Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
July-August 2011 Volume 2 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-August 2011 Volume 2 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Expression of cecropin B in Pichia pastoris and its bioactivity in vitro

  • Authors:
    • Xiuqing Wang
    • Mingxing Zhu
    • Guimao Yang
    • Chunxia Su
    • Aijun Zhang
    • Ruibing Cao
    • Puyan Chen
  • View Affiliations / Copyright

    Affiliations: School of Clinical Laboratory of Medicine, NingXia Medical University, Yinchuan 750004, P.R. China, Laboratory Animal Centre, NingXia Medical University, Yinchuan 750004, P.R. China, School of Basic Medical Science, NingXia Medical University, Yinchuan 750004, P.R. China, Key Laboratory of Animal Disease Diagnosis and Immunology, Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210095, P.R. China
  • Pages: 655-660
    |
    Published online on: May 9, 2011
       https://doi.org/10.3892/etm.2011.262
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Natural cecropin B (CB), consisting of 35 amino acids, is a member of the cecropin family with the highest antibacterial activity. Here, a novel approach for the generation of recombinant CB in the methylotrophic yeast Pichia pastoris was explored. For this purpose, the CB gene was amplified by recursive PCR (rPCR) and cloned into the pPICZαA vector. The SacI-linearized plasmid pPICZαA-CB was transformed into P. pastoris SMD1168 by electroporation. The expression of recombinant CB was induced with 1.0% methanol at pH 5.0 for 60 h at 28˚C. Recombinant CB was purified using cationic exchange chromatography; 5.0 mg of pure active CB was obtained from 100 ml of culture broth supernatant. Antimicrobial assays demonstrated that CB has a broad spectrum of antimicrobial activity against both Gram-positive and Gram-negative bacteria. Our results suggest that the P. pastoris expression system can be used to produce large quantities of fully functional CB for both research and industrial purposes.

Introduction

Antimicrobial peptides (AMPs) are amphiphilic, positively charged molecules (1–4) that have emerged as novel antimicrobial agents for use in therapeutics, animal drugs and food preservatives. In recent years, many different types of AMPs have been identified in various organisms, including amphibians, mammals, plants, invertebrates and prokaryotes (1,5–7). Currently, the database of the National Center for Biotechnology Information records more than 800 sequences of antibacterial peptides and proteins from both animals and plants.

The cecropin family of antibacterial peptides is found in the immune hemolymph of silkworm pupae (8), insects and mammals (9,10) and plays an important role in the innate immune systems of these animals. The cecropin family is comprised of cecropins A, B, C, D, E and F, all of which are 35 to 39 amino acids in length and share highly homologous sequences (11). These peptides were originally described as having a broad spectrum of antibacterial activity against both Gram-positive and Gram-negative bacteria, but lacking the ability to lyse eukaryotic cells (12). Therefore, cecropins are considered to be valuable peptide antibiotics, particularly against bacteria that have developed resistance to chemical antibiotics. Moreover, previous studies (5) have demonstrated that cecropins lyse cancer cells, opening the possibility for their use in medical applications (13).

Over the past decade, bacterial resistance to antibiotics has risen dramatically. Thus, there is an increasing need to discover and introduce novel effective antibiotic drugs. Cationic antimicrobial peptides are one potential source of novel antibiotics. Antimicrobial peptides are naturally occurring antibiotics (14). As part of the innate immune system of vertebrates, these peptides have direct antimicrobial function (15). However, few peptide antibiotics have been tested in clinical trials, and these few have exhibited mixed results (16–19). ABP-CB is a promising novel antibiotic candidate. However, the yield of ABP-CB extracted from the silkworm is fairly small. The use of recombinant expression methods may allow for the production of a sufficient quantity of ABP-CB in order to meet the demand. We expressed ABP-CB in the methylotrophic yeast Pichia pastoris, which has been widely utilized as a heterologous gene expression system. The increasing popularity of this expression system is attributed to three key advantages: i) it possesses a highly regulated alcohol oxidase (AOX1) promoter gene that can be induced by methanol and repressed by glucose and glyceroland; ii) a minimal salt medium yields a high cell density, making this system cost-effective; and iii) P. pastoris possesses subcellular organelles, such as an endoplasmic reticulum and Golgi apparatus, allowing for post-translational modifications that include protein folding, disulfide bridge formation and glycosylation (20–24).

Here, the synthesis of the ABP-CB gene, the extracellular expression of ABP-CB protein in P. pastoris SMD 1168 and the characterization of the biological activity of recombinant ABP-CB are described in detail.

Materials and methods

Materials

E. coli DH5α was used for cloning the pPICZα-A-ABP-CB plasmid. E. coli K88 and Staphylococcus aureus (Cowan I) were used for the antibacterial assay.

The pPICZα-A vector (Invitrogen) was used for the expression of ABP-CB. The P. pastoris strain SMD1168 (his− mut+) was used for the expression of the ABP-CB protein.

The restriction enzymes XhoI, XbaI and SacI and T4 DNA ligase were purchased from Takara (Nanjing, China).

Synthesis of cecropin B

Three 60-bp oligomers with 20 bases complementary to their 3′ ends were designed based on the CB amino acid sequence. In order to express the native N-terminus of CB, a XhoI restriction site was introduced into the α-factor secretion signal of the pPICZ-A expression vector to allow in-frame cloning, and a nucleotide sequence encoding the KEX2 cleavage site was placed upstream of the CB gene. At the C-terminus, an Asn codon, a XbaI restriction site and a stop codon were introduced. The sequences of the primers were as follows: F1, cctctcgagaaaagaaagtggaaggtcttcaagaaga tcgaaaagatgggtcgtaac; F2, gatagctggaccagccttgacgataccgttacg gatgttacgacccatcttttc; F3, gctggtccagctatcgctgtcctaggtgaagct aaggctctacaa tga tct aga act.

Gene splicing by overlap extension (SOE) was used for gene synthesis (Fig. 1). An additional pair of primers was designed for identification of the recombinant vector and yeast. The upstream primer targeted the 5′ AOX gene region of P. pastoris, and the downstream primer targeted the insertion region of CB; the amplification length was 496 bp. The sequences of the primers were as follows: P1: 5′ GTCTCC ACATTGTATGCTTC3′ ; P2, 5′ CTGTGCAGGAACTTGAT3′ .

Figure 1.

Schematic representation of synthetic cecropin B.

All primers were synthesized by the Shanghai Branch Office of Invitrogen.

PCR amplification was performed according to the SOE method using the F1, F2 and F3 elements as templates and primers. In addition, Touchdown (TD) PCR technology was used to optimize the PCR method in order to ensure the specificity of the SOE synthesis. The TD-PCR reaction involved the following solutions: 5 μl 10X Mg2+-free PCR buffer; 3 μl 25 mmol/l MgCl2; 1 μl 10 mmol/l dNTP; 2 μl each 40 pmol/l F1, F2, F3; 0.5 μl Takara ExTaq™; and 38.5 μl sterile ultrapure water. All solutions were mixed uniformly and centrifuged for use in TD-PCR. The reaction was initialized at 94°C for 2 min and TD-PCR circulation was performed at 94°C for 30 sec; the annealing temperature was decreased from 65 to 50°C in 0.5°C increments/min and maintained at 72°C for 1 min; the temperature was then maintained at 50°C after 30 cycles, and then another 15 cycles were performed at an optimization temperature of 52°C; extension was performed at 72°C for 6 min.

Construction of recombinant expression plasmids

PCR products and pPICZα-A vectors were digested with XhoI and XbaI, gel-purified and ligated together. E. coli DH5α was chemically transformed with the recombinant vectors and then cultured at 37°C on low-salt LB supplemented with 25 μg/ml Zeocin for selection of recombinants. The nucleotide sequence of the recombinant pPICZα-A-CB plasmid was verified by restriction analysis and DNA sequencing in order to ensure 100% identity with the expected sequence and in-frame orientation. The positive clones were then grown for further DNA transformation.

Transformation and PCR analysis of P. pastoris

Yeast cells were transformed using the Pichia Expression kit. Briefly, 80 μl of competent P. pastoris SMD1168 cells mixed with 5 μg SacI-linearized pPICZα-A-CB were transferred into an ice-cold 0.2-cm electroporation cuvette and incubated in an ice bath for 5 min. Immediately following electroporation at 1.5 kV, 25 µF, 200 Ω, 1 ml of ice-cold 1 M sorbitol was added to the cuvette, which was then incubated for 1 h at 30°C without shaking. Aliquots of 200 μl were spread on YPDS plates supplemented with 100 μg/ml Zeocin, and the plates were incubated at 30°C until colonies appeared. As a negative control, linearized pPICZα-A vector alone was transformed into P. pastoris SMD1168 cells.

The transformants bearing the genomic integrants of the pPICZα-A-CB plasmids were identified by genomic PCR using primers P1 and P2. The method of ‘boiling-freezing-boiling’ was used to prepare the Pichia genomic DNA template. PCR amplification was performed with the following conditions: initial denaturation at 94°C for 5 min, followed by 26 cycles at 94°C for 1 min, 46°C for 1 min and 72°C for 1 min, and elongation at 72°C for 7 min.

Induction of ABP-CB expression in recombinant P. pastoris using the shake-flask method

A single colony of transformants was grown in 5 ml of buffered glycerol-complex medium [BMGY, 1% (w/v) yeast extract, 2% (w/v) peptone, 1.34% YNB, 1% glycerol, 0.4 μg/ml biotin, buffered with 1/10 volume potassium phosphate buffer pH 6.0] in a 50-ml flask. The culture was grown at 28°C in a rotating shaker at 230 rpm for 24 h until the culture reached an OD600 equal to 5. The culture was harvested after centrifugation at 1,500 g for 5 min at room temperature. To induce ABP-CB expression, the pellet was resuspended in 25 ml of buffered methanol-complex medium [BMMY, 1% (w/v) yeast extract, 2% (w/v) peptone, 1.34% YNB, 0.5% methanol, 0.4 μg/ml biotin, buffered with 1/10 volume potassium phosphate buffer pH 6.0] in a 250-ml flask and grown at 28°C with shaking. To maintain expression of ABP-CB, methanol was added to the culture at a final concentration of 1%. In addition, aliquots were sampled throughout the incubation time in order to perform activity assays. Several parameters that could influence the level of protein expression were analyzed. Antibacterial activity assays were performed by measuring zones of growth inhibition of E. coli K88 in thin agar plates, as described by Cipakova et al (25) A total of 100 μl of each condensed expression supernatant was added to the wells.

Determination of ABP-CB expression efficiency and protein concentration

The efficiency of ABP-CB expression was assessed by Tricine-SDS-PAGE. Protein concentration was determined using the Bio-Rad dye agent with bovine serum albumin (BSA) as a standard (23).

Purification of secreted cecropin B

After 60 h of culture, the culture medium (100 ml) was collected by centrifugation at 12,000 g for 30 min. The supernatant was filtrated using the Amicon ultrafiltration device. The filtrate, which contained proteins that ranged from 3 to 10 kDa in size, was dialyzed overnight in 0.1 M sodium acetate and then applied to a CM-Sepharose CL-6B column (Pharmacia Biosciences, USA) pre-equilibrated with 0.1 M sodium acetate (pH 4.5). The column was washed with 0.1 M acetate buffer, and the proteins were eluted using a linear gradient of 0.1–1.0 M sodium acetate (pH 4.5). The purified proteins were analyzed by Tricine-SDS-PAGE.

Antimicrobial assays

The antimicrobial activity of CB was tested against several Gram-positive and Gram-negative bacteria. The minimal growth inhibition concentration (MIC), which is defined as the lowest concentration of a peptide that can inhibit the growth of a microorganism (26), was determined by performing a liquid growth inhibition assay (27). A stock solution of CB was serially diluted 10-fold in 0.01% acetic acid and 0.2% BSA. Aliquots of each dilution (10 μl) were distributed into the wells of a 96-well polypropylene microtiter plate, and each well was inoculated with 100 μl of a suspension of mid-log bacteria (2–7×105 CFU/ml) in LB broth. Cultures were grown for 24 h at 30°C with vigorous shaking, and the bacterial concentration was evaluated by measuring the absorbance of the cultures at 600 nm using a microplate reader (Bio-Rad, USA).

Acid stability analysis of recombinant CB

Buffers of pH ranging from 2.5 to 8.5 were prepared. Antibacterial CB peptide (20 μl) and of the different buffers were mixed in order to check the acid stability of CB. Buffer alone was used as a negative control.

Heat stability of recombinant CB

Recombinant CB was heated at 60, 80 and 100°C for 5 min, and then centrifuged at 12,000 rpm for 10 min in order to separate the precipitate. The supernatant was then used in the antibacterial assays.

Results

Construction and transformation of pPICZα-A-CB

Fig. 1 shows a schematic representation of the sequence of the synthetic CB peptide. The amplification of the CB gene was achieved through TD-PCR, resulting in a product of 129 bp in length. After transformation, transformants were screened by restriction enzyme analysis using XhoI and XbaI and sequencing. The results of restriction enzyme analysis and DNA sequencing revealed that the CB gene was inserted correctly into the expression vector. Transformation with the SacI-linearized version of pPICZα-A-CB favored its insertion into the yeast genome by homologous recombination.

Determination of the optimal conditions for secretion of recombinant CB

The activity of the recombinant CB secreted by P. pastoris was analyzed under several different conditions. The supernatant was collected and its antimicrobial activity was monitored by performing bacterial inhibition assays. In addition, several parameters that affect the level of protein expression were assayed. The secretion of proteases into the medium, and possibly their release due to cell lysis, is a significant problem in many high-cell-density cultures because it can lead to proteolytic degradation. The induction temperature is also an important parameter. In P. pastoris, incubation at 30, 25, 20 and 15°C was performed in attempts to minimize extracellular proteolysis. Lower temperatures have been shown to reduce protease levels and to greatly enhance the yield of biologically active proteins in P. pastoris (8,28–31). We found that reducing the incubation temperature from 30 to 20°C during the methanol-feed phase dramatically increased the yield of recombinant protein (data not shown). Culture of P. pastoris on BMMY medium at pH 6.0 provided the most optimal conditions for the expression of CB, and a methanol induction time of 60 h was the most suitable (Figs. 2 and 3).

Figure 2.

Effect of pH on the production of recombinant cecropin B.

Figure 3.

Effect of methanol concentration on the production of recombinant cecropin B.

Expression of CB in P. pastoris

The highest CB-producing P. pastoris clone was selected for subsequent large-scale protein expression under the most optimal conditions of 28°C with 1.0% methanol for 60 h. Approximately 50 mg of ABP-CB was secreted into 1 l of medium. The resultant protein appeared as a single homogeneous band on a Coomassie blue-stained Tricine-SDS-PAGE gel (Fig. 4). The size of the recombinant CB was consistent with the expected molecular weight of 4.7 kDa calculated from the amino acid sequence.

Figure 4.

Tricine-SDS-PAGE analysis of cecropin B. M1, ultra-low molecular weight protein marker; M2, low molecular weight protein marker; lanes 1 and 2, culture supernatant of SMD1168/pPICZα-CB; lane 3, purified cecropin B; lane 4, supernatant of SMD1168/pPICZα.

Antimicrobial assay

The antibacterial activity of recombinant CB was qualitatively determined with a radial diffusion assay using E. coli as a representative Gram-negative bacterium. CB was found to be highly effective against E. coli (Fig. 5). Similar results were obtained from radial diffusion assays using the Gram-positive bacterium S. aureus (Fig. 6, Table I).

Figure 5.

Analysis of the antibacterial activity of cecropin B against E. coli. A, Amp control (25 μg/ml); 1, 3 and 4: supernatant of cecropin B; 2, 5 and 6: control supernatant from P. pastoris SMD1168/pPICZα-A.

Figure 6.

Analysis of the antibacterial activity of cecropin B against S. aureus. A, Amp control (25 μg/ml); 1, 2 and 4: supernatant of cecropin B; 3, 5 and 6: control supernatant from P. pastoris SMD1168/pPICZα-A.

Table I.

Antibacterial activity of cecropin B (MIC) expressed as the final concentration in μM.

Table I.

Antibacterial activity of cecropin B (MIC) expressed as the final concentration in μM.

MicroorganismMIC (μM)
Gram-positive bacteria
  Staphylococcus aureus0.89
  Bacillus subtilis0.98
  Sporosarcina0.88
  Curtobacterium0.97
Gram-negative bacteria
  E. coli0.50
  Salmonella pullorum0.78
  Pseudomonas aeruginosa0.98
Acid stability of recombinant CB

Recombinant CB had the strongest antibacterial activity at pH 4.0. There were no obvious changes observed in the diameters of the antibacterial zone at pH values between 3.5 and 7.5. The diameter of the antibacterial zone decreased gradually at pH values >7.5. Recombinant CB was stable at low (3.5) and high pH (8.5), resulting in suppressed antibacterial activity (Fig. 7).

Figure 7.

Effect of pH on the antibacterial activity of cecropin B.

Heat stability of recombinant CB

Incubation of the CB supernatant at 60°C for 5 min had no effect on its antibacterial activity. We found that there were many ingredients in the supernatant of the CB peptide, which were removed by treatment at high temperature. Boiling the supernatant for 30 min removed approximately 60% of the mixed proteins found in the supernatant without changing the heat resistance of CB (Fig. 8).

Figure 8.

Effect of temperature on the antibacterial activity of cecropin B.

Discussion

Cecropins are a family of small basic polypeptides that are mainly present in the hemolymph of insects (30). CB exhibits significant antibacterial activity against Gram-positive and Gram-negative bacteria, and also has potent antitumor activity against certain transformed tumor cells, but rather than the hemolytic effect on human erythrocytes. To date, potent CB analogues have been synthesized and have been proven to exhibit effective antibacterial activity; however, heterologous expression of recombinant cecropin has seldom been reported (32,33). Heterologous expression of recombinant proteins results in toxicity for the host cells (27). For a peptide to be used as an antibiotic, the fusion protein partner must be removed from the bacterial expression system; this process is expensive and laborious. Therefore, in the present study, the methylotrophic yeast P. pastoris was used as a host for high level expression and secretion of recombinant CB. Recombinant CB was successfully secreted by P. pastoris into the culture supernatant, and 5.0 mg of recombinant CB was obtained from 100 ml of crude extract. The large-scale production of antibiotic peptides, such as cecropin, will require further exploration regarding the manufacturing methods.

Previously, it was reported that the recombinant protein Psd1, which originates from the C-terminus of the α-factor secretion signal of S. cerevisiae and contains four additional amino acids (EAEA) at the N-terminal region, was produced by P. pastoris. In addition, recombinant Psd1 was shown to decrease antifungal activity against A. niger by at least 10-fold (22,34). In the present study, we cloned the gene encoding CB, with only the KEX2 cleavage site, by recursive PCR in order to obtain CB protein with its native N-terminus. Tricine-SDS-PAGE revealed that CB was successfully secreted by the P. pastoris α-mating factor signal sequence into the culture supernatant. Activity assays demonstrated that CB had low MIC against all Gram-negative and Gram-positive bacteria tested. Additionally, our results showed that the signal peptide was efficiently processed by the KEX2 protease through the P. pastoris secretory pathway.

Expression of a foreign gene, in this case CB, in P. pastoris and secretion of the active antibacterial peptide suggest that the CB gene could be introduced into animal cells in order to enhance their resistance to bacterial pathogens. Previously, we showed that both CB and cecropin P1 produced by transgene constructs under the control of the cytomegalovirus (CMV) promoter in Chinook salmon embryo cells (CHSE-214) exhibited bactericidal activity against three pathogens (35). In addition, the expression of cecropin in yeast and fish cells demonstrates that the cecropin gene can be introduced into animal cells. Moreover, the expression of CB by transgenic plants has also been reported (36,37). However, further studies are required to address the feasibility of generating cecropin-expressing transgenic animals for the purpose of increasing their resistance to microbial diseases. In this study, we showed that heterologous CB can be expressed in P. pastoris under the promoter for the secretion signal of the yeast-mating factor. Recombinant CB was expressed at a concentration of 50 mg/l in culture medium, and it exhibited strong antimicrobial activity. Our results show that P. pastoris is a robust system that can be used for the expression of secreted CB, which exhibits antibacterial activity against both Gram-positive and Gram-negative bacteria (7–11).

References

1. 

Devine DA and Hancock RE: Cationic peptides: distribution and mechanisms of resistance. Curr Pharm Des. 8:703–714. 2002. View Article : Google Scholar : PubMed/NCBI

2. 

Ganz T: Defensins: antimicrobial peptides of innate immunity. Nat Rev Immunol. 3:710–720. 2003. View Article : Google Scholar : PubMed/NCBI

3. 

Segrest JP, De Loof H, Dohlman JG, Brouillette CG and Anantharamaiah GM: Amphipathic helix motif: classes and properties. Proteins. 8:103–117. 1990. View Article : Google Scholar : PubMed/NCBI

4. 

Zasloff M: Antimicrobial peptides of multicellular organisms. Nature. 415:389–395. 2002. View Article : Google Scholar : PubMed/NCBI

5. 

Boman HG: Peptide antibiotics and their role in innate immunity. Annu Rev Immunol. 13:61–92. 1995. View Article : Google Scholar : PubMed/NCBI

6. 

Noga EJ and Silphaduang U: Piscidins: a novel family of peptide antibiotics from fish. Drug News Perspect. 16:87–92. 2003. View Article : Google Scholar : PubMed/NCBI

7. 

Steiner H, Hultmark D, Engstrom A, Bennich H and Boman HG: Sequence and specificity of two antibacterial proteins involved in insect immunity. Nature. 292:246–248. 1981. View Article : Google Scholar

8. 

Boman HG and Hultmark D: Cell-free immunity in insects. Annu Rev Microbiol. 41:103–126. 1987. View Article : Google Scholar : PubMed/NCBI

9. 

Lee JY, Boman A, Sun CX, Andersson M, Jornvall H, Mutt V and Boman HG: Antibacterial peptides from pig intestine: isolation of a mammalian cecropin. Proc Natl Acad Sci USA. 86:9159–9162. 1989. View Article : Google Scholar : PubMed/NCBI

10. 

Hultmark D, Engstrom A, Bennich H, Kapur R and Boman HG: Insect immunity: isolation and structure of cecropin D and four minor antibacterial components from Cecropia pupae. Eur J Biochem. 127:207–217. 1982. View Article : Google Scholar : PubMed/NCBI

11. 

Boman HG, Wade D, Boman IA, Wahlin B and Merrifield RB: Antibacterial and antimalarial properties of peptides that are cecropin-melittin hybrids. FEBS Lett. 259:103–106. 1989. View Article : Google Scholar : PubMed/NCBI

12. 

Moore AJ, Devine DA and Bibby MC: Preliminary experimental anticancer activity of cecropins. Pept Res. 7:265–269. 1994.PubMed/NCBI

13. 

Hancock RE and Lehrer R: Cationic peptides: a new source of antibiotics. Trends Biotechnol. 16:82–88. 1998.PubMed/NCBI

14. 

Hancock RE and Patrzykat A: Clinical development of cationic antimicrobial peptides: from natural to novel antibiotics. Curr Drug Targets Infect Disord. 2:79–83. 2002. View Article : Google Scholar : PubMed/NCBI

15. 

Diamond G: Natures antibiotics: the potential of antimicrobial peptides as new drugs. Biologist. 48:209–212. 2001.PubMed/NCBI

16. 

Andres E and Dimarcq JL: Cationic antimicrobial peptides: from innate immunity study to drug development. Med Mal Infect. 37:194–199. 2007.PubMed/NCBI

17. 

Cereghino JL and Cregg JM: Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol Rev. 24:45–66. 2000. View Article : Google Scholar

18. 

Sreekrishna K, Brankamp RG, Kropp KE, Blankenship DT, Tsay JT, Smith PL, Wierschke JD, Subramaniam A and Birkenberger LA: Strategies for optimal synthesis and secretion of heterologous proteins in the methylotrophic yeast Pichia pastoris. Gene. 190:55–62. 1997. View Article : Google Scholar : PubMed/NCBI

19. 

Cregg JM, Cereghino JL, Shi J and Higgins DR: Recombinant protein expression in Pichia pastoris. Mol Biotechnol. 16:23–52. 2000. View Article : Google Scholar : PubMed/NCBI

20. 

Boze H, Celine L, Patrick C, Fabien R, Christine V, Yves C and Guy M: High-level secretory production of recombinant porcine follicle-stimulating hormone by Pichia pastoris. Process Biochem. 36:907–913. 2001. View Article : Google Scholar

21. 

Lee CY, Lee SJ, Jung KH, Katoh S and Lee K: High dissolved oxygen tension enhances heterologous protein expression by recombinant Pichia pastoris. Process Biochem. 38:1147–1154. 2003. View Article : Google Scholar

22. 

Almeida MS, Cabral KS, de Medeiros LN, Valente AP, Almeida FC and Kurtenbach E: cDNA cloning and heterologous expression of functional cysteine-rich antifungal protein Psd1 in the yeast Pichia pastoris. Arch Biochem Biophys. 395:199–207. 2001. View Article : Google Scholar : PubMed/NCBI

23. 

Ausubel FM, Brent R and Kingston RE: Protocols in molecular biology. Trends Cell Biol. 6:366–367. 1996.

24. 

Lehrer RI, Rosenman M, Harwig SS, Jackson R and Eisenhauer P: Ultrasensitive assays for endogenous peptides. J Immunol Methods. 137:167–173. 1991. View Article : Google Scholar

25. 

Cipakova I, Hostinova E, Gasperik J and Velebny V: High-level expression and purification of a recombinant hBD-1 fused to LMM protein in Escherichia coli. Protein Expr Purif. 37:207–212. 2004. View Article : Google Scholar : PubMed/NCBI

26. 

Shi X, Karkut T, Chamankhah M, Alting-Mees M, Hemmingsen SM and Hegedus D: Optimal conditions for the expression of a single-chain antibody (scFv) gene in Pichia pastoris. Protein Express Purif. 28:321–330. 2003. View Article : Google Scholar : PubMed/NCBI

27. 

Jahic M, Gustavsson M, Jansen AK, Martinelle M and Enfors SO: Analysis and control of proteolysis of a fusion protein in Pichia pastoris fed-batch processes. J Biotechnol. 102:45–53. 2003. View Article : Google Scholar : PubMed/NCBI

28. 

Li SZ, Xiong F and Lin Q: Low-temperature increases the yield of biologically active herring antifreeze protein in Pichia pastoris. Protein Express Purif. 21:438–445. 2001. View Article : Google Scholar : PubMed/NCBI

29. 

Bencurova M, Rendic D, Fabini G, Kopecky EM, Altmann F and Wilson IB: Expression of eukaryotic glycosyltransferases in the yeast Pichia pastoris. Biochimie. 85:413–422. 2003. View Article : Google Scholar : PubMed/NCBI

30. 

Skosyrev VS, Kulesskiy EA, Yakhnin AV, Temirov YV and Vinokurov LM: Expression of the recombinant antibacterial peptide sarcotoxin IA in Escherichia coli cells. Protein Expr Purif. 28:350–356. 2003. View Article : Google Scholar : PubMed/NCBI

31. 

Aly R, Granot D, Mahler-Slasky Y, Halpern N, Nir D and Galun E: Saccharomyces cerevisiae cells harboring the gene encoding sarcotoxin IA secrete a peptide that is toxic to plant pathogenic bacteria. Protein Expr Purif. 16:120–124. 1999. View Article : Google Scholar

32. 

Yamada K, Nakajima Y and Nator S: Production of recombinant sarcotoxin IA in Bombyx mori cells. Biochem J. 272:633–636. 1990.PubMed/NCBI

33. 

Rao XC, Li S, Hu JC, Jin XL, Hu XM, Huang JJ, Chen ZJ, Zhu JM and Hu FQ: A novel carrier molecule for high-level expression of peptide antibiotics in Escherichia coli. Protein Expr Purif. 36:11–18. 2004. View Article : Google Scholar : PubMed/NCBI

34. 

Cabral KM, Almeida MS, Valente AP, Almeida FC and Kurtenbach E: Production of the active antifungal Pisum sativum defensin 1 (Psd1) in Pichia pastoris: overcoming the inefficiency of the STE13 protease. Protein Expr Purif. 31:115–122. 2003.PubMed/NCBI

35. 

Sarmasik A and Chen TT: Bactericidal activity of cecropin B and cecropin P1 expressed in fish cells (CHSE-214): application in controlling fish bacterial pathogens. Aquaculture. 220:183–194. 2003. View Article : Google Scholar

36. 

Sessitsch A, Kan FY and Pfeifer U: Diversity and community structure of culturable Bacillus spp. populations in the rhizospheres of transgenic potatoes expressing the lytic peptide cecropin B. Appl Soil Ecol. 22:149–158. 2003.

37. 

Sharma A, Sharma R, Imamura M, Yamakawa M and Machii H: Transgenic expression of cecropin B, an antibacterial peptide from Bombyx mori, confers enhanced resistance to bacterial leaf blight in rice. FEBS Lett. 484:7–11. 2000. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang X, Zhu M, Yang G, Su C, Zhang A, Cao R and Chen P: Expression of cecropin B in Pichia pastoris and its bioactivity in vitro. Exp Ther Med 2: 655-660, 2011.
APA
Wang, X., Zhu, M., Yang, G., Su, C., Zhang, A., Cao, R., & Chen, P. (2011). Expression of cecropin B in Pichia pastoris and its bioactivity in vitro. Experimental and Therapeutic Medicine, 2, 655-660. https://doi.org/10.3892/etm.2011.262
MLA
Wang, X., Zhu, M., Yang, G., Su, C., Zhang, A., Cao, R., Chen, P."Expression of cecropin B in Pichia pastoris and its bioactivity in vitro". Experimental and Therapeutic Medicine 2.4 (2011): 655-660.
Chicago
Wang, X., Zhu, M., Yang, G., Su, C., Zhang, A., Cao, R., Chen, P."Expression of cecropin B in Pichia pastoris and its bioactivity in vitro". Experimental and Therapeutic Medicine 2, no. 4 (2011): 655-660. https://doi.org/10.3892/etm.2011.262
Copy and paste a formatted citation
x
Spandidos Publications style
Wang X, Zhu M, Yang G, Su C, Zhang A, Cao R and Chen P: Expression of cecropin B in Pichia pastoris and its bioactivity in vitro. Exp Ther Med 2: 655-660, 2011.
APA
Wang, X., Zhu, M., Yang, G., Su, C., Zhang, A., Cao, R., & Chen, P. (2011). Expression of cecropin B in Pichia pastoris and its bioactivity in vitro. Experimental and Therapeutic Medicine, 2, 655-660. https://doi.org/10.3892/etm.2011.262
MLA
Wang, X., Zhu, M., Yang, G., Su, C., Zhang, A., Cao, R., Chen, P."Expression of cecropin B in Pichia pastoris and its bioactivity in vitro". Experimental and Therapeutic Medicine 2.4 (2011): 655-660.
Chicago
Wang, X., Zhu, M., Yang, G., Su, C., Zhang, A., Cao, R., Chen, P."Expression of cecropin B in Pichia pastoris and its bioactivity in vitro". Experimental and Therapeutic Medicine 2, no. 4 (2011): 655-660. https://doi.org/10.3892/etm.2011.262
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team