) was not applied. This
approach is consistent with recommendations for candidate gene
studies with a limited number of pre-specified variants (22). P<0.05 was considered to indicate
a statistically significant difference.
Results
Enrolled patient characteristics
In the present study, a total of 202 participants
were enrolled from the Endocrinology Clinic at King Abdullah
University Hospital, including 101 patients with T2DM and 101
healthy individuals whose HbA1c level was <5.7%, serving as
controls. The clinical and demographic characteristics of the study
population are outlined in Table
II.
| Table IIBaseline characteristics of study
subjects and biochemical profile. |
Table II
Baseline characteristics of study
subjects and biochemical profile.
| Variable | T2DM (n=101) | Healthy controls
(n=101) | P-value |
|---|
| Age | | | 0.7268 |
|
<60 | 82 (81.19) | 79 (78.22) | |
|
≥60 | 19 (18.81) | 22 (21.78) | |
| Sex | | | 1.0000 |
|
Female | 61 (60.40) | 61 (60.40) | |
|
Male | 40 (39.60) | 40 (39.60) | |
| BMI | | | 0.8219 |
|
<25 | 12 (11.88) | 10 (9.90) | |
|
≥25 | 89 (88.12) | 91 (90.10) | |
| Smoking
statusa | | | 0.4736 |
|
Smoker | 20 (22.47) | 15 (18.07) | |
|
Non-smoker | 66 (74.16) | 67 (80.72) | |
|
Ex-smoker | 3 (3.37) | 1 (1.20) | |
| Comorbidities
(Yes) | | | |
|
HTN | 70 (69.31) | 35 (34.65) | <0.0001 |
|
CKD | 5 (4.95) | 4 (3.96) | 1.0000 |
|
IHD | 7 (6.93) | 4 (3.96) | 0.5373 |
| Biochemical blood
test | | | |
|
Cholesterol,
mmol/l | | | 0.9499 |
|
Normal
(<5.2) | 73 (72.28) | 75 (74.26) | |
|
Borderline
high (5.2-6.2) | 16 (15.84) | 15 (14.85) | |
|
High
(≥6.2) | 12 (11.88) | 11 (10.89) | |
|
HDLb,
mmol/l | | | 0.1561 |
|
Normal | 11 (10.89) | 10 (9.90) | |
|
Moderate
risk | 51 (50.50) | 64 (63.37) | |
|
High
risk | 39 (38.61) | 27 (26.73) | |
|
LDL,
mmol/l | | | 0.7954 |
|
Normal
(0-4.40) | 94 (93.07) | 92 (91.09) | |
|
High
(>4.40) | 7 (6.93) | 9 (8.91) | |
|
Triglycerides,
mmol/l | | | 0.0046 |
|
Normal
(0-1.7) | 36 (35.64) | 57 (56.44) | |
|
High
(>1.7) | 65 (64.36) | 44 (43.56) | |
|
Creatinine,
µmol/l | | | 1.0000 |
|
Low
(<53) | 8 (7.92) | 8 (7.92) | |
|
Normal
(53-97) | 83 (82.18) | 83 (82.18) | |
|
High
(>97) | 10 (9.90) | 10 (9.90) | |
|
Urea,
mmol/l | | | 0.8656 |
|
Low
(<2.14) | 1 (0.99) | 2 (1.98) | |
|
Normal
(2.14-7.14) | 88 (87.13) | 89 (88.12) | |
|
High
(>7.14) | 12 (11.88) | 10 (9.90) | |
Serum HbA1c levels were used as a reference to
assess glycemic status in the study population. HbA1c levels were
markedly elevated in the T2DM group compared with those in controls
(P<0.0001). The median HbA1c level was 5.4% (IQR: 5.2-5.5%) in
the control group and 7.2% (IQR: 6.2-8.7%) in the T2DM group,
indicating a clear metabolic distinction associated with T2DM
(Fig. 1).
A deliberate matching process was carried out to
ensure comparability between the T2DM and healthy control groups in
terms of age (±5 years) and sex. As a result, no significant
differences were found between the two groups in these variables.
Women comprised 60.40% of each group, while men accounted for
39.60%. The mean age was 52.75±8.12 years in the T2DM group and
50.32±12.41 years in the control group, with ~80% of participants
in each group being <60 years old.
Smoking status was also assessed and did not show
any significant difference between the T2DM and control groups.
Among individuals with T2DM, 22.47% were current smokers, 74.16%
were non-smokers and 3.37% were ex-smokers. In the control group,
18.07% were current smokers, 80.72% were non-smokers and 1.20% were
former smokers.
Furthermore, BMI analysis revealed no significant
difference between the two groups, indicating a comparable
distribution of this key metabolic risk factor. However, a
significant disparity in hypertension prevalence was observed
(P<0.0001), with 69.31% of individuals in the T2DM group
affected, compared with 34.65% in the control group.
In addition, biochemical analyses revealed a notable
difference in triglyceride levels, with a higher proportion of
elevated triglycerides among patients with T2DM compared with
controls (64.36% vs. 43.56%, respectively; P=0.0046), further
underscoring the metabolic disturbances commonly associated with
T2DM.
Association of COX-2 genetic variants
with T2DM
Allele and genotype distributions of the
COX-2 SNPs rs689466, rs20417 and rs2066826 were determined
using PCR-RFLP analysis. The genotype distributions of these three
SNPs were compared between the T2DM and healthy control groups, as
summarized in Table III. No
statistically significant differences were observed for rs2066826
and rs689466 (P>0.05). HWE was assessed for all three SNPs in
the control group, since deviation from HWE in cases may reflect a
true disease association. The rs689466 and rs2066826 loci conformed
to HWE (P=0.24 and P=0.76 respectively). A modest deviation from
HWE was observed for rs20417 in controls (P=0.03), which may
reflect population structure or chance variation due to sample
size.
| Table IIIGenotype and allele frequency for
polymorphisms rs689466, rs20417 and rs2066826. |
Table III
Genotype and allele frequency for
polymorphisms rs689466, rs20417 and rs2066826.
| A, rs689466 |
|---|
| SNP | T2DM (n=101) | Healthy controls
(n=101) | HWE control
P-value | P-value |
|---|
| Genotype | | | 0.24 | 1.0000 |
|
TT | 83 (82.18) | 83 (82.18) | | |
|
TC | 16 (15.84) | 16 (15.84) | | |
|
CC | 2 (1.98) | 2 (1.98) | | |
|
Allele | | | NA | 1.0000 |
|
T | 182 (90.10) | 182 (90.10) | | |
|
C | 20 (9.90) | 20 (9.90) | | |
| B, rs20417 |
| SNP | T2DM (n=101) | Healthy controls
(n=101) | HWE control
P-value | P-value |
| Genotype | | | 0.03 | 0.0248 |
|
CC | 68 (67.33) | 57 (56.44) | | |
|
CG | 30 (29.69) | 31 (30.69) | | |
|
GG | 3 (2.97) | 13 (12.87) | | |
|
Allele | | | NA | 0.0178 |
|
C | 166 (82.18) | 145 (71.78) | | |
|
G | 36 (17.82) | 57 (28.22) | | |
| C, rs2066826 |
| SNP | T2DM (n=101) | Healthy controls
(n=101) | HWE control
P-value | P-value |
| Genotype | | | 0.76 | 0.2707 |
|
CC | 74 (73.27) | 64 (63.37) | | |
|
CT | 25 (24.75) | 32 (31.68) | | |
|
TT | 2 (1.98) | 5 (4.95) | | |
|
Allele | | | NA | 0.1163 |
|
C | 173 (85.64) | 160 (79.21) | | |
|
T | 29 (14.36) | 42 (20.79) | | |
For rs2066826, the TT genotype was the least
frequent in both groups, while the CC genotype was the most common.
In the case of rs689466, the TT genotype was predominant, whereas
the CC genotype appeared with the lowest frequency in both cohorts.
Interestingly, a significant difference in genotype distribution
between the T2DM and healthy groups was found for rs20417. The CC
genotype was the most prevalent in both groups, representing 67.33%
of the T2DM group and 56.44% of the healthy controls. Notably, the
GG genotype was observed in only 2.97% of the T2DM group compared
with 12.87% in the healthy control group, suggesting a potential
association with disease status.
Subsequently, the allele frequencies of the three
COX-2 SNPs were analyzed, as presented in Table III. No statistically significant
differences were observed for rs2066826 and rs689466 (P>0.05).
For rs689466, the T allele was predominant in both groups,
accounting for 90.10% of all alleles, while the C allele was
relatively rare, comprising only 9.90%. Similarly, for rs2066826,
the C allele was the most common in both patients with T2DM
(85.64%) and healthy controls (79.21%), while the T allele was
present at a frequency of 14.36 and 20.79%, respectively. Although
the association between rs2066826 and T2DM did not reach
statistical significance, a P-value of ~0.1 suggests a potential
trend toward significance and may warrant further
investigation.
Association between COX-2 genotypes
and biochemical parameters in patients with T2DM
To explore whether genetic variation in the
COX-2 gene may influence metabolic or kidney-related traits
in individuals with T2DM, the association between the three SNPs
and biochemical parameters within the T2DM group was examined
(Table SI). The biochemical
parameters included serum markers of glycemic control (HbA1c),
lipid metabolism [triglycerides, total cholesterol, high-density
lipoprotein (HDL) and low-density lipoprotein (LDL)] and renal
function (creatinine and urea).
The analysis revealed no statistically significant
associations between any of the examined SNP genotypes and the
biochemical measures (all P>0.05). These results suggest that,
in the present study, COX-2 genetic variants were not major
contributors to variations in metabolic or renal profiles among
individuals with T2DM.
Haplotype analysis
To explore whether combinations of alleles across
the three SNPs in the COX-2 gene may be associated with
T2DM, a haplotype analysis was conducted using the SHEsisPlus
software platform. This approach aimed to identify potential
genomic blocks that may confer increased susceptibility to or
protection against T2DM.
As shown in Table
IV, the most common haplotype identified, T-C-C, was
significantly more frequent among patients with T2DM (70.30%) than
healthy controls (60.89%). This haplotype was associated with a 52%
increased risk of T2DM (OR=1.52; 95% CI: 1.01-2.30; P=0.046),
suggesting a potential risk allele combination within the
COX-2 gene.
| Table IVHaplotype frequency of
cyclooxygenase-2 loci in healthy control and T2DM groups. |
Table IV
Haplotype frequency of
cyclooxygenase-2 loci in healthy control and T2DM groups.
| rs689466 | rs20417 | rs2066826 | T2DM | Healthy
controls | OR (95% CI) | P-value |
|---|
| T | C | C | 142 (70.30) | 123 (60.89) | 1.52
(1.01-2.30) | 0.046 |
| T | G | T | 25 (12.38) | 38 (18.81) | 0.61
(0.35-1.05) | 0.074 |
| C | C | C | 20 (9.90) | 18 (8.91) | 1.12
(0.58-2.19) | 0.733 |
| T | G | C | 11 (5.45) | 17 (8.42) | 0.63
(0.29-1.37) | 0.239 |
By contrast, the T-G-T haplotype appeared more
frequently in healthy controls (18.81%) than in patients with T2DM
(12.38%), with an OR of 0.61 (95% CI: 0.35-1.05; P=0.074). Although
this trend suggests a possible protective effect of this haplotype
against T2DM, the result did not reach statistical
significance.
Together, these findings highlighted the potential
relevance of COX-2 haplotypes in modulating diabetes risk
and warrant further investigation in larger, independent
cohorts.
Multivariate logistic regression
analysis of key demographic, clinical and genetic factors
associated with T2DM
To evaluate the independent contribution of
demographic, clinical and genetic factors to the risk of T2DM, a
multivariate logistic regression analysis was performed (Table V). The analysis showed that
hypertension was strongly associated with T2DM, with hypertensive
individuals being more than four times more likely to develop the
disease compared with healthy controls (OR=4.44; 95% CI: 2.37-8.29;
P<0.0001). Similarly, individuals with high triglyceride levels
exhibited a significantly increased likelihood of developing T2DM
(OR=2.21; 95% CI: 1.18-4.11; P=0.0119). By contrast, age, sex and
BMI did not show statistically significant associations with T2DM
in this model.
| Table VMultivariate logistic regression
analysis on the association of key variables with the risk for type
2 diabetes mellitus. |
Table V
Multivariate logistic regression
analysis on the association of key variables with the risk for type
2 diabetes mellitus.
| Variable | OR | 95% CI | P-value |
|---|
| Age (≥60 vs. <60
years) | 0.82 | 0.38-1.78 | 0.6224 |
| Sex (female vs.
male) | 1.08 | 0.58-2.03 | 0.8051 |
| BMI (≥25 vs.
<25) | 1.09 | 0.40-2.95 | 0.8645 |
| HTN (yes vs.
no) | 4.44 | 2.37-8.29 | <0.0001 |
| Triglycerides (high
vs. normal) | 2.21 | 1.18-4.11 | 0.0119 |
| rs20417 (vs.
GG) | | | |
|
CG | 5.09 | 1.18-21.96 | 0.0290 |
|
CC | 5.39 | 1.34-21.72 | 0.0178 |
Notably, the COX-2 rs20417 SNP remained
significantly associated with T2DM after adjustment for other
covariates. Individuals with the CG genotype were nearly five times
more likely to develop T2DM (OR=5.09; 95% CI: 1.18-21.96;
P=0.0290), and those with the CC genotype exhibited a similarly
elevated risk (OR=5.39; 95% CI: 1.34-21.72; P=0.0178).
Discussion
The findings of the present study suggested a
possible association between the COX-2 SNP rs20417 and the
risk of T2DM. The CC genotype and C allele were more frequent among
individuals with T2DM, suggesting a possible risk-enhancing effect.
Conversely, the GG genotype and G allele were more prevalent in the
control group, suggesting a potential protective effect against
T2DM. By contrast, the other two investigated COX-2
polymorphisms, rs689466 and rs2066826, did not show a statistically
significant association with T2DM in the Jordanian population.
COX-2 is an inducible enzyme that has been shown to
play a central role in inflammatory responses and has been
implicated in the development of T2DM (19,23).
Experimental studies have shown that COX-2-stimulated PGE2
contributes to β-cell inflammation and impaired insulin secretion
under chronic inflammatory conditions, such as cytokine-mediated
pancreatic stress (24,25). In addition, genetic variation in
inflammatory genes, including COX-2, has been associated
with metabolic traits and diabetes susceptibility in diverse
populations, although the associated polymorphisms vary by
ethnicity (18,19). Such heterogeneity may reflect
differences in the genetic background, allele frequencies,
environmental exposures and gene-environment interactions.
Regarding rs689466, the present study did not reveal
any significant association with T2DM, consistent with findings
from previous studies conducted in different populations (18,19).
Similarly, the rs2066826 did not show a statistically significant
association with T2DM in the Jordanian population. However, this
contrasts with the results of Konheim and Wolford (19), who reported a significant
association between this SNP and T2DM in Pima Indians.
Additionally, Rudock et al (26) found that the A allele of rs2066826
was markedly associated with lower levels of coronary calcified
plaques while the AA genotype was associated with increased levels
of carotid calcified plaques in individuals with diabetes,
highlighting the potential relevance of this SNP in cardiovascular
risk modulation within populations with diabetes. Notably, in the
present analysis, the P-value for rs2066826 allele frequency was
closer to the conventional threshold for statistical significance
(P=0.1163 approaches the conventional threshold for statistical
significance P<0.05), suggesting that a larger sample size may
reveal a meaningful association of this SNP with the onset of T2DM.
Accordingly, the rs2066826 polymorphism may warrant further
investigation in expanded or multi-center studies to better
understand its potential role in T2DM susceptibility and related
cardiovascular complications.
The association of rs20417 with diabetes risk may be
linked to its involvement in inflammatory and metabolic regulatory
pathways, consistent with prior findings on COX-2 gene
variants. Konheim and Wolford (19)
identified both rs20417 and rs2066826 as being associated with T2DM
in the Pima Indian population. In their study, the G allele of
rs20417 was predominant, accounting for 88% of the population,
while the C allele was associated with an increased risk of T2DM.
In line with this, Churm et al (23), who investigated this SNP in patients
from the University College London Diabetes and Cardiovascular
Study group, reported that while the G allele remained the major
allele, the C allele was markedly associated with T2DM, angina and
reduced HDL levels. However, a study in the Bai ethnic group of
China reported a lower frequency of the G allele compared to that
of the C allele for the rs20417 SNP in healthy individuals
(27). These population-level
variations in allele distribution may be influenced by several
factors, including ethnic background, genetic drift, natural
selection and environmental exposures, which collectively shape
allele and genotype frequencies over time.
In the present Jordanian cohort, the C allele was
found to be the most prevalent variant of the rs20417 polymorphism,
accounting for 76.98% [(166+145)/404 alleles x 100%)] of the total
population, with a significantly higher frequency among individuals
with T2DM. However, unlike the findings of Churm et al
(23), the current findings showed
no significant association between rs20417 and individual lipid
profile parameters, including HDL, LDL, total cholesterol and
triglycerides. Despite differences in overall allele distribution,
these findings consistently support a T2DM risk-enhancing role for
the C allele across multiple populations.
Another study investigated the association of COX-2
gene variants with early indicators of cardiovascular disease in a
population with T2DM. The findings revealed that individuals
carrying the CC genotype at rs20417 exhibited significantly
increased levels of carotid calcified plaques (26). This reinforces the hypothesis that
the C allele of rs20417 may contribute not only to diabetes
susceptibility but also to its cardiovascular complications,
underscoring the clinical importance of this variant in metabolic
and vascular health. However, it is worth noting that another study
found that the minor allele of rs20417 is associated with a reduced
risk of major adverse events from cardiovascular diseases (28).
The rs20417 promoter variant in the COX-2
gene has been shown to reduce promoter activity and lower
C-reactive protein levels under inflammatory states, suggesting a
regulatory role in inflammation (29). This SNP was suggested to alter the
number of CpG islands present within the promoter of the
COX-2 gene and, therefore, may affect its expression level
(30). The precise mechanism by
which rs20417 reduces COX-2 promoter activity has not yet
been fully elucidated. However, this SNP resides within a potential
specificity protein 1 (Sp1) binding site within the COX-2
promoter region, suggesting that it may alter Sp1 transcription
factor binding and consequently affect gene expression regulation
(29,31). The present findings suggested that
the C allele is associated with an increased risk of T2DM,
supporting the notion that altered COX-2 expression may
contribute to metabolic dysregulation in diabetes.
The potential involvement of COX-2 in the
pathogenesis of T2DM is further supported by evidence of its
abnormal expression in pancreatic islets of individuals with
diabetes. Pancreatic islets continually and dominantly express the
inducible COX form, COX-2(32), and
a previous study demonstrated elevated COX-2 expression in
the islets of organ donors with T2DM compared with those of
non-diabetic organ donors (13).
The same study indicated that upregulated COX-2 expression
in human T2DM islets is associated with inflammatory cytokines and
may contribute, at least in part, to β-cell dysfunction. These
findings provide functional insights that complement the current
genetic results, reinforcing the notion that COX-2 variants
such as rs20417 may influence T2DM susceptibility through both
inflammatory signaling pathways and pancreatic islet
impairment.
The haplotype analysis of the present study revealed
that the T-C-C haplotype, comprising alleles from rs689466, rs20417
and rs2066826, respectively, was significantly more frequent among
individuals with T2DM (70.30%) compared with healthy controls
(60.89%). This haplotype was associated with an OR of 1.52, meaning
that individuals carrying the T-C-C haplotype exhibited a 52%
higher likelihood of developing T2DM compared with those without
this haplotype. Although modest, this elevated OR suggested a
potential risk-enhancing genetic profile, supporting the role of
COX-2 gene variants in contributing to diabetes
susceptibility.
The present study has certain limitations that
should be acknowledged. First, a formal power calculation was not
performed prior to the study. Post-hoc power analysis indicated
moderate power (70%) for detecting the observed rs20417 allelic
association. However, power was limited for detecting associations
with rare genotypes such as rs2066826 TT (21%) due to low minor
allele frequencies. This may have reduced the ability to detect
true associations for some variants. Second, while correction for
multiple comparisons (three SNPs tested for genotype and allele
associations plus haplotype analysis) was not applied due to the
pre-specified, literature-based selection of variants, future
studies with larger samples and independent validation will be
valuable in confirming these associations.
In conclusion, the present study provided evidence
that the COX-2 rs20417 polymorphism is significantly
associated with increased risk for T2DM in the Jordanian
population, independently of traditional clinical risk factors. The
C allele and CC genotype were more frequent among patients with
diabetes and may contribute to disease susceptibility through
inflammatory and metabolic regulatory pathways. No significant
associations were observed for rs689466 or rs2066826, although the
latter showed a trend toward significance, warranting further
investigation in larger or multi-center cohorts. These findings
highlight the potential of COX-2 genetic variants as
biomarkers for T2DM risk and underscore the potential relevance of
genetic variants in risk stratification.
Supplementary Material
Representative agarose gel
electrophoresis of PCR-restriction fragment length polymorphism
genotyping for cyclooxygenase-2. Polymorphisms of (A) rs689466, (B)
rs2066826 and (C) rs20417. Fragment sizes for each genotype are
indicated. Undigested PCR products are shown for reference.
Association of cyclooxygenase-2
single-nucleotide polymorphisms with biochemical parameters in
patients with type 2 diabetes mellitus.
Acknowledgements
Not applicable.
Funding
Funding: This work was supported by the Deanship of Research at
Jordan University of Science and Technology (grant no.
20230519).
Availability of data and materials
The data generated in the present study may be
requested from the corresponding author.
Authors' contributions
NA was involved in study conception, formal data
analysis, funding acquisition, investigation of the genetic
association analysis, project administration, supervision and
writing the original draft. LE was involved in study conception,
investigation of the genetic association analysis, project
administration and supervision. SF was involved in data curation,
methodology (performing experiments) and writing the original
draft. KM was involved in data curation and methodology (performing
experiments). NS conceived the study and performed data curation
and clinical interpretation of data and results. NA and LE confirm
the authenticity of all the raw data. All authors read and approved
the final manuscript.
Ethics approval and consent to
participate
The present study was approved by the Institutional
Review Board (IRB) of Jordan University of Science and Technology
and King Abdullah University Hospital (approval no. 47/163/2023;
Irbid, Jordan), under the oversight of the Deanship of Research at
Jordan University of Science and Technology. All participants
provided written informed consent before being enrolled in the
study, confirming their voluntary participation.
Patient consent for publication
All participants were informed about the study's
objectives, assured that their data would be de-identified to
protect their privacy, and provided written informed consent for
the use of their blood samples for scientific research
purposes.
Competing interests
The authors declare that they have no competing
interests.
Use of artificial intelligence tools
During the preparation of this work, artificial
intelligence tools were used to improve the readability and
language of the manuscript, and subsequently, the authors revised
and edited the content produced by the artificial intelligence
tools as necessary, taking full responsibility for the ultimate
content of the present manuscript.
References
|
1
|
Liu J, Ren ZH, Qiang H, Wu J, Shen M,
Zhang L and Lyu J: Trends in the incidence of diabetes mellitus:
Results from the global burden of disease study 2017 and
implications for diabetes mellitus prevention. BMC Public Health.
20(1415)2020.PubMed/NCBI View Article : Google Scholar
|
|
2
|
Arokiasamy P, Salvi S and Selvamani Y:
Global burden of diabetes mellitus. In: Handbook of global health.
Springer, pp1-44, 2021.
|
|
3
|
Kumar R, Saha P, Kumar Y, Sahana S, Dubey
A and Prakash O: A review on diabetes mellitus: Type1 & Type2.
World J Pharm Pharm Sci. 9:838–850. 2020.
|
|
4
|
Ahmad E, Lim S, Lamptey R, Webb DR and
Davies MJ: Type 2 diabetes. Lancet. 400:1803–1820. 2022.
|
|
5
|
Awad SF, Huangfu P, Dargham SR, Ajlouni K,
Batieha A, Khader YS, Critchley JA and Abu-Raddad LJ:
Characterizing the type 2 diabetes mellitus epidemic in Jordan up
to 2050. Sci Rep. 10(21001)2020.PubMed/NCBI View Article : Google Scholar
|
|
6
|
Calle MC and Fernandez ML: Inflammation
and type 2 diabetes. Diabetes Metab. 38:183–191. 2012.
|
|
7
|
Helmersson J, Vessby B, Larsson A and Basu
S: Association of type 2 diabetes with cyclooxygenase-mediated
inflammation and oxidative stress in an elderly population.
Circulation. 109:1729–1734. 2004.PubMed/NCBI View Article : Google Scholar
|
|
8
|
Morita I: Distinct functions of COX-1 and
COX-2. Prostaglandins Other Lipid Mediat. 68-69:165–175.
2002.PubMed/NCBI View Article : Google Scholar
|
|
9
|
Simmons DL, Botting RM and Hla T:
Cyclooxygenase isozymes: The biology of prostaglandin synthesis and
inhibition. Pharmacol Rev. 56:387–437. 2004.PubMed/NCBI View Article : Google Scholar
|
|
10
|
Crofford LJ: COX-1 and COX-2 tissue
expression: Implications and predictions. J Rheumatol Suppl.
49:15–19. 1997.PubMed/NCBI
|
|
11
|
Alfadul H, Sabico S and Al-Daghri NM: The
role of interleukin-1β in type 2 diabetes mellitus: A systematic
review and meta-analysis. Front Endocrinol (Lausanne).
13(901616)2022.PubMed/NCBI View Article : Google Scholar
|
|
12
|
Tran POT, Gleason CE and Robertson RP:
Inhibition of interleukin-1beta-induced COX-2 and EP3 gene
expression by sodium salicylate enhances pancreatic islet beta-cell
function. Diabetes. 51:1772–1778. 2002.PubMed/NCBI View Article : Google Scholar
|
|
13
|
Wang G, Liang R, Liu T, Wang L, Zou J, Liu
N, Liu Y, Cai X, Liu Y, Ding X, et al: Opposing effects of
IL-1β/COX-2/PGE2 pathway loop on islets in type 2 diabetes
mellitus. Endocr J. 66:691–699. 2019.PubMed/NCBI View Article : Google Scholar
|
|
14
|
Fletcher B, Gulanick M and Lamendola C:
Risk factors for type 2 diabetes mellitus. J Cardiovasc Nurs.
16:17–23. 2002.PubMed/NCBI View Article : Google Scholar
|
|
15
|
Ayelign B, Negash M, Andualem H,
Wondemagegn T, Kassa E, Shibabaw T, Akalu Y and Molla MD:
Association of IL-10 (- 1082 A/G) and IL-6 (- 174 G/C) gene
polymorphism with type 2 diabetes mellitus in Ethiopia population.
BMC Endocr Disord. 21(70)2021.PubMed/NCBI View Article : Google Scholar
|
|
16
|
Momeni-Moghaddam MA, Chahkandi H, Amini
Beidokhti N, Rahmani M, Salarbashi D and Khorasani M:
Angiotensin-converting enzyme I/D gene polymorphism and risk of
type 2 diabetes mellitus in Iranian individuals. Nucleosides
Nucleotides Nucleic Acids. 44:327–336. 2025.PubMed/NCBI View Article : Google Scholar
|
|
17
|
Alharbi KK, Abudawood M and Khan IA:
Amino-acid amendment of arginine-325-tryptophan in rs13266634
genetic polymorphism studies of the SLC30A8 gene with type 2
diabetes-mellitus patients featuring a positive family history in
the Saudi population. J King Saud Univ Sci. 33(101258)2021.
|
|
18
|
Ozbayer C, Kebapci MN, Degirmenci I, Yagci
E, Gunes HV and Kurt H: Genetic variant in the 3'-untranslated
region of the COX2 gene is associated with type 2 diabetes: A
hospital-based case-control study. Prostaglandins Leukot Essent
Fatty Acids. 137:39–42. 2018.PubMed/NCBI View Article : Google Scholar
|
|
19
|
Konheim YL and Wolford JK: Association of
a promoter variant in the inducible cyclooxygenase-2 gene (PTGS2)
with type 2 diabetes mellitus in Pima Indians. Hum Genet.
113:377–381. 2003.PubMed/NCBI View Article : Google Scholar
|
|
20
|
Appleby SB, Ristimäki A, Neilson K, Narko
K and Hla T: Structure of the human cyclo-oxygenase-2 gene. Biochem
J. 302:723–727. 1994.PubMed/NCBI View Article : Google Scholar
|
|
21
|
Fritsche E, Baek SJ, King LM, Zeldin DC,
Eling TE and Bell DA: Functional characterization of
cyclooxygenase-2 polymorphisms. J Pharmacol Exp Ther. 299:468–476.
2001.PubMed/NCBI
|
|
22
|
Perneger TV: What's wrong with Bonferroni
adjustments. BMJ. 316:1236–1238. 1998.PubMed/NCBI View Article : Google Scholar
|
|
23
|
Churm R, Oliver T, Hurel S, Humphries S,
Stephens J and Prior S and Prior S: The-765G> C cyclooxygenase-2
promoter polymorphism is associated with type 2 diabetes mellitus,
low high-density lipoprotein and manifest angina. J Diabetes Metab.
7(2)2016.
|
|
24
|
Martín-Vázquez E, Cobo-Vuilleumier N,
López-Noriega L, Lorenzo PI and Gauthier BR: The
PTGS2/COX2-PGE2 signaling cascade in inflammation: Pro
or anti? A case study with type 1 diabetes mellitus. Int J Biol
Sci. 19:4157–4165. 2023.PubMed/NCBI View Article : Google Scholar
|
|
25
|
Oshima H, Taketo MM and Oshima M:
Destruction of pancreatic beta-cells by transgenic induction of
prostaglandin E2 in the islets. J Biol Chem. 281:29330–29336.
2006.PubMed/NCBI View Article : Google Scholar
|
|
26
|
Rudock ME, Liu Y, Ziegler JT, Allen SG,
Lehtinen AB, Freedman BI, Carr JJ, Langefeld CD and Bowden DW:
Association of polymorphisms in cyclooxygenase (COX)-2 with
coronary and carotid calcium in the diabetes heart study.
Atherosclerosis. 203:459–465. 2009.PubMed/NCBI View Article : Google Scholar
|
|
27
|
Chen W, Ding H, Cheng Y, Li Q, Dai R, Yang
X and Zhang C: Genetic polymorphisms analysis of pharmacogenomic
VIP variants in Bai ethnic group from China. Mol Genet Genomic Med.
7(e884)2019.PubMed/NCBI View
Article : Google Scholar
|
|
28
|
Ross S, Eikelboom J, Anand SS, Eriksson N,
Gerstein HC, Mehta S, Connolly SJ, Rose L, Ridker PM, Wallentin L,
et al: Association of cyclooxygenase-2 genetic variant with
cardiovascular disease. Eur Heart J. 35:2242–2248a. 2014.PubMed/NCBI View Article : Google Scholar
|
|
29
|
Papafili A, Hill MR, Brull DJ, McAnulty
RJ, Marshall RP, Humphries SE and Laurent GJ: Common promoter
variant in cyclooxygenase-2 represses gene expression: Evidence of
role in acute-phase inflammatory response. Arterioscler Thromb Vasc
Biol. 22:1631–1636. 2002.PubMed/NCBI View Article : Google Scholar
|
|
30
|
Wren JD and Garner HR: Data-mining
analysis suggests an epigenetic pathogenesis for type 2 diabetes. J
Biomed Biotechnol. 2005:104–112. 2005.PubMed/NCBI View Article : Google Scholar
|
|
31
|
Yang X, Hou F, Taylor L and Polgar P:
Characterization of human cyclooxygenase 2 gene promoter
localization of a TGF-beta response element. Biochim Biophys Acta.
1350:287–292. 1997.PubMed/NCBI View Article : Google Scholar
|
|
32
|
Robertson RP: Dominance of
cyclooxygenase-2 in the regulation of pancreatic islet
prostaglandin synthesis. Diabetes. 47:1379–1383. 1998.PubMed/NCBI View Article : Google Scholar
|
