Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
January 2012 Volume 3 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January 2012 Volume 3 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Polymorphisms of IGFI contribute to the development of ischemic stroke

  • Authors:
    • Hak Jae Kim
    • Su Kang Kim
    • Hae Jeong Park
    • Joo-Ho Chung
    • Jinman Chun
    • Dong Hwan Yun
    • Young Ock Kim
  • View Affiliations / Copyright

    Affiliations: Soonchunhyang Medical Research Institute, College of Medicine, Soonchunhyang University, Chunan, Republic of Korea, Department of Pharmacology and Kohwang Medical Research Institute, School of Medicine, Kyung Hee University, Seoul, Republic of Korea, Department of Physical Medicine and Rehabilitation, School of Medicine, Kyung Hee University, Seoul, Republic of Korea, Ginseng and Medical Plants Research Institute Rural Development Administration, Chunbuk 369-873, Republic of Korea
  • Pages: 93-98
    |
    Published online on: October 21, 2011
       https://doi.org/10.3892/etm.2011.372
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Insulin-like growth factor 1 (IFG1) is neuroprotective in animal models of focal brain ischemia and correlates with ischemic stroke (IS) outcome in the elderly. In this study, we investigated whether single nucleotide polymorphisms (SNPs) of the IFG1 gene are associated with the development and clinical features of IS in a Korean population. A total of 119 patients with IS and 289 control subjects were recruited. Stroke patients were classified into subgroups according to the scores of the National Institutes of Health Stroke Survey (NIHSS; <6 and ≥6) and the Modified Barthel Index (MBI; <60 and ≥60). Among the SNPs of the IFG1 gene, five SNPs were selected and analyzed by direct sequencing: rs2162679 (intron), rs2195239 (intron), rs978458 (intron), rs1520220 (intron) and rs6214 (3' untranslated region; 3'UTR). Multiple logistic regression models were conducted to analyze genetic data. SNPStats, SNPAnalyzer Pro and Helixtree programs were used to calculate odds ratios (ORs), 95% confidence intervals (CIs) and p-values. Two SNPs, rs2162679 and rs6214, were associated with the development of IS. After Bonferroni correction (pc), the A and G alleles of rs2162679 and rs6214 had significant differences between patients with IS and the controls [rs2162679, OR (95% CI) = 1.64 (1.17-2.31), p=0.004, pc=0.02; rs6214, OR (95% CI) = 1.52 (1.12-2.07), p=0.007, pc=0.035], respectively. However, the five selected SNPs were not related to the NIHSS and MBI scores. These results suggest that IGF1 may be associated with the development of IS.

Introduction

Stroke is a neurological disease which causes long-term disability and is the third leading cause of death in the United States. Ischemic stroke (IS) accounts for approximately 85% of all strokes. The other 9% are caused by intracerebral hemorrhage and 4–5% by subarachnoid hemorrhage (1,2). Environmental and genetic factors are related to the pathogenesis of IS. Several lines of genetic studies have reported the relationship between IS and single nucleotide polymorphisms (SNPs) of candidate genes, such as the transforming growth factor β1 (TGFB1), transforming growth factor β receptor II (70/80 kDa) (TGFBR2) and tumor necrosis factor (TNF) (3–5).

Insulin-like growth factor 1 (somatomedin C) (IGF1) is similar to insulin in function and plays a crucial role in mammalian growth and development. The IGF1 level declines during the normal aging process, and a low IGF1 level correlates with decreased cognitive abilities (6). In vitro studies have shown that IGF1 reduces neuronal cell death in various injury insults (7,8) and IGF1 has a protective effect in ischemic animal models (9,10). Several reports have reviewed the roles of IGF1 in stroke severity and outcome (11,12). They have suggested that IGF levels may be associated with neurological recovery and functional outcome, and have also proposed IGF1 as a predictor of stroke outcome.

In this study, we investigated the association between IGF1 SNPs and IS in a Korean population. We also assessed the relationship between IGF1 SNPs and the clinical phenotypes according to the scores of National Institutes of Health Stroke Survey (NIHSS) and the Modified Barthel Index (MBI).

Materials and methods

Study population and clinical phenotypes

IS patients were enrolled among participants visiting the Departments of Neurosurgery and Physical Medicine and Rehabilitation, Kyung Hee Medical Center (Seoul, Republic of Korea). Patients with transient ischemic attack, cerebrovascular malformation, congenital brain disorders and accidental or iatrogenic stroke, were excluded. Stroke patients were diagnosed by computed tomography, magnetic resonance imaging, angiography and duplex sonography. The control subjects were recruited among healthy volunteers to examine the general health check-up program. Patients with neurological diseases, ischemic heart diseases and other severe diseases, were excluded. All stroke patients were classified into clinical phenotypes according to the NIHSS and MBI scores. For the neurological functional level of IS patient, the severity of 13 neurological symptoms was assessed by the NIHSS score. For the daily living activity of IS patients, the quality of 10 general life activities was evaluated by the MBI score. This study was approved by the Ethics Review Committee of the Medical Research Institute, School of Medicine, Kyung Hee University. Written informed consent was obtained from all patients. If patients were incommunicative, it was obtained from a guardian or close relatives.

SNP selection and genotyping

We searched the coding SNPs (cSNPs) of the IFG1 gene in the SNP database of the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/SNP, BUILD 132). The cSNPs with a heterozygosity of <0.05 and/or a minor allele frequency (MAF) of <0.05, were excluded. Out of five missense and two synonymous SNPs, there were no cSNPs with a heterozygosity of >0.05 or a MAF of >0.05. Therefore, we searched the untranslational and intron SNPs of the IGF1 gene and previous studies (13–15). Finally, five SNPs [rs2162679 (intron), rs2195239 (intron), rs978458 (intron), rs1520220 (intron) and rs6214 (3′ untranslated region; 3′UTR)] were selected (Fig. 1). Genotypes of the five selected SNPs were analyzed by direct sequencing (Macrogen, Seoul, Republic of Korea). Polymerase chain reactions (PCRs) were conducted using the forward and reverse primers of each SNP (Table II). PCRs were performed under the following conditions: 35 cycles at 95°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec, and 1 cycle at 72°C for 5 min for the final reaction. The PCR products were sequenced by an ABI PRISM 3730XL analyzer (PE Applied Biosystems, Foster City, CA, USA) and genotypes of each SNP were analyzed by SeqManII software (DNASTAR, Madison, WI, USA).

Figure 1.

Gene map and single nucleotide polymorphisms in the IGF gene on chromosome 12q23.2. Exons are marked with a box. The coding regions are represented by black boxes and untranslation regions by white boxes.

Table II.

Primer sequences for each single nucleotide polymorphism (SNP).

Table II.

Primer sequences for each single nucleotide polymorphism (SNP).

SNPForward (5′-3′)Reverse (5′-3′)Size (bp)
rs2162679 TCTGCAAGATCAATCACAGGTT AAAAACCAAAACCCCTGTCTCT386
rs2195239 CAAATTTCAGCTGCGACTTTATC GAGCCAAAACCATCTCTACACC306
rs978458 TCCACTAGAGCCAAAGAAGAGC GTGAAATGGTGGAGGATGATTT381
rs1520220 AAAGGATCTAGAGGCCAGAAGG AGTTCTTGTTTCCTGCACTCCC390
rs6214 CCAGACATACAGGTTCTGTGGA TTGGAGAGGATTATGTGTTGGA304
Statistical analysis

SNPStats (http://bioinfo.iconcologia.net/index.php?module=Snpstats), SNPAnalyzer Pro (ISTECH, Goyang, Republic of Korea), and Helixtree (Golden Helix, Bozeman, MT, USA) were used to obtain odds ratios (ORs), 95% confidence intervals (CIs) and p-values. Hardy-Weinberg equilibrium (HWE) was calculated using the Chi-square test. Multiple logistic regression models were conducted using the following models: codominant1 (major allele homozygotes vs. heterozygotes), codominant2 (major allele homozygotes vs. minor allele homozygotes), dominant (major allele homozygotes vs. heterozygotes and minor allele homozygotes), recessive (major allele homozygotes and heterozygotes vs. minor allele homozygotes) and log-additive (major allele homozygotes vs. heterozygotes vs. minor allele homozygotes) (16,17). Bonferroni correction was performed to obtain further statistical significance. Linkage disequilibrium (LD) blocks were estimated using Haploview version 4.2 (Daly Lab, Cambridge, MA, USA). The required case size in each SNP was estimated using the genetic power calculator (http://pngu.mgh.harvard.edu/~purcell/gpc/cc2.html) to obtain the statistical power. The statistical significant level was set at a value of p<0.05.

Results

Demographic and clinical features of study subjects

Table I shows the demographic and clinical features of the IS patients and the control subjects. The age of the IS patients and control subjects was 65.8±12.1 (mean ± SD) and 62.9±9.3 years, respectively. The number of IS patients and control subjects was 119 (66 male/53 female) and 289 (150 male/139 female), respectively. All IS patients were divided into two clinical subgroups according to the NIHSS (<6 and ≥6) and MBI scores (<60 and ≥60). The numbers of IS patients with a NIHSS score of <6 and ≥6 were 55 (49.1%) and 57 (50.9%), respectively. The numbers of IS patients with a MBI score of <60 and ≥60 were 71 (74.7%) and 24 (25.3%), respectively. In two clinical subgroups, patients with inappropriate or insufficient clinical data, were excluded (Table I).

Table I.

Clinical characteristics in stroke patients and control subjects.

Table I.

Clinical characteristics in stroke patients and control subjects.

ISControl
Total no.119289
Male/female (n)66/53150/139
Age (mean ± SD, years)65.8±12.162.9±9.3
NIHSS (score)
  <655
  ≥657
MBI (score)
  <6071
  ≥6024

[i] IS, ischemic stroke; SD, standard deviation; NIHSS, National Institutes of Health Stroke Survey; MBI, Modified Barthel Index. Stroke patients with inappropriate clinical data were excluded.

Genetic analysis of IGF1 SNPs

Table III represents the genotype and allele frequencies of the five examined SNPs (rs2162679, rs2195239, rs978458, rs1520220 and rs6214) in the IS patients and the control subjects. The HWE of the five SNPs showed no difference in the control group (rs2162679, p=0.61; rs2195239, p=0.18; rs978458, p=0.91; rs1520220, p=1.00; rs6214, p=1.00). Multiple logistic regression analysis adjusting for age and gender was performed. An intron SNP (rs2162679) was associated with the development of IS [p=0.0050, OR = 0.27, 95% CI = 0.11–0.67 in the codominant2 model (A/A vs. G/G); p=0.0150, OR = 0.58, 95% CI = 0.37–0.90 in the dominant model (A/A vs. A/G and G/G); p=0.0059, OR = 0.32, 95% CI = 0.13–0.79 in the recessive model (A/A and A/G vs. G/G); and p=0.0020, OR = 0.59, 95% CI = 0.41–0.83 in the log-additive model (A/A vs. A/G vs. G/G)]. A 3′UTR SNP (rs6214) was also associated with the development of IS [p=0.0110, OR = 0.44, 95% CI = 0.23–0.83 in the codominant2 model (G/G vs. A/A); p=0.0250, OR = 0.59, 95% CI = 0.37–0.93 in the dominant model (G/G vs. A/G and A/A); p=0.0420, OR = 0.57, 95% CI = 0.32–1.00 in the recessive model (G/G and A/G vs. A/A); and p=0.0088, OR = 0.66, 95% CI = 0.49–0.90 in the log-additive model (G/G vs. A/G vs. A/A)]. The A allele frequency of rs2162679 was higher in the IS group (74.4%) than in the control group (63.8%) (p=0.004, OR = 1.64, 95% CI = 1.17–2.31). The G allele frequency of rs6214 was higher in the IS group (60.5%) than in the control group (50.2%) (p=0.007, OR = 1.52, 95% CI = 1.12–2.07). After Bonferroni correction (pc), the allele frequencies of rs2162679 and rs6214 showed significant differences between IS and the controls (rs2162679, pc=0.004; rs6214, pc=0.007). The other SNPs (rs2195239, rs978458 and rs1520220) had no differences between IS and the controls (Table III). The LD block was estimated using Haploview version 4.2. One LD block was strongly made between rs1520220 and rs978458 (D’=1.0 and r2=0.993 in the control group). However, the haplotypes of these two SNPs were not associated with the development of IS (data not shown). IS patients were classified into two clinical subgroups according to the NIHSS (<6 and ≥6) and MBI (<60 and ≥60) scores. As shown in Table IV, the five tested SNPs were not associated with the NIHSS and MBI scores.

Table III.

Genotype and allele frequencies of IGF singe nucleotide polymorphisms in controls and IS patients.

Table III.

Genotype and allele frequencies of IGF singe nucleotide polymorphisms in controls and IS patients.

SNPTypeControl
IS
ModelOR (95% CI)p-valuepc
n%n%
rs2162679A/A12041.56353.9Codominant10.68 (0.43–1.07)0.09000.4500
IntronA/G12944.64841.0Codominant20.27 (0.11–0.67)0.00500.0250
G/G4013.865.1Dominant0.58 (0.37–0.90)0.01500.0800
Recessive0.32 (0.13–0.79)0.00590.0295
Log-additive0.59 (0.41–0.83)0.00200.0100
G20936.26025.61
A36963.817474.41.64 (1.17–2.31)0.00400.0200
rs2195239G/G9332.24336.1Codominant10.84 (0.53–1.36)0.48001.0000
IntronC/G15252.66050.4Codominant20.78 (0.39–1.54)0.47001.0000
C/C4415.21613.4Dominant0.83 (0.53–1.30)0.42001.0000
Recessive0.86 (0.46–1.61)0.64001.0000
Log-additive0.87 (0.63–1.21)0.41001.0000
G33858.514661.31
C24041.59238.70.89 (0.65–1.21)0.45001.0000
rs978458G/G9031.14134.5Codominant10.92 (0.57–1.48)0.72001.0000
IntronA/G14449.86050.4Codominant20.70 (0.37–1.36)0.30001.0000
A/A5519.01815.1Dominant0.86 (0.54–1.35)0.51001.0000
Recessive0.74 (0.41–1.34)0.32001.0000
Log-additive0.85 (0.62–1.17)0.32001.0000
G32456.114259.71
A25443.99640.30.86 (0.64–1.17)0.34001.0000
rs1520220C/C9031.14134.8Codominant10.93 (0.57–1.50)0.75001.0000
IntronC/G14349.56050.9Codominant20.64 (0.33–1.25)0.20001.0000
G/G5619.41714.4Dominant0.85 (0.53–1.34)0.47001.0000
Recessive0.68 (0.37–1.23)0.19000.9500
Log-additive0.83 (0.60–1.13)0.23001.0000
C32355.914260.21
G25544.19439.80.84 (0.62–1.14)0.26001.0000
rs6214G/G7325.34437.0Codominant10.66 (0.41–1.08)0.10000.5000
3′UTRA/G14449.85647.1Codominant20.44 (0.23–0.83)0.01100.0600
A/A7224.91916.0Dominant0.59 (0.37–0.93)0.02500.1300
Recessive0.57 (0.32–1.00)0.04200.2100
Log-additive0.66 (0.49–0.90)0.00880.0440
A28849.89439.51
G29050.214460.51.52 (1.12–2.07)0.00700.0350

[i] The p-values were calculated from logistic regression analysis adjusting age and gender. Bold numbers indicate significant associations. IS, ischemic stroke; SNP, singe nucleotide polymorphism; OR, odds ratio; CI, confidence interval.

Table IV.

Genotype frequencies of IGF singe nucleotide polymorphisms in stroke subgroups according to the NIHSS and MBI scores.

Table IV.

Genotype frequencies of IGF singe nucleotide polymorphisms in stroke subgroups according to the NIHSS and MBI scores.

SNPTypeSubgroups
ModelOR (95% CI)p-value
n%n%
NHISS(<6)(≥6)
rs2162679A/A2749.13258.2Codominant10.63 (0.29–1.38)0.25
IntronA/G2647.32036.4Codominant21.26 (0.19–8.23)0.81
G/G23.635.5Dominant0.67 (0.31–1.45)0.31
Recessive1.56 (0.25–9.79)0.63
Log-additive0.79 (0.41–1.53)0.49
rs2195239G/G2341.81628.1Codominant12.00 (0.87–4.59)0.10
IntronC/G2443.63357.9Codominant21.46 (0.45–4.73)0.53
C/C814.6814.0Dominant1.87 (0.84–4.12)0.12
Recessive0.97 (0.34–2.80)0.95
Log-additive1.36 (0.77–2.38)0.28
rs978458G/G2240.01526.3Codominant11.89 (0.82–4.39)0.14
IntronA/G2545.53256.1Codominant21.87 (0.60–5.87)0.28
A/A814.61017.5Dominant1.89 (0.85–4.21)0.12
Recessive1.27 (0.46–3.51)0.65
Log-additive1.46 (0.83–2.54)0.18
rs1520220C/C2240.01526.8Codominant11.77 (0.76–4.10)0.18
IntronC/G2647.33155.4Codominant22.12 (0.66–6.86)0.21
G/G712.71017.9Dominant1.84 (0.83–4.12)0.13
Recessive1.50 (0.52–4.28)0.45
Log-additive1.52 (0.86–2.67)0.14
rs6214G/G2036.42136.8Codominant10.96 (0.42–2.20)0.92
3′UTRA/G2749.12645.6Codominant21.22 (0.40–3.73)0.73
A/A814.61017.5Dominant1.02 (0.47–2.23)0.96
Recessive1.25 (0.45–3.45)0.67
Log-additive1.07 (0.63–1.84)0.79
MBI(<60)(≥60)
rs2162679A/A3753.61562.5Codominant10.96 (0.35–2.65)0.94
IntronA/G2942.0937.5Codominant20.00 (0.00-NA)
G/G34.300.0Dominant0.91 (0.33–2.50)0.85
Recessive0.00 (0.00-NA)0.32
Log-additive0.83 (0.32–2.15)0.70
rs2195239G/G2535.2833.3Codominant11.06 (0.36–3.12)0.91
IntronC/G3650.71354.2Codominant20.86 (0.17–4.33)0.86
C/C1014.1312.5Dominant1.02 (0.36–2.88)0.97
Recessive0.83 (0.19–3.61)0.80
Log-additive0.96 (0.46–2.03)0.92
rs978458G/G2433.8729.2Codominant11.40 (0.46–4.25)0.55
IntronA/G3549.31458.3Codominant20.83 (0.17–4.15)0.82
A/A1216.9312.5Dominant1.26 (0.43–3.66)0.67
Recessive0.67 (0.16–2.82)0.58
Log-additive1.00 (0.48–2.07)1.00
rs1520220C/C2434.3729.2Codominant11.44 (0.47–4.36)0.52
IntronC/G3550.01458.3Codominant20.90 (0.18–4.57)0.90
G/G1115.7312.5Dominant1.31 (0.45–3.81)0.62
Recessive0.72 (0.17–3.06)0.65
Log-additive1.04 (0.50–2.17)0.92
rs6214G/G2636.61041.7Codominant10.41 (0.13–1.32)0.14
3′UTRA/G3752.1833.3Codominant21.56 (0.40–6.13)0.53
A/A811.3625.0Dominant0.62 (0.22–1.75)0.37
Recessive2.50 (0.73–8.61)0.15
Log-additive1.06 (0.52–2.17)0.86

[i] The p-values were evaluated from logistic regression analysis adjusting age and gender. Subjects with an undetected genotype were excluded. SNP, singe nucleotide polymorphism; NIHSS, National Institutes of Health Stroke Survey; MBI, Modified Barthel Index; OR, odds ratio; CI, confidence interval.

Sample power

We estimated the sample power using a genetic power calculator to obtain the required sample size. The sample powers (α=0.05, genotype relative risk 2-fold, number of case for 70% power) of each SNP in the IS group were 0.757 for rs2162679 (n=104), 0.800 for rs2195239 (n=93), 0.801 for rs978458 (n=93), 0.801 for rs1520220 (n=93) and 0.801 for rs6214 (n=93). Therefore, the results of the five examined SNPs in the IGF1 gene had statistical confidence.

Discussion

IGF1 is an endogenous survival factor for neurons, glial cells and endothelial cells. IGF1 plays an important role in tissue repair and cell proliferation. IGF1 induces the synthesis of elastin and prevents apoptosis of vascular smooth muscle cells. Therefore, low levels of IGF1 may be a risk factor of stroke. As shown in previous studies, the expression of IGF1 increased after hypoxic injury in regions with neuronal loss (18) and IGF1 reduced infarct volume and improved neurological function after ischemia in an animal study (19).

There are several reports that IGF1 polymorphisms are associated with certain diseases, such as adenocarcinoma (EAC) and colorectal cancer (15,20). McElholm et al observed that IGF1 SNP rs6214 was associated with Barrett’s esophagus (BE) in EAC (15). Using GG genotype as reference, OR for BE in AA (wild-type) was 0.43 (95% CI 0.24–0.75). Feik et al also suggested that rs6214 could have an impact on developing colorectal cancer and colorectal polyps with villous elements (20). Based on previous studies, we believed that the SNPs of IGF1 were associated with the development of IS and clinical features according to the NIHSS and MBI scores in Korean stroke patients. In the present study, we found a significant association between IGF1 SNPs and IS. The G allele frequency of rs6214 in the IGF1 gene was higher in the IS group (60.5%) than in the control group (50.2%). The A allele of rs2162679 was also higher in the IS group (74.4%) than in the control group (74.4%). Thus, our results suggest that IGF1 may be a risk factor of IS development. However, all five SNPs (rs2162679, rs2195239, rs978458, rs1520220 and rs6214) of IGF1 did not contribute to the NIHSS and MBI scores of IS. To our knowledge, this is the first study on whether IGF1 SNPs are associated with the development of IS in a Korean population. Additional studies with a larger number of cases or different populations are required in order to confirm our results.

In conclusion, we suggest that an intron SNP (rs2162679) and 3′UTR SNP (rs6214) of the IGF1 gene may be associated with the development of IS.

Acknowledgements

This work was supported by the Biogreen 21 Program (Code PJ007187), Rural Development Administration

References

1. 

RA GrysiewiczK ThomasDK PandeyEpidemiology of ischemic and hemorrhagic stroke: incidence, prevalence, mortality, and risk factorsNeurol Clin26871895200810.1016/j.ncl.2008.07.00319026895

2. 

CJ Van AschMJ LuitseGJ RinkelIncidence, case fatality, and functional outcome of intracerebral haemorrhage over time, according to age, sex, and ethnic origin: a systematic review and meta-analysisLancet Neurol9167176201020056489

3. 

HM TaoGZ ChenXD LuGP ChenB ShaoTGF-beta1 869T/C polymorphism and ischemic stroke: sex difference in ChineseCan J Neurol Sci37803807201021059542

4. 

Y TongY GengJ XuThe role of functional polymorphisms of the TNF-alpha gene promoter in the risk of ischemic stroke in Chinese Han and Uyghur populations: two case-control studiesClin Chim Acta41112911295201010.1016/j.cca.2010.05.00720493182

5. 

YH LimYS JeongSK KimAssociation between TGFBR2 gene polymorphism (rs2228048, Asn389Asn) and intracerebral hemorrhage in Korean PopulationImmunol Invest40569580201110.3109/08820139.2011.55949821609163

6. 

S KalmijnJA JanssenHA PolsSW LambertsMM BretelerA prospective study on circulating insulin-like growth factor I (IGF-I), IGF-binding proteins, and cognitive function in the elderlyJ Clin Endocrinol Metab8545514555200010.1210/jcem.85.12.703311134107

7. 

M TagamiK YamagataY NaraInsulin-like growth factors prevent apoptosis in cortical neurons isolated from stroke-prone spontaneously hypertensive ratsLab Invest7660361219979166279

8. 

C GalliO MeucciA ScorzielloApoptosis in cerebellar granule cells is blocked by high KCl, forskolin, and IGF-1 through distinct mechanisms of action: the involvement of intracellular calcium and RNA synthesisJ Neurosci151172117919957532699

9. 

R KooijmanS SarreY MichotteJ De KeyserInsulin-like growth factor I: a potential neuroprotective compound for the treatment of acute ischemic stroke?Stroke40e83e88200910.1161/STROKEAHA.108.52835619197073

10. 

J GuanAJ GunnES SirimanneThe window of opportunity for neuronal rescue with insulin-like growth factor-1 after hypoxia-ischemia in rats is critically modulated by cerebral temperature during recoveryJ Cereb Blood Flow Metab20513519200010.1097/00004647-200003000-0001010724116

11. 

A De SmedtR BrounsM UyttenboogaartInsulin-like growth factor I serum levels influence ischemic stroke outcomeStroke4221802185201121700939

12. 

M BondanelliMR AmbrosioA OnofriPredictive value of circulating insulin-like growth factor I levels in ischemic stroke outcomeJ Clin Endocrinol Metab9139283934200610.1210/jc.2006-104016882751

13. 

M HenningsonM HietalaT TorngrenH OlssonH JernstromIGF1 htSNPs in relation to IGF-1 levels in young women from high-risk breast cancer families: implications for early-onset breast cancerFam Cancer10173185201010.1007/s10689-010-9404-z21113804

14. 

WH HahnJS SuhBS ChoPolymorphisms of insulin-like growth factor-1 (IGF-1) and IGF-1 receptor (IGF-1R) contribute to pathologic progression in childhood IgA nephropathyGrowth Factors29813201010.3109/08977194.2010.53212621047277

15. 

AR McElholmAJ McKnightCC PattersonA population-based study of IGF axis polymorphisms and the esophageal inflammation, metaplasia, adenocarcinoma sequenceGastroenterology139204212201010.1053/j.gastro.2010.04.01420403354

16. 

SK KimHJ ParkJS LeeAssociation of niemann-pick disease, type c2 (NPC2) polymorphisms with obesity in Korean populationMol Cell Toxicol63954002010

17. 

TW LimSK KimJY BanPolymorphisms of transmembrane channel-like 1 gene are associated with Kawasaki disease in Korean populationMol Cell Toxicol52912972009

18. 

P GluckmanN KlemptJ GuanA role for IGF-1 in the rescue of CNS neurons following hypoxic-ischemic injuryBiochem Biophys Res Commun182593599199210.1016/0006-291X(92)91774-K1370886

19. 

XF LiuJR FawcettRG ThorneWH Frey IINon-invasive intranasal insulin-like growth factor-I reduces infarct volume and improves neurologic function in rats following middle cerebral artery occlusionNeurosci Lett30891942001

20. 

E FeikA BaierlB HiegerAssociation of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer riskCancer Causes Control219197201010.1007/s10552-009-9438-419784788

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kim H, Kim S, Park H, Chung J, Chun J, Yun D and Kim Y: Polymorphisms of IGFI contribute to the development of ischemic stroke. Exp Ther Med 3: 93-98, 2012.
APA
Kim, H., Kim, S., Park, H., Chung, J., Chun, J., Yun, D., & Kim, Y. (2012). Polymorphisms of IGFI contribute to the development of ischemic stroke. Experimental and Therapeutic Medicine, 3, 93-98. https://doi.org/10.3892/etm.2011.372
MLA
Kim, H., Kim, S., Park, H., Chung, J., Chun, J., Yun, D., Kim, Y."Polymorphisms of IGFI contribute to the development of ischemic stroke". Experimental and Therapeutic Medicine 3.1 (2012): 93-98.
Chicago
Kim, H., Kim, S., Park, H., Chung, J., Chun, J., Yun, D., Kim, Y."Polymorphisms of IGFI contribute to the development of ischemic stroke". Experimental and Therapeutic Medicine 3, no. 1 (2012): 93-98. https://doi.org/10.3892/etm.2011.372
Copy and paste a formatted citation
x
Spandidos Publications style
Kim H, Kim S, Park H, Chung J, Chun J, Yun D and Kim Y: Polymorphisms of IGFI contribute to the development of ischemic stroke. Exp Ther Med 3: 93-98, 2012.
APA
Kim, H., Kim, S., Park, H., Chung, J., Chun, J., Yun, D., & Kim, Y. (2012). Polymorphisms of IGFI contribute to the development of ischemic stroke. Experimental and Therapeutic Medicine, 3, 93-98. https://doi.org/10.3892/etm.2011.372
MLA
Kim, H., Kim, S., Park, H., Chung, J., Chun, J., Yun, D., Kim, Y."Polymorphisms of IGFI contribute to the development of ischemic stroke". Experimental and Therapeutic Medicine 3.1 (2012): 93-98.
Chicago
Kim, H., Kim, S., Park, H., Chung, J., Chun, J., Yun, D., Kim, Y."Polymorphisms of IGFI contribute to the development of ischemic stroke". Experimental and Therapeutic Medicine 3, no. 1 (2012): 93-98. https://doi.org/10.3892/etm.2011.372
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team