Introduction
Liver fibrosis is an excessive wound-healing
response to various forms of chronic liver injury, including viral
hepatitis, alcoholic liver disease and metabolic
dysfunction-associated steatohepatitis. It is characterized by the
excessive accumulation of extracellular matrix (ECM) within the
liver, which progressively disrupts normal hepatic architecture and
function (1). As fibrosis advances,
it may ultimately progress to cirrhosis and hepatocellular
carcinoma, posing a major global health burden (2).
Although substantial progress has been made in
understanding the cellular and molecular mechanisms underlying
liver fibrosis, effective therapies capable of reversing
established fibrosis remain limited. Consequently, the
identification of natural bioactive compounds with hepatoprotective
and anti-fibrotic properties has become an important area of
research.
Protein kinase RNA-like endoplasmic reticulum (ER)
kinase (PERK) is one of the three principal ER stress sensors
involved in the unfolded protein response (UPR) pathway (3). Upon activation, PERK undergoes
autophosphorylation and subsequently phosphorylates eukaryotic
initiation factor 2α (eIF2α). Phosphorylated (p-) eIF2α suppresses
global protein translation while selectively promoting the
translation of activating transcription factor 4 (ATF4). Under
persistent or excessive ER stress, ATF4 induces the expression of
C/EBP homologous protein (CHOP), a key mediator of ER
stress-induced apoptosis (4,5).
CHOP promotes apoptosis by regulating the expression
of apoptosis-related proteins, including downregulation of the
anti-apoptotic protein B-cell lymphoma 2 (Bcl-2) and upregulation
of the pro-apoptotic protein Bcl-2-associated X protein (Bax),
ultimately leading to cysteine-aspartic protease (caspase)
activation and cell apoptosis. Increasing evidence suggests that
abnormal activation of the PERK-eIF2α-ATF4-CHOP signaling pathway
plays a pivotal role in the development and progression of liver
fibrosis. In addition to promoting hepatocyte apoptosis, this
pathway has been implicated in hepatic stellate cell (HSC)
activation and ECM deposition (6,7). As a
result, modulation of the PERK-CHOP signaling pathway may represent
a potential strategy for attenuating liver fibrosis.
Geniposide, a major iridoid glycoside derived from
the fruit of Gardenia jasminoides, has been reported to
possess multiple pharmacological activities, including
anti-inflammatory, anti-oxidative stress, anti-apoptotic activities
and hepatoprotective effects (8).
Previous in vitro and in vivo studies have
demonstrated that geniposide alleviates liver injury by modulating
inflammatory signaling pathways and oxidative stress, thereby
slowing the progression of liver fibrosis (9,10). In
addition, it has been recently suggested that geniposide may
regulate the expression of ER stress-related proteins (11). However, whether geniposide exerts
its anti-fibrotic effects through modulation of the PERK-CHOP
signaling pathway, thereby reducing hepatocyte apoptosis and HSC
activation, remains unclear. To address this knowledge gap,
pirfenidone, an antifibrotic agent with established clinical use in
idiopathic pulmonary fibrosis and documented anti-fibrotic activity
in experimental liver fibrosis, was included as a pharmacological
comparator (12). Therefore, the
present study aimed to investigate the protective effects of
geniposide against CCl4-induced liver fibrosis and to
explore the potential involvement of PERK-CHOP-associated ER stress
and apoptosis.
Materials and methods
Chemicals and reagents
Geniposide was purchased from Shanghai Yuanye
Biotechnology Co., Ltd. Pirfenidone, used as the positive control
drug, was purchased from Beijing Innocare Technology Co., Ltd.
Rapid Transfer Buffer (20X) (cat. no. WB4600; NCM Biotech); 10X
TBST Buffer (cat. no. G0004-1L; Wuhan Servicebio Technology Co.,
Ltd.); polyvinylidene fluoride (PVDF) Membrane (cat. no.
0000378827; Immobilon-P; MilliporeSigma); PAGE Gel Fast Preparation
Kit (cat. no. PG112; Yamei Biotechnology Co, Ltd.); Prestained
Protein Marker VII (cat. no. MPC2409047; Wuhan Servicebio
Technology Co., Ltd.); anti-Bax Rabbit mAb (cat. no. R013644; Yamei
Biotechnology Co, Ltd.); Anti-Caspase3 Rabbit mAb (cat. no.
R015994; Yamei Biotechnology Co, Ltd.); anti-Bcl2 Rabbit mAb (cat.
no. R010733; Yamei Biotechnology Co, Ltd.); HRP-labeled goat
anti-rabbit IgG (cat. no. LF102; Yamei Biotechnology Co, Ltd.);
phospho-EIF2S1 (Ser1) Rabbit pAb (cat. no. 310073; Zenbio);
phospho-PERK (Thr982) Rabbit pAb (cat. no. 340846; Zenbio); eIF2
alpha (D7D3) Rabbit Monoclonal Antibody (cat. no. 5324T; Cell
Signaling Technology, Inc.); CHOP (D46F1) (cat. no. 5554T; Cell
Signaling Technology, Inc.); PERK (PT0310R) PT™ Rabbit mAb (cat.
no. YM8183; ImmunoWay Biotechnology Company); and anti-Collagen I
Rabbit pAb (cat. no. GB11022-3; Wuhan Servicebio Technology Co.,
Ltd.).
Liver function assay kits, hydroxyproline (HYP)
assay kits, hematoxylin and eosin (H&E) staining kits, Sirius
Red staining kits, and terminal deoxynucleotidyl transferase dUTP
nick end labeling (TUNEL) apoptosis detection kits were purchased
from Shenzhen Youpin Biotechnology Co., Ltd. TRIzol reagent was
obtained from Shanghai Beyotime Biotechnology Co., Ltd. Reverse
transcription-quantitative polymerase chain reaction (RT-qPCR) kits
were purchased from Nanjing Novizan Biotechnology Co., Ltd.
Serum biochemical indicators, including alanine
aminotransferase (ALT), aspartate aminotransferase (AST),
superoxide dismutase (SOD), reduced glutathione (GSH),
malondialdehyde (MDA) and HYP, were measured using commercially
available assay kits obtained from Hangzhou Uping Biotechnology
Co., Ltd. CCl4 was purchased from Acmec and diluted with
corn oil (1:3, v/v) before use. Horseradish peroxidase
(HRP)-conjugated secondary antibodies and western blotting reagents
were purchased from Yamei Biotechnology Co, Ltd. All other
chemicals and reagents used in the present study were of analytical
grade.
Animal experiments
Male C57BL/6J mice (6-8 weeks old, weighing 20-22 g)
were obtained from Shanghai Jihui Laboratory Animal Co., Ltd. and
housed at the Experimental Animal Center of Xiamen University under
specific pathogen-free (SPF) conditions with a 12 h light/dark
cycle, controlled temperature (22±2˚C), and relative humidity of
50-60%, with free access to standard chow and water. All animal
procedures were approved (approval no. XMULAC20120020) by the
Institutional Animal Care and Use Committee of Xiamen University
(Xiamen, China). Animals were monitored daily for general health,
body weight, food intake, activity, and signs of distress. Humane
endpoints were implemented in accordance with the approved
institutional animal protocol. No animals were excluded from the
study.
After one week of acclimatization, mice were
randomly divided into four groups (n=6 per group): Control group,
CCl4 group, Geniposide group, and Pirfenidone group. No
formal a priori sample size calculation was performed; the
sample size was selected based on previous studies using comparable
CCl4-induced liver fibrosis models. A liver fibrosis
model was established by intraperitoneal injection of 25%
CCl4-corn oil. Briefly, CCl4 was diluted in
corn oil at a volume ratio of 1:3 (v/v) and administered
intraperitoneally at 0.02 ml per mouse twice weekly for 7 weeks.
This corresponded to ~1 ml/kg for a 20-g mouse. The stated
injection volume refers to the diluted CCl4-corn oil
solution. Mice in the Control group received an equal volume of
corn oil without CCl4.
Drug treatment was initiated during the third week
of CCl4 administration and continued concurrently until
the end of the experiment. Geniposide powder and pirfenidone powder
were dissolved in 0.5% sodium carboxymethyl cellulose (CMC-Na)
solution before use. Mice in the Geniposide group and Pirfenidone
group were orally administered geniposide (100 mg/kg/day) and
pirfenidone (200 mg/kg/day), respectively, by oral gavage once
daily at a volume of 0.2 ml per mouse. Mice in the control and
CCl4 model groups received an equal volume of 0.5%
CMC-Na vehicle. During the treatment period, mice in the model and
treatment groups continued to receive intraperitoneal injections of
the CCl4 mixture twice weekly. Animals were monitored
daily throughout the study for signs of distress, abnormal
behavior, weight loss, or illness.
At the end of the experimental period, mice were
deeply anesthetized with 5% isoflurane. After confirming complete
loss of consciousness, they were euthanized by cervical
dislocation. Death was confirmed by the following criteria: Absence
of respiratory movement (thoracic excursions), heartbeat, corneal
reflex, and response to toe pinch. Blood samples were collected by
orbital sinus and centrifuged at 1,711 x g for 15 min at 4˚C to
obtain serum for biochemical analysis of ALT and AST. Liver tissues
were rapidly excised, rinsed with ice-cold phosphate-buffered
saline (PBS), and divided into three portions. One portion was
fixed in 4% paraformaldehyde for 24 h, embedded in paraffin, and
used for H&E staining, Sirius Red staining,
immunohistochemistry (IHC) and TUNEL analysis. A second portion was
preserved in RNA later solution for RT-qPCR analysis. The remaining
liver tissue was snap-frozen in liquid nitrogen and stored at -80˚C
for western blotting and biochemical analyses. No animals or data
points were excluded from the final analysis.
Histopathological staining
Immediately after removal, liver tissue was fixed in
a 4% paraformaldehyde solution for 24 h, followed by dehydration in
a gradient of ethanol, clearing with xylene, and infiltration with
paraffin, after which it was embedded in a paraffin block. A
microtome was used to cut the paraffin block into consecutive
sections 4-µm thick, which were mounted on glass slides for
observation under a brightfield microscope.
Paraffin sections were sequentially dewaxed with
xylene and rehydrated with a gradient of ethanol, followed by
H&E staining. The staining procedure includes: Staining with
hematoxylin solution for 5-10 min, rinsing with tap water,
differentiation with 1% hydrochloric acid-ethanol for several
seconds, treatment with a re-blue solution, followed by staining
with eosin solution for 2-3 min, dehydration with graded ethanol,
clearing with xylene, and mounting with neutral resin. H&E
staining is used to observe the basic morphological structure of
liver tissue, with a focus on evaluating hepatocyte degeneration
(such as hyaline degeneration and steatosis), necrosis,
inflammatory cell infiltration (including focal or diffuse
infiltration), dilation of hepatic sinuses, disruption of hepatic
lobule structure, and changes in the portal triad.
Paraffin-embedded liver sections were stained with
Sirius Red to visualize collagen fiber deposition. After dewaxing
and rehydration, the section was stained with Sirius Red solution
at room temperature (20-25˚C) for 1 h, then rapidly rinsed with
dilute acetic acid, dehydrated to transparency, and mounted. This
staining was primarily used to assess the degree of liver fibrosis
and to observe the formation and distribution of fibrous septa.
Images were captured from randomly selected fields using an Olympus
BX53 microscope. The collagen-positive area was quantified using
ImageJ software and expressed as the collagen volume fraction
(CVF), calculated as the percentage of Sirius Red-positive area
relative to the total tissue area. All histological analyses were
reviewed by two pathologists using a single-blind method.
IHC
Paraffin sections were deparaffinized and
rehydrated, followed by antigen retrieval using a citrate buffer
(pH 6.0) in a microwave oven (heated at 95˚C for 15 min) and
allowed to cool naturally to room temperature. To inactivate
endogenous peroxidase, the sections were incubated with a 3%
hydrogen peroxide solution at room temperature for 10 min.
Non-specific binding sites were then blocked with 3% BSA (cat. no.
GC305010; Wuhan Servicebio Technology Co., Ltd.) and incubated at
room temperature (20-25˚C) for 30 min. After discarding the serum,
rabbit anti-α-smooth muscle actin (α-SMA; 1:200; cat. no. GB121364;
Wuhan Servicebio Technology Co., Ltd.) and anti-collagen I (1:200;
cat. no. GB11022-3; Wuhan Servicebio Technology Co., Ltd.) primary
antibodies were added dropwise and incubated overnight at 4˚C in a
humid chamber. The next day, after washing with PBS, HRP-conjugated
goat anti-rabbit secondary antibody (1:1,000; cat. no. LF102; Yamei
Biotechnology Co, Ltd.) was added and incubated at room temperature
for 1 h. After thorough washing with PBS, 3,3'-diaminobenzidine
(DAB) was used as the chromogenic substrate, and the samples were
developed for 5-10 min at room temperature in the dark. The
intensity of the staining was monitored under a microscope, and the
reaction was terminated with distilled water. The cell nuclei were
counterstained with hematoxylin. Images were captured using an
Olympus BX53 microscope equipped with a DP26 digital camera. The
positive staining area was quantified using ImageJ software.
For TUNEL analysis, antigen retrieval was performed
on the treated paraffin sections by incubating them with 20 µg/ml
proteinase K at 37˚C for 20 min. Following washing with PBS, the
sections were incubated with the TUNEL reaction mixture in a dark,
humid chamber at 37˚C for 1 h, according to the instructions of the
TUNEL apoptosis detection kit. After thorough rinsing with PBS, the
cell nuclei were counterstained with 4',6-diamino-2-phenylindole
(DAPI, 1 µg/ml) for 5 min, and the slides were mounted with an
anti-fade mounting medium. Images were observed and acquired using
a Nikon fluorescence microscope (Nikon Corporation). The percentage
of TUNEL-positive cells (red fluorescence) relative to the total
number of DAPI-positive cells, the apoptosis index, was calculated
to reflect the level of hepatocyte apoptosis. All image analyses
were performed under uniform exposure and parameter settings to
ensure the comparability of results.
Biochemical analysis
After blood samples were collected, they were left
to stand at room temperature for 30 min to allow natural clotting.
The samples were then centrifuged at 1,711 x g for 15 min to
separate the serum, which was aliquoted and stored at -80˚C for
future use. Using the rate method, a fully automated biochemical
analyzer and a commercial assay kit were employed, strictly
following the manufacturer's instructions, to measure serum ALT and
AST activity, expressed in U/l, to assess the extent of hepatocyte
damage.
After removing the liver tissue, an appropriate
amount (~0.1 g) was weighed and mixed with pre-chilled PBS (pH 7.4)
at a 1:9 (w/v) ratio. A 10% homogenate was prepared using a tissue
homogenizer on an ice bath. The mixture was then centrifuged at 4˚C
and 1,711 x g for 10 min, and the supernatant was collected for
biochemical analysis. SOD activity was determined using the WST-1
method at a detection wavelength of 450 nm, with results expressed
in U/mg protein; GSH content was determined using the DTNB
colorimetric method at a detection wavelength of 412 nm, with
results expressed in µmol/g protein; MDA content was measured using
the thiobarbituric acid method at a wavelength of 532 nm, with
results expressed in nmol/mg protein; HYP content was measured
using the alkaline hydrolysis method at a wavelength of 550 nm,
with results expressed in mg/mg tissue. These biochemical
parameters were used to assess the effects of geniposide on liver
injury, oxidative stress, and hepatic fibrosis in
CCl4-treated mice.
Western blot analysis
Total protein was extracted from liver tissues using
RIPA lysis buffer (cat. no. R0010; Beijing Solarbio Science &
Technology Co., Ltd.), and protein concentrations were determined
using a BCA protein assay kit. Equal amounts of protein (30 µg per
lane) were separated by 10% SDS-PAGE and transferred onto PVDF
membranes. After blocking with 5% non-fat milk for 1 h at room
temperature, the membranes were incubated overnight at 4˚C with
primary antibodies against p-PERK, PERK, p-eIF2α, eIF2α, CHOP,
α-SMA, Bax, Bcl-2, Caspase-3 and β-actin. The membranes were then
incubated with HRP-conjugated secondary antibodies (1:5,000; cat.
no. LF102; Yamei Biotechnology Co, Ltd.) for 1 h at room
temperature. Protein bands were visualized using an enhanced
chemiluminescence (ECL) detection kit and quantified using ImageJ
software (version 1.x, National Institutes of Health).
RT-qPCR
Liver tissues stored at -80˚C were used for total
RNA extraction with TRIzol reagent according to the manufacturer's
instructions. The concentration and purity of the extracted RNA
were determined using an ultra-micro spectrophotometer.
Subsequently, 1 µg of total RNA was reverse transcribed into
complementary DNA (cDNA) using a reverse transcription kit (cat.
no. R323-01; Vazyme Biotech Co., Ltd.) according to the
manufacturer's instructions. RT-qPCR was performed using SYBR Green
Master Mix with cDNA as the template to determine the relative mRNA
expression levels of PERK, eIF2α, CHOP, Caspase-3, Bcl-2 and Bax
with β-actin serving as the internal reference gene. Primer
sequences were designed based on the corresponding gene sequences
obtained from GenBank (https://www.ncbi.nlm.nih.gov/genbank/). PCR
amplification was performed according to the manufacturer's
instructions and melting curve analysis was conducted to confirm
the specificity of the amplified products. PCR amplification was
performed with the following thermal cycling conditions: initial
denaturation at 95˚C for 30 sec, followed by 40 cycles of
denaturation at 95˚C for 10 sec, annealing at 60˚C for 30 sec, and
extension at 72˚C for 30 sec. Melting curve analysis was conducted
to confirm the specificity of the amplified products. Each sample
was analyzed in triplicate, and the relative mRNA expression levels
were calculated using the 2-ΔΔCq method (13). The primer sequences used in the
present study are listed in Table
I.
 | Table IPrimer sequences used for reverse
transcription-quantitative PCR analysis. |
Table I
Primer sequences used for reverse
transcription-quantitative PCR analysis.
| Gene name | Primer sequence
(5'-3') |
|---|
| PERK | F:
GACGAATCGCTGCACTGGAT |
| | R:
AAGTTTTGTGGGTGCCCTCTG |
| eIF2α | F:
CCTGGAGCAATGGAGAAAAAGTA |
| | R:
AGTAGTGTAAGGCTGCCACG |
| CHOP | F:
TCTTGAGCCTAACACGTCGATT |
| | R:
ACGTGGACCAGGTTCTCTCT |
| Caspase-3 | F:
GCTTGGAACGGTACGCTAAG |
| | R:
CCACTGACTTGCTCCCATGT |
| Bax | F:
AAACTGGTGCTCAAGGCCC |
| | R:
GGTCCCGAAGTAGGAGAGGA |
| Bcl-2 | F:
CACCCCTGGTGGACAACATC |
| | R:
TATAGTTCCACAAAGGCATCCCAG |
| β-actin | F:
GGCGGACTGTTACTGAGCTG |
| | R:
CTGCGCAAGTTAGGTTTTGTCA |
Statistical analysis
Data are presented as the mean ± SD. Normality was
assessed using the Shapiro-Wilk test. Comparisons among multiple
groups were performed using one-way ANOVA followed by Tukey's
multiple-comparisons test. Body-weight changes over time were
analyzed using two-way repeated-measures ANOVA, with groups and
time as factors, followed by an appropriate multiple-comparisons
test. All replicates in the experiments were biological replicates.
A two-sided P<0.05 was considered to indicate a statistically
significant difference. Statistical analyses were performed using
GraphPad Prism 10 (Dotmatics).
Results
Effects of Geniposide on the general
condition and liver function of mice with liver fibrosis
During the experiment, mice in the Control group
exhibited normal behavioral patterns, healthy physical appearances,
and steady weight gain. By contrast, mice in the CCl4
group displayed lethargy, reduced physical activity, stunted or
decreased weight gain, and a significantly elevated liver-to-body
weight ratio. Compared with the CCl4 group, the general
condition of mice in the Geniposide group and the Pirfenidone group
was markedly improved. Biochemical analysis demonstrated that serum
ALT and AST levels were significantly elevated in the
CCl4 group compared with the Control group (P<0.001;
P<0.05). Levels of HYP and MDA in liver tissue increased
(P<0.001), while levels of GSH and SOD decreased (P<0.001).
Following treatment with geniposide, all of these parameters showed
a certain degree of recovery compared with the CCl4
group (P<0.001, P<0.01 or P<0.05). These results indicate
that geniposide can effectively alleviate the severity of
inflammation, the extent of collagen deposition, and oxidative
stress in liver fibrosis in mice (Fig.
1A-H).
 | Figure 1Effects of geniposide on general
condition, liver function, and oxidative stress in
CCl4-induced liver fibrosis mice. (A) Body weight change
curve: Changes in body weight (g) of mice in each group throughout
the experimental period (7 weeks). (B) Body weight and liver
weight: the left panel shows the final body weight (WT, g), the
middle panel shows the liver weight at sacrifice (LW, g), and the
right panel shows the liver wet weight to body weight ratio (L/W).
(C-E) Serum AST and ALT levels and HYP content in each group. (F-H)
Hepatic SOD, GSH and MDA levels in each group. All data are
expressed as the mean ± SD. Statistical analysis was performed
using one-way ANOVA. *P<0.05, **P<0.01,
***P<0.001 and ****P<0.0001 vs. the
CCl4 group; (n=6). CCl4, carbon
tetrachloride; ALT, alanine aminotransferase; AST, aspartate
aminotransferase; HYP, hepatic hydroxyproline; SOD, superoxide
dismutase; GSH, glutathione; MDA, malondialdehyde; ns, not
significant. |
Effects of geniposide on liver
histopathology
H&E staining showed that a large number of
hepatocytes in the CCl4 group exhibited ballooning
degeneration, fatty degeneration and focal necrosis. Prominent
inflammatory cell infiltration was observed within both the portal
areas and hepatic lobules, accompanied by the formation of
noticeable fibrous septa. Following geniposide treatment,
hepatocyte damage was markedly attenuated, inflammatory
infiltration subsided, and the fibrous septa became thinner and
fragmented, indicating a clear trend toward tissue structural
recovery. Sirius Red staining showed extensive collagen deposition
in the portal areas and around the central veins of the
CCl4 group, resulting in the formation of broad fibrous
septa. Quantitative analysis showed that geniposide treatment
significantly reduced the CVF (P<0.05), reflecting a significant
reduction in ECM deposition, which was consistent with the results
of HYP content measurement. In addition, IHC analysis showed that
the expression of α-SMA and collagen I was significantly reduced
following geniposide treatment. In addition, western blot analysis
confirmed the reduction in α-SMA expression (Fig. 2A-D).
 | Figure 2Effects of geniposide on liver
histopathological changes and fibrosis in CCl4-induced
liver fibrosis mice. (A) Representative gross morphology of liver
tissues, H&E staining, Sirius Red staining, and IHC staining of
α-SMA and Collagen I in each group. (B) Representative western blot
bands and quantitative analysis of α-SMA protein expression in
liver tissues. (C) Quantitative analysis of H&E-positive injury
area, Sirius Red-positive fibrotic area, and α-SMA- and Collagen
I-positive areas in each group. (D) Statistical summary of
histopathological and IHC quantification results. Data are
presented as the mean ± SD. Statistical analysis was performed
using one-way ANOVA. *P<0.05, **P<0.01
and ****P<0.0001 vs. the CCl4 group; (n=3;
magnification, x200). CCl4, carbon tetrachloride; α-SMA,
alpha-smooth muscle actin; IHC, immunohistochemical; ns, not
significant. |
Effects of geniposide on the PERK-CHOP
signaling pathway
Western blot analysis showed that the ratios of
p-PERK/PERK and p-eIF2α/eIF2α, as well as the expression level of
CHOP, were significantly increased in the CCl4 group
compared with the control group (P<0.05; P<0.01; P<0.001),
indicating activation of the PERK-CHOP signaling pathway.
Geniposide treatment significantly reduced the p-PERK/PERK and
p-eIF2α/eIF2α ratios and CHOP expression compared with the model
group (P<0.05; P<0.001). These findings suggest that the
protective effects of geniposide were associated with reduced
CCl4-induced ER stress and PERK-CHOP-associated
signaling (Fig. 3A-H).
 | Figure 3Western blot analysis of
PERK/eIF2α/CHOP signaling pathway-related proteins in liver tissues
of CCl4-induced liver fibrosis mice. (A) Representative
Western blot bands of p-PERK, p-eIF2α, PERK, eIF2α and CHOP protein
expression in liver tissues from each group. (B-H) Densitometric
analysis of (B) PERK, (C) p-PERK, (D) eIF2α, (E) p-eIF2α, (F) CHOP,
(G) p-PERK/PERK and (H) p-eIF2α/eIF2α protein expression levels in
each group. Data are presented as the mean ± SD. Statistical
analysis was performed using one-way ANOVA. *P<0.05,
**P<0.01 and ***P<0.001 vs. the
CCl4 group; (n=3). PERK, protein kinase R-like ER
kinase; eIF2α, eukaryotic initiation factor 2α; CHOP, C/EBP
homologous protein; CCl4, carbon tetrachloride; p-,
phosphorylated; ns, not significant. |
Effects of geniposide on hepatic cell
apoptosis
TUNEL staining results showed that a large number of
TUNEL-positive cells were observed in the liver tissue of the
CCl4 group, primarily distributed around the fibrous
septa and in areas of severely damaged liver parenchyma; the
apoptosis index was significantly higher than that of the Control
group (P<0.001). Following treatment with geniposide, the number
of apoptotic cells decreased markedly, and the apoptosis index also
decreased significantly (Fig. 4A
and B). Consistent with the TUNEL
results, western blot analysis showed that in the CCl4
group, the expression of the pro-apoptotic proteins Bax and
caspase-3 in liver tissue was significantly increased (P<0.05;
P<0.001); although the expression of the anti-apoptotic protein
Bcl-2 was also increased (P<0.05), the Bax/Bcl-2 ratio was still
elevated compared with the normal group (P<0.05), suggesting
aggravated hepatocyte apoptosis (Fig.
4C-G). After treatment with geniposide, all of these indicators
improved. The CHOP pathway suppresses the expression of the
anti-apoptotic protein Bcl-2 and triggers the translocation of Bax
from the cytoplasm to the outer mitochondrial membrane, where it
aggregates and forms pores, leading to the release of apoptotic
factors such as cytochrome C and initiating the apoptotic program.
When the Bax/Bcl-2 ratio is high, cells tend to survive; when the
ratio is low, they tend to undergo apoptosis. These results
suggested that PERK-CHOP-associated apoptotic signaling may be
related to the degree of liver fibrosis (Fig. 4).
 | Figure 4Effects of geniposide on hepatocyte
apoptosis in CCl4-induced liver fibrosis mice. (A)
Representative TUNEL staining images of liver tissue sections from
each group. TUNEL-positive cells are shown in red, and nuclei are
counterstained with DAPI (blue). (B) Quantitative analysis of the
apoptosis rate in liver tissues from each group. (C) Representative
western blot bands of cleaved Caspase-3, Bax, Bcl-2 and Bax/Bcl-2
protein expression in liver tissues from each group. (D-G)
Densitometric analysis of (D) Caspase-3, (E) Bax, (F) Bcl-2 and (G)
Bax/Bcl-2. Data are presented as the mean ± SD (n=3). Statistical
analysis was performed using one-way ANOVA. *P<0.05,
**P<0.01, ***P<0.001 and
****P<0.0001 vs. the CCl4 group; (n=3;
magnification, x400). CCl4, carbon tetrachloride; TUNEL,
terminal deoxynucleotidyl transferase dUTP nick end labeling; Bax,
Bcl-2-associated X protein; Bcl-2, B-cell lymphoma 2; caspase-3,
cysteine-aspartic protease 3; Bax, Bcl-2-associated X protein; ns,
not significant. |
Effects of geniposide on the mRNA
expression of PERK-CHOP pathway- and apoptosis-related genes
RT-qPCR analysis showed that, compared with the
Control group, the CCl4 group had significantly higher
mRNA levels of PERK, eIF2α and CHOP (P<0.01); and the mRNA
levels of apoptosis-related genes Caspase-3 and Bax were also
significantly increased (P<0.01), while the mRNA level of the
anti-apoptotic gene Bcl-2 decreased (P<0.05). Compared with the
CCl4 group, the Geniposide group significantly reduced
the mRNA levels of PERK, eIF2α, CHOP, Caspase-3 and Bax (P<0.05
or P<0.01), and increased the mRNA level of Bcl-2 (P<0.05).
These findings further support an association between geniposide
treatment and reduced expression of PERK-CHOP pathway-related genes
at the transcriptional level (Fig.
5A-F).
 | Figure 5Relative mRNA expression levels of
PERK, eIF2α, CHOP, Caspase-3, Bax and Bcl-2 in liver tissues
detected by reverse transcription-quantitative PCR. (A-F) Relative
mRNA expression levels of (A) PERK, (B) eIF2α, (C) CHOP, (D)
Caspase-3, (E) Bax and (F) Bcl-2 in liver tissues from each group.
Data are presented as the mean ± SD. Statistical analysis was
performed using one-way ANOVA. *P<0.05,
**P<0.01, ***P<0.001 and
****P<0.0001 vs. the CCl4 group; (n=6).
PERK, protein kinase R-like ER kinase; eIF2α, eukaryotic initiation
factor 2α; CHOP, C/EBP homologous protein; caspase-3,
cysteine-aspartic protease 3; Bax, Bcl-2-associated X protein;
Bcl-2, B-cell lymphoma 2. |
Discussion
Establishment of a liver fibrosis model and
evaluation of the therapeutic effect of geniposide.
CCl4 can cause chemical damage, which gets amplified
through inflammation and eventually leads to liver fibrosis in mice
through ECM deposition mediated by HSCs. This process involves
oxidative stress, ER stress, multiple signaling pathways and immune
cell regulation (14). In the
present study, mice in the CCl4 group showed significant
liver function impairment, marked histopathological changes in the
liver, and extensive collagen deposition, indicating successful
establishment of the liver fibrosis model. Following geniposide
treatment, serum liver function parameters were markedly improved,
hepatic pathological damage was alleviated, and both CVF and
hydroxyproline content were significantly reduced. These findings
suggest that geniposide exerts a protective effect against
CCl4-induced liver fibrosis in mice.
Given its reported anti-inflammatory, antioxidant
and anti-apoptotic activities, geniposide may exert broader
biological effects than those reflected by the PERK-CHOP-associated
mechanism investigated in the present study. However, direct
comparisons of efficacy, safety, pharmacokinetics and
bioavailability between geniposide and established antifibrotic
agents require further investigation.
Regulatory effects of geniposide on
the PERK-CHOP signaling pathway
ER stress has been recognized as an important
contributor to the initiation and progression of liver fibrosis.
Glucose-regulated protein 78 (GRP78), a key ER molecular chaperone,
is commonly regarded as a marker of ER stress activation (15). Under persistent ER stress
conditions, activation of the PERK signaling pathway promotes
phosphorylation of eIF2α, subsequently enhancing ATF4 and CHOP
expression and ultimately triggering apoptosis-related signaling
cascades. As a central transcription factor in this pathway, CHOP
regulates the expression of apoptosis-related proteins, including
the upregulation of Bax, thereby promoting activation of the
apoptotic cascade (4,16). In the present study, the protein
expression levels of p-PERK, p-eIF2α and CHOP were significantly
increased in the model group, suggesting activation of
PERK-CHOP-associated signaling. Following geniposide treatment, the
expression levels of these proteins were significantly decreased
compared with those in the CCl4 model group (P<0.05
or P<0.01), suggesting that geniposide treatment was associated
with reduced ER stress and PERK-CHOP signaling. RT-qPCR analysis
further supported these findings, showing that geniposide
significantly reduced the mRNA expression levels of PERK, eIF2α and
CHOP, suggesting that its effects may occur, at least in part, at
the transcriptional level.
Geniposide reduces PERK-CHOP
pathway-associated apoptosis
The present study found that geniposide
significantly reduced MDA levels while increasing SOD and GSH,
suggesting that its antioxidant capacity may play an upstream role
in its anti-fibrotic effects. Oxidative stress is a
well-established trigger of ER stress; reactive oxygen species can
disrupt the redox balance within the ER, promote the accumulation
of misfolded proteins, and consequently activate UPR sensors such
as PERK (17). Therefore, a
plausible interpretation is that geniposide first attenuates
oxidative damage induced by CCl4 metabolism through its
intrinsic antioxidant activity, which in turn reduces the
initiation of ER stress and ultimately leads to a passive
downregulation of PERK-CHOP pathway activity.
CHOP is considered one of the most important
effector molecules in the ER stress-induced apoptosis pathway
(4). CHOP activates the
mitochondrial apoptosis pathway by promoting Bax translocation to
the mitochondrial membrane, ultimately leading to the cleavage and
activation of Caspase-3 and apoptosis (18,19).
In the present study, TUNEL staining and analysis of Bax, Bcl-2 and
Caspase-3 showed a large number of apoptotic cells in the
CCl4 group, and geniposide intervention significantly
reduced hepatocyte apoptosis. It should be noted that the
biological effects of ER stress may differ among hepatic cell
types. Hepatocyte apoptosis directly contributes to liver
parenchymal injury and subsequent repair responses, whereas
activated HSCs exhibit relatively strong resistance to apoptosis
and may instead be regulated through non-apoptotic ER
stress-related mechanisms (20,21).
Therefore, the reduction effect of geniposide on CHOP-associated
signaling may not only alleviate hepatocyte apoptosis while the
concurrent reduction in HSC activation may further contribute to
the anti-fibrotic effects of geniposide.
Innovation and limitations of the
study
The present study systematically investigated the
protective effects of geniposide against liver fibrosis and
explored its underlying molecular mechanism from the perspective of
ER stress. The findings suggest that the anti-fibrotic effects of
geniposide are associated with reduced ER stress-related apoptotic
signaling and decreased activation of the PERK-CHOP pathway.
Geniposide can also reduce liver cell apoptosis associated with
reduced the protein expression of Bax and Caspase-3 and promoting
the protein expression of Bcl-2, which further supports its
anti-apoptotic effects. These findings provide experimental
evidence supporting the potential of geniposide as a candidate for
further investigation in liver fibrosis.
However, the present study also has certain
limitations. The present study mainly focused on in vivo
pharmacological effects and pathway-related protein expression,
while lacking direct mechanistic evidence from primary HSCs or HSC
cell lines. Therefore, the direct regulatory effect of geniposide
on HSC activation through the PERK-CHOP pathway requires further
investigation. Thus, the direct binding relationship between
geniposide and PERK remains unclear. GRP78/BiP, a commonly used
marker of ER stress, was not assessed in the present study. Future
studies should include GRP78/BiP and other upstream ER stress
markers to further characterize the involvement of ER stress and
determine whether geniposide affects ER stress upstream of PERK.
Moreover, the present study did not include pathway-specific
inhibition, gene knockdown/knockout, or rescue experiments;
therefore, a direct causal role of PERK-CHOP signaling in the
anti-fibrotic effects of geniposide cannot be established. Future
studies could employ hepatocyte or HSC-specific gene knockout
models, as well as gene silencing approaches in HSC-T6 or other
hepatic cell lines, to further clarify the specific role of the
PERK-CHOP pathway in the antifibrotic effects of geniposide. In
addition, further investigation into the pharmacokinetic properties
and clinical translational potential of geniposide is warranted. A
schematic illustration of the proposed mechanism is presented in
Fig. S1.
Conclusions and prospects
The present study demonstrated that geniposide can
effectively improve CCL4-induced liver fibrosis in mice.
Its protective effects were associated with reduced ER
stress-related PERK-CHOP signaling, decreased hepatocyte apoptosis,
and inhibition of HSC activation. These findings provide
experimental evidence for the potential anti-fibrotic effects of
geniposide and suggest that PERK-CHOP signaling may be involved in
its protective actions. Further studies using pathway-specific
genetic or pharmacological approaches are needed to establish the
direct role of PERK-CHOP signaling in the anti-fibrotic effects of
geniposide.
Supplementary Material
Proposed mechanism potentially
underlying the protective effects of geniposide against
CCl4-induced liver fibrosis. Geniposide is associated
with reduced PERK-CHOP-related ER stress and apoptosis, accompanied
by decreased Bax and cleaved Caspase-3 expression, increased Bcl-2
expression, reduced hepatocyte apoptosis, and inhibition of HSC
activation. CCl4, carbon tetrachloride; PERK, protein
kinase R-like ER kinase; CHOP, C/EBP homologous protein; ER,
endoplasmic reticulum; Bax, Bcl-2-associated X protein; Bcl-2,
B-cell lymphoma 2; ALT, alanine aminotransferase; AST, aspartate
aminotransferase; eIF2α, eukaryotic initiation factor 2α; ATF4,
activating transcription factor 4; CHOP, C/EBP homologous protein;
HSC, hepatic stellate cell; p-, phosphorylated; GRP78,
glucose-regulated protein 78; Caspase-3, cysteine aspartic protease
3.
Acknowledgements
Not applicable.
Funding
Funding: The present study was supported by the National Natural
Science Foundation of China (grant no. 82374353), the Natural
Science Foundation of Fujian (grant no. 2023J011636), the Xiamen
Science and Technology Planning Project (grant no. 3502Z20224018),
the Xiamen Medical and Health Guidance Project (grant no.
3502Z20224ZD1166), the Traditional Chinese Medicine Foundation of
Xiamen (grant no. XMXY20250204) and the Xiamen University Malaysia
Fund (grant no. XMUMRF/2025-C15/ITCM/0006).
Availability of data and materials
The data generated in the present study are included
in the figures and/or tables of this article.
Authors' contributions
All authors made a significant contribution to the
work reported, whether in the conception, study design, execution,
acquisition of data, analysis and interpretation, or in all these
areas. YY contributed to methodology design, conceptualization,
visualization and formal analysis. HL and YY carried out the
investigation. XK provided resources and curated data. YY and XK
prepared the original draft. XK contributed to writing, reviewing,
and editing the manuscript. SC and HL supervised the study,
acquired funding, and managed project administration. All authors
took part in drafting, revising, or critically reviewing the
article, gave final approval of the version to be published, agreed
on the journal to which the article has been submitted, and agree
to be accountable for all aspects of the work. All authors read and
approved the final version of the manuscript. YY and XK confirm the
authenticity of all the raw data.
Ethics approval and consent to
participate
All animal experiments were conducted in accordance
with the guidelines of the Animal Ethics Committee of Xiamen
University (approval no. XMULAC20120020; Xiamen, China).
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing
interests.
Use of artificial intelligence tools
During the preparation of this work, artificial
intelligence tools were used to improve the readability and
language of the manuscript or to generate images, and subsequently,
the authors revised and edited the content produced by the
artificial intelligence tools as necessary, taking full
responsibility for the ultimate content of the present
manuscript.
References
|
1
|
Chen L, Chen C, Chen Q, Jiang T, Zheng L,
Tang R and Wang C: Deacetylasperulosidic acid methyl ester
ameliorates carbon tetrachloride-induced liver fibrosis by
suppressing inflammation and modulating gut microbiota.
Inflammation. 49(16)2025.PubMed/NCBI View Article : Google Scholar
|
|
2
|
Zhang F, Yue K, Sun S, Lu S, Jia G, Zha Y,
Zhang S, Chou CJ, Liao C, Li X and Duan Y: Targeting histone
deacetylase 11 with a highly selective inhibitor for the treatment
of MASLD. Adv Sci (Weinh). 12(e2412903)2025.PubMed/NCBI View Article : Google Scholar
|
|
3
|
Raza S, Mahamood R, Medhe P, Shahi A,
Yadav A, Tewari A and Sinha RA: Sterile inflammation in MASH:
Emerging role of extracellular RNA and therapeutic strategies. NPJ
Metab Health Dis. 3(39)2025.PubMed/NCBI View Article : Google Scholar
|
|
4
|
Hu H, Tian M, Ding C and Yu S: The C/EBP
homologous protein (CHOP) transcription factor functions in
endoplasmic reticulum stress-induced apoptosis and microbial
infection. Front Immunol. 9(3083)2019.PubMed/NCBI View Article : Google Scholar
|
|
5
|
Yuan JR, Tang J and Sheng R: The stress
responsive transcription factor ATF4: from molecular structure to
disease mechanisms. J Adv Re: Mar 12, 2026 (Epub ahead of
print).
|
|
6
|
Hwang HJ, Lee SR, Yoon JG, Moon HR, Zhang
J, Park E, Yoon SI and Cho JA: Ferulic acid as a protective
antioxidant of human intestinal epithelial cells. Antioxidants
(Basel). 11(1448)2022.PubMed/NCBI View Article : Google Scholar
|
|
7
|
Wang X, Li M, Chi Z, Wang M, Liu J, Li A,
Song B and Tong L: Endoplasmic reticulum stress in skeletal muscle
dysfunction of type 2 diabetes: Mechanisms and therapeutic
implications. Front Endocrinol (Lausanne).
17(1769545)2026.PubMed/NCBI View Article : Google Scholar
|
|
8
|
Yin JB, Wang YX, Fan SS, Shang WB, Zhu YS,
Peng XR, Zou C and Zhang X: Geniposide ameliorates
bleomycin-induced pulmonary fibrosis in mice by inhibiting
TGF-β/Smad and p38MAPK signaling pathways. PLoS One.
19(e0309833)2024.PubMed/NCBI View Article : Google Scholar
|
|
9
|
Yang L, Bi L, Jin L, Wang Y, Li Y, Li Z,
He W, Cui H, Miao J and Wang L: Geniposide ameliorates liver
fibrosis through reducing oxidative stress and inflammatory
respose, inhibiting apoptosis and modulating overall metabolism.
Front Pharmacol. 12(772635)2021.PubMed/NCBI View Article : Google Scholar
|
|
10
|
Li J, Ge H, Xu Y, Xie J, Yan F and Chen W:
Geniposide alleviates oxidative damage in hepatocytes through
regulating miR-27b-3p/Nrf2 axis. J Agric Food Chem. 70:11544–11553.
2022.PubMed/NCBI View Article : Google Scholar
|
|
11
|
Zhong M, Wu Z, Chen Z, Wu L and Zhou J:
Geniposide alleviates cholesterol-induced endoplasmic reticulum
stress and apoptosis in osteoblasts by mediating the GLP-1R/ABCA1
pathway. J Orthop Surg Res. 19(179)2024.PubMed/NCBI View Article : Google Scholar
|
|
12
|
Torre A, Martínez-Sánchez FD,
Narvaez-Chávez SM, Herrera-Islas MA, Aguilar-Salinas CA and
Córdova-Gallardo J: Pirfenidone use in fibrotic diseases: What do
we know so far? Immun Inflamm Dis. 12(e1335)2024.PubMed/NCBI View Article : Google Scholar
|
|
13
|
Livak KJ and Schmittgen TD: Analysis of
relative gene expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) method. Methods. 25:402–408.
2001.PubMed/NCBI View Article : Google Scholar
|
|
14
|
Lee YS and Seki E: In vivo and in vitro
models to study liver fibrosis: Mechanisms and limitations. Cell
Mol Gastroenterol Hepatol. 16:355–367. 2023.PubMed/NCBI View Article : Google Scholar
|
|
15
|
Ajoolabady A, Kaplowitz N, Lebeaupin C,
Kroemer G, Kaufman RJ, Malhi H and Ren J: Endoplasmic reticulum
stress in liver diseases. Hepatology. 77:619–639. 2023.PubMed/NCBI View Article : Google Scholar
|
|
16
|
Karin M and Kim JY: Endoplasmic reticulum
stress at the forefront of fatty liver diseases and cancer.
Pharmacol Rev. 77(100096)2025.PubMed/NCBI View Article : Google Scholar
|
|
17
|
Saaoud F, Liu L, Xu K, Cueto R, Shao Y, Lu
Y, Sun Y, Snyder NW, Wu S, Yang L, et al: Aorta- and
liver-generated TMAO enhances trained immunity for increased
inflammation via ER stress/mitochondrial ROS/glycolysis pathways.
JCI Insight. 8(e158183)2023.PubMed/NCBI View Article : Google Scholar
|
|
18
|
Green DR: The mitochondrial pathway of
apoptosis part II: The BCL-2 protein family. Cold Spring Harb
Perspect Biol. 14(a041046)2022.PubMed/NCBI View Article : Google Scholar
|
|
19
|
Xu L, Bi Y, Xu Y, Wu Y, Du X, Mou Y and
Chen J: Suppression of CHOP reduces neuronal apoptosis and rescues
cognitive impairment induced by intermittent hypoxia by inhibiting
Bax and Bak activation. Neural Plast. 2021(4090441)2021.PubMed/NCBI View Article : Google Scholar
|
|
20
|
New-Aaron M, Adepoju LA, Pathania AS,
Kharbanda KK and Osna NA: Hepatocyte-derived apoptotic bodies as
pathological intercellular messengers in the liver. Biomolecules.
16(198)2026.PubMed/NCBI View Article : Google Scholar
|
|
21
|
Maiers JL and Malhi H: Endoplasmic
reticulum stress in metabolic liver diseases and hepatic fibrosis.
Semin Liver Dis. 39:235–248. 2019.PubMed/NCBI View Article : Google Scholar
|
