Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
December-2014 Volume 8 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2014 Volume 8 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Toll‑like receptor 4 agonist, lipopolysaccharide, increases the expression levels of cytokines and chemokines in human peripheral blood mononuclear cells

  • Authors:
    • Dan Pu
    • Wei Wang
  • View Affiliations / Copyright

    Affiliations: Clinical Skills Training Center, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, P.R. China, Department of Pathology, West China Second University Hospital, Sichuan University, Chengdu, Sichuan 610041, P.R. China
  • Pages: 1914-1918
    |
    Published online on: October 15, 2014
       https://doi.org/10.3892/etm.2014.2025
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Toll‑like receptors (TLRs) are members of the pattern recognition receptor family and are essential in the innate immune response. In total, 11 TLRs exist in humans, which are expressed in a variety of cells, including peripheral blood cells. TLR4 plays a significant role in the defense against gram‑negative pathogens by recognizing the lipopolysaccharide (LPS) molecules in these bacteria. The aim of the present study was to detect the expression level variation of a number of major immune molecules in peripheral blood mononuclear cells (PBMCs) stimulated by LPS, in order to identify candidate genes involved in the biological functions mediated by TLR4. Reverse transcription quantitative polymerase chain reaction (RT‑qPCR) analysis and an antibody chip were performed in the current study. The RT‑qPCR results revealed a marked enhancement in the expression levels of various molecules, including cytokines, chemokines, growth factors and protein kinases. In addition, the antibody chip identified the increased secretion of crucial proinflammatory molecules in the supernatants collected from LPS‑treated PBMCs. In conclusion, a large number of molecules were found to be involved in TLR4‑mediated functions.

Introduction

Innate immunity is a major part of the immune system, playing a significant role in the acute inflammation induced by microbial infection or tissue damage (1). Innate immune cells, including monocytes, dendritic cells and T cells, can be recognized by their germ line-encoded pattern recognition receptors (PRRs), which are responsible for sensing the structure of microbial species (2). PRRs have also been shown to recognize endogenous ligands released from damaged cells and tissues (3).

The Toll-like receptor (TLR) family is a well-characterized PRR family that is responsible for recognizing invading pathogens (4). TLR stimulation initiates a signal transduction pathway via the adaptor protein, MyD88, which induces the expression of proinflammatory cytokines, such as interleukin (IL)-6, IL-8 and tumor necrosis factor (TNF)-α (5). In total, 11 members constitute the human TLR family. Among them, TLR4 is a transmembrane protein specialized in the recognition of lipopolysaccharide (LPS), which is a component of gram-negative bacteria (6).

A previous study has demonstrated that the activation of TLR4 induces the expression of numerous proinflammatory molecules, which are essential in shaping the immune status of immune cells (7). However, the expression level variation of immune molecules within immune cells upon TLR4 stimulation remains unclear. In the current study, peripheral blood mononuclear cells (PBMCs) were isolated from healthy volunteers and stimulated by the TLR4 agonist, LPS, while the expression levels of various cytokines, chemokines, growth factors and kinases were screened. The aim of the present study was to confirm which types of immune molecules are involved in the activation of the TLR4 signaling pathway.

Materials and methods

Isolation and stimulation of PBMCs

Heparinized venous blood samples were isolated from three healthy male volunteers (aged 25–28 years) and PBMCs were separated by density separation over Ficoll-Hypaque. After washing twice with phosphate buffered-saline, the PBMCs were plated into 24-well plates with a total number of 2×106 cells/well. LPS was added to the PBMCs at a concentration of 100 ng/ml. Supernatants were collected at 4 h following stimulation for use in the antibody chip. The present study was approved by the Ethics Committee of West China Hospital, Sichuan University (Sichuan, China) and written informed consent was obtained from the patients.

RNA extraction and cDNA synthesis

This procedure was performed as previously described (8). In brief, the total RNA from the PBMCs was extracted using a RNeasy mini kit (74104; Qiagen, Hilden, Germany) and quantified using a NanoDrop 3300 Fluorospectrometer (Thermo Fisher Scientific, Wilmington, DE, USA). cDNA was synthesized using a ReverTra Ace qPCR kit (FSQ-101; Toyobo, Kagoshima, Japan) and the reverse transcription (RT) conditions were as follows: 65°C for 5 min, 37°C for 15 min and 98°C for 5 min.

Quantification polymerase chain reaction (PCR)

This procedure was performed as previously described (8). In brief, quantitative PCR (qPCR) was performed to amplify the synthesized cDNA using the RealMaster Mix Reagent (SYBR Green; FP202; Tiangen Biotech Co., Ltd., Beijing, China). An iCycler iQTM Optical Module (Beckman Coulter, Fullerton, CA, USA) was used for RT-qPCR under the following conditions: One cycle at 95°C for 30 sec, 40 cycles at 95°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec, followed by a melt curve between 55 and 95°C in 0.5°C-increments and 10-sec intervals. All the tests were performed in triplicate and the primers used are shown in Table I.

Table I

Oligonucleotides used in quantitative polymerase chain reaction analysis.

Table I

Oligonucleotides used in quantitative polymerase chain reaction analysis.

GeneForward primerReverse primerGenBank number
CCL5 GACACCACACCCTGCTGCT TACTCCTTGATGTGGGCACGNM_002985
CCL7 AGCAGAGGCTGGAGAGCTACA GGGTCAGCACAGATCTCCTTGTNM_006273
CCL8 GTTTCTGCAGCGCTTCTGTG TGGCTGAGCAAGTCCCTGAY10802
CCL15 CCTCTCCTGCCTCATGCTTATT CTCTGTCTCTGCATCATTTGTGAAU58914
CCL17 CCATCGTTTTTGTAACTGTGCAG TGCATTCTTCACTCTCTTGTTGTTGNM_002987
CCL22 TGCGCGTGGTGAAACACT GGTTAGCAACACCACGCCANM_002990
CCL24 AGCCTTCTGTTCCTTGGTGTCT GGGAGAGGGTATGACCACAGAGNM_002991
CCL26 CCAAGACCTGCTGCTTCCAA GAATTCATAGCTTCGCACCCANM_006072
CCL28 CTCGCCATCGTGGCCTT GCAATGGGAAGTATGGCTTCTGAF220210
c-Myc CAAGACTCCAGCGCCTTCTC GTTGAGTAACGAGCTGACCCCAM393287
CTNNB CATCGTGAGGGCTTACTGGC GAGCAAGGCAACCATTTTCTGXM_006712984
CXCL2 AGGTGAAGTCCCCCGGAC GCCCATTCTTGAGTGTGGCTNM_002089
CXCL6 GCTGAGAGTAAACCCCAAAACGGGAGCACTGCGGGCCNM_002993
GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTCJ04038
IFN-β CAGCAATTTTCAGTGTCAGAAGCT TCATCCTGTCCTTGAGGCAGTM28622
IFN-γ CCAACGCAAAGCAATACATGA CGCTTCCCTGTTTTAGCTGCJ00219
IL-1β ACGAATCTCCGACCACCACT CCATGGCCACAACAACTGACM15330
IL-2 CAAGAATCCCAAACTCACCAGG GACACTGAAGATGTTTCAGTTCTGTJ00264
IL-6 GACCCAACCACAAATGCCA GTCATGTCCTGCAGCCACTGM14584
IL-7 ACCAGTAGAAGACAATTGCATC CCAGGTTTTCATCATCTTCAGCTNM_001199888
IL-8 CTGGCCGTGGCTCTCTTG CCTTGGCAAAACTGCACCTTNM_000584
IL-12 CGGTCATCTGCCGCAAA CAAGATGAGCTATAGTAGCGGTCCTM65272
IL-15 GACCCCACCAAAGCTGGAC TCACAGTGCTGCTGTCTGCTGM90391
IL-23 GAAGGCTCCGCTCTGCAAT TCTGGGTCTTCTCGATGGCAL06801
IP-10 TGAAATTATTCCTGCAAGCCAA CAGACATCTCTTCTCACCCTTCTTTNM_001565
JNK GCTAATTCTGTACCAATGTC GAAGAGTGCACGTCAGGAACNM_139049
MAP3K CCTGCTCGGTGCACGATGCTG CTCTGTCTCTTCACGTGGCGGNM_003954
MAP3K1 CTTTTAAGTCAGAAGTTGCTG CTTCTCCATTTTCAACCTGCAF042838
MIP-3α TCCTGGCTGCTTTGATGTCA TCAAAGTTGCTTGCTGCTTCTGNM_004591
MIP-3β GGCACCAATGATGCTGAAGA GAAGTTCCTCACGATGTACCCAGNM_006274
NF-κB AGAGTGCTGGAGTTCAGGATA AAGGTGGATGATTGCTAAGTGTAJ271718
PTEN ACCATAACCCACCACAGC CAGTTCGTCCCTTTCCAGNM_058074
PI3K CCTGGGGGTTGGTGGCTGTTC GTCTGGCTGGAATGATGCTATCNM_006219
STAT3 CCTACAAAGGGGACCCCATTGTAC CAGGGAATTTGACCAGCAACCNM_213662
TGF-α TATCGACATGGAGCTGGTGAAG CAGCTTGGACAGGATCTGGCX02812
TNF-β GGTGCTTGTTCCTCAGCCTC CAGGCAGAAGAGCGTGGTGM10988
VEGF GACTTGAGTTGGGAGGGGAA GAGGCTCAGCGCCAGGGCTGGGAF024710

[i] CCL, chemokine (C-C motif) ligand; CTNNB, cadherin-associated protein β; CXCL, chemokine (C-X-C motif) ligand; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IL, interleukin; IP, interferon γ-induced protein; JNK, c-Jun N-terminal kinase; MAP3K, mitogen-activated protein kinase kinase kinase; MIP, macrophage inflammatory protein; NF, nuclear factor; PTEN, phosphatase and tensin homolog; PI3K, phosphatidylinositol-4,5-bisphosphate 3-kinase; STAT, signal transducer and activator of transcription; TGF, transforming growth factor; TNF, tumor necrosis factor; VEGF, vascular endothelial growth factor.

Antibody chip

The supernatants collected from the TLR4-stimulated and unstimulated PBMCs were arrayed for molecule secretion using the RayBio® Human Antibody Array C-Series 1000 (RayBiotech, Inc., Norcross, GA, USA), according to the manufacturer’s instructions. Blots were analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Statistical analysis

Data analysis was performed using the Bio-Rad iQ5 software (Bio-Rad Laboratories, Hercules, CA, USA), with glyceraldehyde 3-phosphate dehydrogenase as the internal control and normal PBMCs as the negative control. The results are expressed as the mean ± standard error of the mean and were analyzed using SPSS 16.0 software (SPSS, Inc., Chicago, IL, USA). P<0.05 and P<0.001 were considered to indicate a statistically significant difference when compared with the control group. The figures were obtained using GraphPad Prism 5 software (GraphPad Software, Inc., La Jolla, CA, USA).

Results

TLR4 agonist increases the expression levels of cytokines and chemokines

RT-qPCR was performed to screen the expression levels of a number of cytokines and chemokines, in order to identify candidate genes responsible for the LPS-mediated changes in PBMCs. The expression level variation of a number of these genes may significantly affect the biological function of the PBMCs, induced by microenvironment or pathogen stimulation.

With regard to cytokine detection, the TLR4 agonist, LPS, was found to significantly increase the expression levels of several major cytokines (P<0.001), including IL-1β, IL-8, IL-15, interferon (IFN)-β, IFN-γ, macrophage inflammatory protein (MIP)-3α and MIP-β. In addition, LPS slightly increased the expression level of IL-6 (P<0.05). IL-23 was the only downregulated cytokine detected (P<0.001; Fig. 1A). During the chemokine assay, only the chemokine (C-C motif) ligand (CCL) 26, chemokine (C-X-C motif) ligand (CXCL) 2 and CXCL6 were found to be evidently enhanced upon LPS stimulation (P<0.001), although CCL22, CCL24 and CCL28 were also found to be significantly different compared with the controls (P<0.05; Fig. 1B).

Figure 1

Gene expression level variation in (A) cytokines and (B) chemokines, as detected by quantitative reverse transcription polymerase chain reaction. *P<0.05 and **P<0.001, vs. control group. IL, interleukin; IFN, interferon; MIP, macrophage inflammatory protein; CCL, chemokine (C-C motif) ligand; CXCL, chemokine (C-X-C motif) ligand; NL-PBMC, normal peripheral blood mononuclear cell.

LPS stimulation enhances the expression levels of growth factors

Growth factors were screened to obtain their expression levels following LPS stimulation. The results indicated an evident upregulation of nuclear factor (NF)-κB, phosphatase and tensin homolog (PTEN), transforming growth factor (TGF)-β and TNF-α in the PBMCs activated by the TLR ligand (P<0.001). The expression of c-Myc remained unchanged, while the expression of vascular endothelial growth factor (VEGF) was inhibited (P<0.05; Fig. 2).

Figure 2

Expression level variation of the growth factors, (A) c-Myc, (B) NF-κB, (C) PTEN, (D) TGF-β, (E) TNF-α and (F) VEGF, as detected by quantitative reverse transcription polymerase chain reaction. *P<0.05 and **P<0.001, vs. control group. NF, nuclear factor; PTEN, phosphatase and tensin homolog; TGF, transforming growth factor; TNF, tumor necrosis factor; VEGF, vascular endothelial growth factor; NL, normal PBMCs; LPS, lipopolysaccharide-treated PBMCs; PBMCs, peripheral blood mononuclear cells.

Activation of the TLR4 signaling pathway has no evident effect on the expression levels of kinases

TLR4 agonist stimulation performed on PBMCs may induce the activation of protein kinases. Therefore, a number of protein kinase signaling pathways were analyzed in the study. The results indicated that the expression of phosphorylated signal transducer and activator of transcription 3 (pSTAT3) was significantly enhanced in PBMCs following LPS stimulation (P<0.001). However, cadherin-associated protein β (CTNNB), mitogen-activated protein kinase kinase kinase 1 (MAP3K1) and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) expression levels remained unchanged during the detection. Notably, the expression levels of two important kinases, c-Jun N-terminal kinase (JNK) and MAP3K, were inhibited following LPS treatment (P<0.05; Fig. 3).

Figure 3

Expression level variation of the protein kinases, (A) pSTAT3, (B) CTNNB, (C) JNK, (D) MAP3K, (E) MAP3K1 and (F) P13K, as detected by quantitative reverse transcription polymerase chain reaction. *P<0.05 and **P<0.001, vs. control group. pSTAT3, phosphorylated signal transducer and activator of transcription 3; CTNNB, cadherin-associated protein β; JNK, c-Jun N-terminal kinase; MAP3K, mitogen-activated protein kinase kinase kinase; PI3K, phosphatidylinositol-4,5-bisphosphate 3-kinase; NL, normal PBMCs; LPS, lipopolysaccharide-treated PBMCs; PBMCs, peripheral blood mononuclear cells.

LPS induces the secretion of proinflammatory molecules

Supernatants collected from the LPS-treated and untreated PBMCs were analyzed to determine the secretion levels of major immune molecules using an antibody chip. A total of 20 proteins, including α-fetoprotein, albumin, E-selectin, intercellular adhesion molecule-1, IFN-α, IFN-γ, IL-10, IL-12, IL-18, IL-1β, IL-4, IL-5, IL-6, IL-8, monocyte chemoattractant protein (MCP)-1, MCP-3, MIP-1α, Notch-1, TGF-β and VEGF, were selected for analysis. The results revealed that only six of the aforementioned proteins were affected by TLR4 activation (Fig 4). Among these, the secretion levels of IL-1β, IL-6 and MIP-1α were significantly enhanced (P<0.001), while IL-8 secretion was moderately increased (P<0.05). In addition, the secretion levels of MCP-1 and MCP-3 were inhibited.

Figure 4

Secretion levels of (A) IL-1β, (B) IL-6, (C) IL-8, (D) MCP-1, (E) MCP-3 and (F) MIP-1α in the supernatant. *P<0.05 and **P<0.001, vs. control group. IL, interleukin; MCP, monocyte chemoattractant protein; MIP, macrophage inflammatory protein; NL, normal control PBMCs; LPS, lipopolysaccharide-treated PBMCs; PBMCs, peripheral blood mononuclear cells.

Discussion

Vertebrates have evolved systems of immune defense to eliminate invading pathogens. The innate immune system is the first line of the host defense against microorganisms and recognizes the conserved components of pathogens via pattern recognition receptors (PRRs) (9). Among the 11 human TLRs, TLR3, TLR7, TLR8 and TLR9 are expressed on the surface of endosomes, while TLR1, TLR2, TLR4, TLR5, TLR6, TLR10 and TLR11 are located on the cellular surface (10). TLR4 plays an important role in the protection against fungi by recognizing LPS components. Stimulation with a TLR4 agonist induces proinflammatory signals, as well as the production of type I IFNs (11).

In the present study, PBMCs were isolated from healthy volunteers and stimulated by the TLR4 agonist, LPS. At 4 h after the treatment, the supernatant and cellular RNA were isolated and assayed using an antibody chip and RT-qPCR, respectively. Using these methods, the immune molecules involved in the immunological signature of PBMCs can be identified and the TLR4 signaling pathway can be further understood. The molecules selected in the present study exhibit a number of important biological functions in vivo. In addition to increasing the expression levels of IL-8 and IL-6 (12), TLR4 agonist stimulation was found to influence numerous immunomodulatory factors. Among the cytokines examined, the expression levels of IL-1β, IL-6, IL-8, IL-15, IFN-β, IFN-γ, MIP-3α and MIP-3β increased markedly. During chemokine detection, the expression levels of CCL22, CCL24, CCL26, CXCL2 and CXCL6 were upregulated upon LPS stimulation. In addition, the expression levels of several growth factors, including NF-κB, PTEN, TNF-α and TGF-β, were enhanced. Detecting the expression levels of protein kinases, which play important roles in TLR-mediated biological functions, was important in this study. The expression level of pSTAT3 was found to increase in LPS-treated PBMCs, while the expression levels of CTNNB, MAP3K1 and PI3K remained unchanged in the treated and untreated groups. However, the expression of JNK was inhibited following LPS treatment. These results indicated that the activation of TLR4 had varying effects on the different kinase pathways. The cytokine levels were detected in the supernatants of LPS-treated PBMCs, and the secretion levels of IL-1β, IL-6, IL-8 and MIP-1α were found to be enhanced, indicating the important role of TLR4 in shaping the immune status of PBMCs.

Compared with previous studies, the present study analyzed a greater number of immune molecules that may be important in TLR-related functions. However, a limitation of the study was that the variation in the expression levels of immune molecules was only detected at a gene level. Future studies should analyze the association between these candidate immune molecules and TLR-mediated functions and should investigate the MEprotein expression levels.

Acknowledgements

This study was supported by a grant from the National Natural Science Foundation of China (no. 81101261).

References

1 

Takeuchi O and Akira S: Pattern recognition receptors and inflammation. Cell. 140:805–820. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Hou B, Reizis B and DeFranco AL: Toll-like receptors activate innate and adaptive immunity by using dendritic cell-intrinsic and -extrinsic mechanisms. Immunity. 29:272–282. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Miyake K: Innate immune sensing of pathogens and danger signals by cell surface Toll-like receptors. Semin Immunol. 19:3–10. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Blasius AL and Beutler B: Intracellular Toll-like receptors. Immunity. 32:305–315. 2010. View Article : Google Scholar

5 

Yamamato M, Sato S, Mori K, Hoshino K, Takeuchi O, Takeda K and Akira S: Cutting edge: a novel Toll/IL-1 receptor domain-containing adapter that preferentially activates the IFN-beta promoter in the Toll-like receptor signaling. J Immunol. 169:6668–6672. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Ghosh TK, Mickelson DJ, Solberg JC, Lipson KE, Inglefield JR and Alkan SS: TLR-TLR cross talk in human PBMC resulting in synergistic and antagonistic regulation of type-1 and 2 interferons, IL-12 and TNF-alpha. Int Immunopharmacol. 7:1111–1121. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Kaisho T, Takeuchi O, Kawai T, Hoshino K and Akira S: Endotoxin-induced maturation of MyD88-deficient dendritic cells. J Immunol. 166:5688–5694. 2001. View Article : Google Scholar : PubMed/NCBI

8 

Activation of the TLR1/2 pathway induces the shaping of the immune response status of peripheral blood leukocytes. Exp Ther Med. 7:1708–1712. 2014.PubMed/NCBI

9 

Beutler B: Inferences, questions and possibilities in Toll-like receptor signalling. Nature. 430:257–263. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Kopp E and Medzhitov R: Recognition of microbial infection by Toll-like receptors. Curr Opin Immunol. 15:396–401. 2003. View Article : Google Scholar : PubMed/NCBI

11 

Shan JY, Ji WZ, Li HT, Tuxun T, Lin RY and Wen H: TLR2 and TLR4 expression in peripheral blood mononuclear cells of patients with chronic cystic echinococcosis and its relationship with IL-10. Parasite Immunol. 33:692–696. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Kaisho T and Akira S: Toll-like receptor function and signaling. J Allergy Clin Immunol. 117:979–987. 2006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Pu D and Wang W: Toll‑like receptor 4 agonist, lipopolysaccharide, increases the expression levels of cytokines and chemokines in human peripheral blood mononuclear cells. Exp Ther Med 8: 1914-1918, 2014.
APA
Pu, D., & Wang, W. (2014). Toll‑like receptor 4 agonist, lipopolysaccharide, increases the expression levels of cytokines and chemokines in human peripheral blood mononuclear cells. Experimental and Therapeutic Medicine, 8, 1914-1918. https://doi.org/10.3892/etm.2014.2025
MLA
Pu, D., Wang, W."Toll‑like receptor 4 agonist, lipopolysaccharide, increases the expression levels of cytokines and chemokines in human peripheral blood mononuclear cells". Experimental and Therapeutic Medicine 8.6 (2014): 1914-1918.
Chicago
Pu, D., Wang, W."Toll‑like receptor 4 agonist, lipopolysaccharide, increases the expression levels of cytokines and chemokines in human peripheral blood mononuclear cells". Experimental and Therapeutic Medicine 8, no. 6 (2014): 1914-1918. https://doi.org/10.3892/etm.2014.2025
Copy and paste a formatted citation
x
Spandidos Publications style
Pu D and Wang W: Toll‑like receptor 4 agonist, lipopolysaccharide, increases the expression levels of cytokines and chemokines in human peripheral blood mononuclear cells. Exp Ther Med 8: 1914-1918, 2014.
APA
Pu, D., & Wang, W. (2014). Toll‑like receptor 4 agonist, lipopolysaccharide, increases the expression levels of cytokines and chemokines in human peripheral blood mononuclear cells. Experimental and Therapeutic Medicine, 8, 1914-1918. https://doi.org/10.3892/etm.2014.2025
MLA
Pu, D., Wang, W."Toll‑like receptor 4 agonist, lipopolysaccharide, increases the expression levels of cytokines and chemokines in human peripheral blood mononuclear cells". Experimental and Therapeutic Medicine 8.6 (2014): 1914-1918.
Chicago
Pu, D., Wang, W."Toll‑like receptor 4 agonist, lipopolysaccharide, increases the expression levels of cytokines and chemokines in human peripheral blood mononuclear cells". Experimental and Therapeutic Medicine 8, no. 6 (2014): 1914-1918. https://doi.org/10.3892/etm.2014.2025
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team