This article is mentioned in:

Introduction

Brugada syndrome (BrS) is a rare, inheritable arrhythmia syndrome, which is characterized by a coved-type ST-segment elevation in the right precordial leads (V1 to V3) on surface electrocardiography (ECG) and a high incidence of sudden mortality in patients without evident structural heart disease, electrolyte disturbances or ischemia (1). The condition is considered to be responsible for 4–12% of all sudden cardiac deaths (SCDs) and 20% of SCDs in patients with the absence of structural heart disease secondary to re-entrant polymorphic ventricular tachycardia and ventricular fibrillation (2–4). The syndrome manifests primarily during adulthood, with a mean age of SCD of ∼40 years (4). The diagnosis of BrS is based on the presence of coved-type ST-segment elevations in the right precordial leads (V1 to V3) on surface electrocardiography (ECG), which are characteristic of BrS type 1 ECGs, whereas saddle-back ST-segment elevations correspond to BrS type 2 and 3 ECGs (5). To confirm the diagnosis, the diagnostic ECGs should be reinforced with either personal symptoms, family history of premature SCD or at least one additional relative with a positive type 1 BrS ECG (6).

Since it was first reported by Chen et al in 1998 (7) that loss-of-function mutations of SCN5A account for the most well-known genetic substrate for BrS, mutations in 11 other genes that cause BrS have been reported. These genes include the cardiac L-type calcium channel subunits encoded by CACNA1C (8), CACNB2B (8) and CACNA2D1 (9), sodium channel subunits encoded by GPD1L (9), SCN1B (10), SCN1Bb (11), SCN3B (12) and MOG1 (13), transient outward potassium channel subunits encoded by KCNE3 (14) and KCND3 (15), the ATP-sensitive potassium channel encoded by KCNJ8 (16) and the HCN4 channel encoded by HCN4 (17). However, SCN5A remains the most frequently reported gene causing BrS to date, accounting for 15–30% of the clinically diagnosed cases (18–20).

In the present study, a novel heterozygous mutation, A1428S, was identified in the SCN5A gene in a patient with BrS. The aim of the study was to characterize the biophysical properties of this novel mutation, in order to expand the spectrum of mutations causing BrS and provide evidence for the hypothesis that the loss of function of the mutant Na+ channel (Nav1.5) was involved in the pathogenesis of BrS.

Materials and methods

Patients

The study participants were identified and enrolled at Huazhong University of Science and Technology Union Hospital (Wuhan, China). Informed consent was obtained from the participants in accordance with the study protocols approved by the Ethics Committee of Huazhong University of Science and Technology. Twenty-eight family members, including 14 males and 14 females were involved in this study (Fig. 1). Detailed records on their medical history, physical examinations and 12-lead ECGs were obtained. The diagnosis of BrS was made on the basis of symptoms, physical signs and a typical ECG. Among all the family members, four members exhibited the clinical criteria of a BrS phenotype.

Figure 1. Pedigree chart of a family with Brugada syndrome. The affected family members are indicated by the filled symbols. The proband is indicated by an arrow (II3).

Direct DNA sequencing analyses

As described previously (21,22), venous blood (5 ml) was collected from the participants, and total human genomic DNA was purified with the DNA Isolation kit for Mammalian Blood (Roche Diagnostics, Indianapolis, IN, USA). Considering that SCN5A thus far remains the most frequently reported gene causing BrS, mutation screening of the SCN5A gene was carried out directly without performing linkage analysis. The entire coding exons of the SCN5A gene of the proband were amplified by polymerase chain reaction (PCR). Primers were designed with intronic flanking sequences according to the gene sequence described by Wang et al (23). Each amplicon was designed for an optimal size, with the exon centered within the amplicon. As a result, a total of 28 amplicons were used to sequence the coding region of the gene. Briefly, the PCR amplification was performed in the PTC-200 thermal cycler (MJ Research Inc., Waterdown, MA, USA) in a 25-µl reaction mixture containing 1.5 mM MgCl2, 0.2 mM of each deoxyribonucleotide triphosphate (Qiagen, Hilden, Germany), 0.5 µM primers, 1 unit Taq DNA polymerase (Qiagen), and 50 ng genomic DNA. PCR was performed as follows: Initial denaturation for 5 min at 94°C, followed by nine cycles of 45 sec at 94°C, 45 sec at 61.5°C and 45 sec at 72°C, followed by 29 cycles of 45 sec at 94°C, 45 sec at 55°C and 45 sec at 72°C with a separate annealing temperature at 55°C. Direct bidirectional resequencing of all PCR-amplified products was performed with the BigDye Terminator Cycle Sequencing v3.1 kit (Applied Biosystems, Foster City, CA, USA) and electrophoresed on an ABI PRISM 3730 Genetic Analyzer (Applied Biosystems). Sequencing results from the subjects and SCN5A gene consensus sequences from GenBank (GenBank accession no. NM_198056; http://www.ncbi.nlm.nih.gov/genbank/) were compared using Basic Local Alignment Search Tool analysis. Mutation description was followed by the nomenclature recommended by the Human Genomic Variation Society (Carlton South, Australia). Resequencing of the mutated exon 24 of the SCN5A gene was performed on the other family members and 100 unrelated controls. The primers used were as follows: Forward, TGGGGTGGCTTGCTTTTCATAA; reverse, TGGGGTGCTGGACAAAGAAGAA. The evolutionary conservation of amino acids in Nav1.5 protein was analyzed among the following species: Humans (Homo sapiens), orangutans (Pongo abelii), chickens (Gallus gallus), mice (Mus musculus), rats (Rattus norvegicus) and dogs (Canis lupus familiaris). ClustalW was used to align these protein sequences (http://www.ebi.ac.uk/Tools/msa/clustalw2/).

PCR-restriction fragment length polymorphism (RFLP) analysis

Mutation c.4282G>T (p.A1428S) disrupts an Nsi1 restriction site, which allowed us to perform PCR-RFLP analysis to confirm the mutation and test whether the mutation co-segregated with the disease in the family as described previously (24). Briefly, PCR amplification was performed on exon 24 containing the A1428S mutation of the SCN5A gene, following the aforementioned method. The 488-bp PCR product was digested with 10 units Nsi1 (New England Biolabs, Ipswich, MA, USA) at 37°C overnight. The resulting digestion products were separated on 1.5% polyacrylamide gels and the DNA samples were separated by electrophoresis overnight at 150 V. The DNA bands were visualized by silver staining.

Cell cultures

Human embryonic kidney 293 (HEK293T) cells were purchased from the American Type Culture Collection (Manassas, VA, USA). These cells were cultured in Dulbecco's modified Eagle's medium (Sigma-Aldrich, St. Louis, MO, USA) containing 10% fetal bovine serum (Life Technologies, Paisley, UK), 2 mM L-glutamine, 100 U/ml penicillin G and 10 mg/ml streptomycin (Gibco-BRL, Burlington, ON, Canada) at 37°C in a humidified atmosphere containing 5% CO2. Cells were plated on poly-L-lysine-coated glass cover slips (12 mm) (Carl Zeiss, Inc., Oberkochen, Germany) and transiently transfected with wild-type (WT) SCN5A/pEGFP-N2 or mutation type (MT) SCN5A/pEGFP-N2 (2–5 µg) using Lipofectamine® 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA) as previously described (20,25). Green fluorescent protein (GFP) was used as a marker to localize the protein within the cell. Cells expressing GFP, identified by green fluorescence, were selected for experiments, as shown in Fig. 2.

Figure 2. Representative bright-field and fluorescent images of HEK cells transfected with the SCN5A and GFP genes on a vector. HEK cells transfected with a vector containing the coding sequences of either wild-type (WT) or mutant (A1428S) Na+ channels and green fluorescent protein (GFP) showed fluorescence, while the control HEK cells showed no fluorescence. Scale bar=50 µm. (A) Merge of bright-field and fluorescent images with GFP, (B) fluorescent images with GFP and (C) bright-field images of HEK293T cells transfected with a vector containing the coding of wild-type (WT) Na+ channels. (D) Merge of bright-field and fluorescent images with GFP, (E) fluorescent images with GFP and (F) bright-field images of HEK293T cells transfected with a vector containing the coding of mutant (A1428S) Na+ channels. For these images the cells were plated at a similar density 36 h prior to imaging. HEK, human embryonic kidney; GFP, green fluorescent protein.

Electrophysiological recordings

Macroscopic sodium currents from the transfected cells were recorded at room temperature (21–24°C) using the whole-cell patch clamp technique and an Axopatch 200B amplifier (Axon Instruments, Foster City, CA, USA). The extracellular solution contained: 70 mM NaCl, 80 mM CsCl, 5.4 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 10 mM D-glucose and 10 mM HEPES (adjusted with CsOH to pH 7.3). The patch pipettes were fabricated from borosilicate glass capillaries (outer diameter, 1.5 mm; inner diameter, 1 mm; VitalSense Scientific Instruments, Wuhan, China) using a Sutter Model P-97 horizontal puller (Sutter Instrument Company, Novato, CA, USA). This typically had a resistance of 1–2 M when filled with the internal solution, which contained (in mM): 20 mM NaCl, 130 mM CsCl, 10 mM EGTA and 10 mM HEPES (adjusted to pH 7.2 with CsOH). Currents were amplified and filtered using an Axopatch 200B amplifier, and digitized with Digidata 1322A (Molecular Devices, Union City, CA, USA) at 5 kHz following analog filtering with the four-pole low-pass Bessel (2 kHz) of the amplifier. pCLAMP 9.0 and Origin 8.5 (OriginLab Corporation, Northampton, MA, USA) software were used for data acquisition and analysis, respectively. Series resistance compensation was used to improve the voltage-clamp control (70–80%). Peak current were normalized by the membrane capacitance and showed as the current density (pA/pF). Membrane conductance (G) was defined as I/(V-Erev), where I was the peak amplitude, V was the test voltage and Erev was the reversal potential of sodium currents. The steady-state inactivation curve was studied using a double-pulse protocol, in which the test voltage was stepped to −10 mV, 200 msec long, and preceded by 200 msec preconditioning pulses from −140 to −30 mV in 10-mV steps. The plots of voltage-dependent steady-state activation and inactivation were fitted by the Boltzmann equation: 1/[1+exp(V-V1/2)/k], where V1/2 was the voltage at which the sodium current was half-maximally activated, and k was the slope factor. Recovery from inactivation was examined by applying a 50-msec conditioning pulse to −20 mV from a holding potential of −120 mV, followed by a recovery interval of variable duration (2–10,000 msec) and a test pulse of −20 mV. The recovery time-course was fitted with the biexponential function: I/Imax = Ao+Af[1-exp(-t/τf)]+As[1-exp(-t/τs)], where τ and A were the time constants and the corresponding relative amplitudes, respectively.

Statistical analysis

Results are presented as the mean ± standard error of the mean with sample sizes (n) indicating the number of cells from which the data were obtained. Statistical significance was assessed using the Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

Pedigree and clinical features of the family

The proband, a 58-year-old patient (II3) was admitted to the emergency care unit due to syncope during walking with spontaneous recovery. A 12-lead ECG was performed without a drug challenge test and showed ST-segment elevation in the right precordial leads (Fig. 3). In V2 and V3, the QRS complex showed a typical BrS 1 pattern with a coved-shape ST-segment. The history of the patient revealed that he had one episode of syncope in the past, and his familial history revealed that two children (III3 and III7) and one brother (II2) had experienced several episodes of dizziness and syncope. Subsequent to a certain dose of flecainide challenge, all of the affected individuals showed right bundle branch block and coved-type ST-segment elevation. However, none of the clinical features of the proband were identified in the other members of his family.

Figure 3. Diagnostic BrS ECG. Twelve-lead electrocardiogram showing a representative type 1 BrS ECG with coved ST-segment elevation in the right precordial leads, particularly in V2 and V3. The arrows indicate the coved ST-segment elevation. BrS, Brugada syndrome; ECG, electrocardiography.

Genetic analysis

To identify the molecular basis of BrS in the proband, exons 1–28 of the dystrophin gene were amplified by PCR. By direct bidirectional sequencing of the PCR products in the proband, a heterozygous missense single nucleotide at position 4,282 (c.4282G>T) in exon 24 of the SCN5A gene was revealed (Fig. 4A); this was confirmed by repeating the experiment. The missense nucleotide resulted in an amino acid change from alanine to serine at position 1,428 (abbreviated as p.A1428S, Fig. 4B) in the DIII-S5/S6 of the Nav1.5 channel (Fig. 4C). Ala1428 is highly conserved among humans (Homo sapiens), orangutans (Pongo abelii), chickens (Gallus gallus), mice (Mus musculus), rats (Rattus norvegicus) and dogs (Canis lupus familiaris) (Fig. 4D).

Figure 4. Analysis the mutation of the SCN5A gene in the studied family and changes in the Nav1.5 channel α subunit protein sequences following mutation. (A) Sequencing chromatograms of the proband from the family showing a novel missense mutation c.4282G>T in the SCN5A gene in exon 24. (B) c.4282G>T results in a heterozygous p.A1428S mutation, which is located in the (C) DIII-S5/S6 of the Nav1.5 channel α subunit protein. (D) ClustalW alignment of the Nav1.5 channel α subunit protein shows that the alanine residue at position 1,428 is highly conserved across humans (Homo sapiens), orangutans (Pongo abelii), chickens (Gallus gallus), mice (Mus musculus), rats (Rattus norvegicus) and dogs (Canis lupus familiaris).

RFLP analysis

Mutation c.4282G>T (p.A1428S) disrupts an Nsi1 restriction site. To confirm the mutation and test whether the mutation co-segregated with the disease in the family, the novel variation detected in exon 24 of the SCN5A gene was further evaluated in the other available family members, as well as in the normal control subjects using RFLP analysis. The PCR fragment containing mutation Ala1428Ser was able to be cut by the enzyme; therefore, the RFLP results revealed the presence of the MT (329 and 159-bp bands) and WT (488-bp bands) alleles (II2, III3, III7 and proband II3, Fig. 5). However, the DNA samples from the 100 normal males and the other unaffected family members were also analyzed by RFLP, and the results revealed that the unaffected members of the family and the 100 normal controls only had the WT allele (488-bp bands) (Fig. 5). These results further suggest that this novel mutation (c.4282G>T, p.A1428S) of the SCN5A gene is not a rare polymorphism, but a causative mutation for BrS in the proband.

Figure 5. PCR-restriction fragment length polymorphism analysis of the mutation in exon 24 of the SCN5A gene. The c.4282G>T mutation resulted in the appearance of an Nsi1 restriction site. The mutation-type PCR product was cut by Nsi1, yielding two shorter DNA fragments of 329 and 159 bp. All affected individuals in the family were heterozygous for the p.A1428S mutation (three fragments: 488, 329 and 159 bp; II2, II3, II3 and II7). However, the wild-type PCR product could not be cut by Nsi1, resulting in only one DNA fragment of 488 bp. The PCR products were shown by electrophoresis in a 1.5% agarose gel stained with ethidium bromide. PCR, polymerase chain reaction.

Biophysical properties of the A1428S mutant

To understand the clinical phenotypes of this patient, the biophysical properties of the WT and MT channels were studied. The WT Nav1.5 channels and channels expressed from the mutated cDNAs of SCN5A were studied in transfected HEK293 cells. Cells expressing GFP, identified by green fluorescence (Fig. 2), were selected for whole-cell patch clamp recordings. The HEK293 cells themselves did not exhibit a substantial level of INa. By contrast, cells transfected with the WT SCN5A cDNA had a large INa (Fig. 6A). A marked reduction in current amplitudes was observed with the mutation A1428S (Fig. 6B). Fig. 6C shows the Vm dependence of the averaged current density. The A1428S mutation did not change the shape of I-V curve, but significantly reduced the peak current density without altering the reversal potential and the voltage dependence of the INa peak. At −30 mV, the mean peak sodium current density was reduced from −220.82 pA/pF (WT) to −136.44 pA/pF (A1428S) (Fig. 6D, P<0.05). The non-significant variation of the reversal potentials of WT (30.9±1.2 mV, n=10) and A1428S (29.8±2.4 mV, n=10) indicated that the mutations had no impact on channel selectivity, as was also evidenced by the I-V curves (Fig. 6C).

Figure 6. Properties of sodium current recorded from HEK293T cells transfected with SCN5A WT or p.A1428S channels. (A and B) Representative current traces of HEK293T cells transfected with (A) SCN5A WT and (B) p.A1428S channel. (C) Current-voltage (I-V) association of WT (n=14) and p.A1428S channel (n=16). (D) Mean peak sodium current density recorded at −30 mV. The difference in the current densities between the WT (n=14) and p.A1428S channels (n=16) was statistically significant. (E and F) Kinetics of sodium channel activation and inactivation: (E) Voltage-dependant steady-state activation (n=13) and (F) inactivation (n=16). (G) Recovery from inactivation was assessed for the WT and MT (n=10) utilizing a two-pulse protocol. HEK, human embryonic kidney; WT, wild-type; MT, mutation-type.

The effects of the A1428S mutation on the Vm dependence of channel activation are shown in Fig. 6E. The normalized conductance-Vm association was constructed and it was revealed that the Vm-dependent activation was the same in the WT channel (V1/2, −43.86±1.39 mV; k, 5.91±0.76 mV) and the A1428S mutant (V1/2, −41.63±1.36 mV; k, 6.10±0.69 mV). To compare the inactivation kinetics of the WT and A1428S mutant, whole-cell currents at various potentials were fitted to a biexponential function. As shown in Fig. 6F, the steady-state inactivation was not significantly different between the WT channel (V1/2, −91.50±1.14 mV; k, 7.01±0.48 mV) and the A1428S mutant (V1/2, −92.33±1.39 mV; k, 7.51±0.73 mV). Recovery from the inactivation of the WT channel and the A1428S mutant was then assessed using a double-pulse protocol, as shown in Fig. 6G. The biexponential fit to recovery curve showed no significant difference between the WT channel (τf, 5.58±1.36 sec; τs, 40.06±21.32 sec), and the A1428S mutant (τf, 6.07±1.27 sec; τs, 23.08±6.48 sec) (P>0.05).

Discussion

In this study, a novel heterozygous mutation c.4282G>T in the SCN5A gene that caused BrS was presented. It was shown that the mutation caused a significant reduction in Na+ current, suggesting its involvement in the pathogenesis of the arrhythmic phenotype seen in the studied family. Diagnosis of BrS in the proband was based on the ECG, which showed a coved-type ST-segment elevation in the right precordial leads, particularly in V2 and V3 (Fig. 3). To identify the disease-causing gene in the proband, all coding regions (exons 1–28) of the SCN5A gene were PCR-amplified and sequenced with DNA. A novel missense mutation (c.4282G>T) in exon 24 of the SCN5A gene was identified, which resulted in an amino acid change from alanine to serine at position 1,428 in the DIII-S5/S6 of the Nav1.5 channel (Fig. 4). This mutation was further confirmed by PCR-RFLP analysis, which showed that the PCR fragment containing mutation A1428S could be cut by the Nsi1 restriction enzyme, yielding two shorter DNA fragments of 329 and 159 bp. These fragments were not present in individuals with the WT allele (Fig. 5). These results suggested the SCN5A mutation led to the dysfunction of the Nav1.5 channel, which caused an episode of sudden collapse during walking.

It is well known that the SCN5A gene encodes the α subunit of the human cardiac Nav1.5 channel, which is a transmembrane protein composed of the main pore-forming α-subunit and two subsidiary β-subunits (β1 and β2) (26,27). There is considerable evidence that Nav1.5 forms a section of a macromolecular complex (28) and that its function is modulated by cytoskeletal proteins, including tubulin (29), syntrophin and dystrophin (30). Considering these interactions between Nav1.5 and the cytoskeletal proteins, it is conceivable that abnormal Nav1.5 proteins affect the function of the cytoskeleton and the structural integrity of cardiomyocytes. A report recently showed that patients with BrS with a SCN5A mutation exhibit enlarged right and left ventricles compared with individuals without an SCN5A mutation (31). Furthermore, the Nav1.5 channel plays a key role in cardiac excitability and conduction. It is responsible for the rapid upstroke of the action potential (AP) caused by the rapid entry of Na+ ions into cardiac myocytes. In the present study, electrophysiological characterization of the Nav1.5 mutation, A1428S, revealed that Na+ current density was significantly decreased compared with that in the WT, which affected the AP of cardiomyocytes. Therefore, dysfunctions of this channel can cause BrS.

The Nav1.5 channel α subunit consists of four homologous domains, and each domain contains six α-helical transmembrane repeats. In the present study, the substituted amino acid p.A1428S was located at the fifth α-helical transmembrane segment of domain III-S5/S6. Mutations located at this region have been previously reported, including N1380K (32), although few have been characterized by functional studies. The present findings indicate that neither the steady-state activation or inactivation, nor the recovery from inactivation differs between the A1428S mutation and the WT. These results revealed that the DIII-S5/S6 of the Nav1.5 channel α subunit was not involved in regulating the recovery from inactivation, or steady-state activation or inactivation. This result was consistent with the previous functional studies reporting that the carboxyl-terminal of the cardiac sodium channel may play an important role in controlling the gate property of the channel (33,34). Rivolta et al (35) reported that the mutation Y1795H, which contributes to BrS, affected steady-state and fast inactivation, as well as current density. Similar findings were also observed in the BrS-causing C1859S mutation, as reported by Petitprez et al (36). Additionally, change of steady-state activation was observed in the T1620M and S1710L mutations (37). These results demonstrated that the carboxyl-terminal of the cardiac sodium channel plays a critical role in the regulation of the gating property of the channel. No change in the gating property of the channel was observed in the A1428S mutation in the present study.

In conclusion, to the best of our knowledge, this is the first description of a novel heterozygous missense mutation, A1428S, in exon 24 of the SCN5A gene in a family with BrS. This finding expands the mutation spectrum of the SCN5A gene and may prove useful and valuable for genetic counseling and prenatal diagnosis in families with BrS. Electrophysiological characterization of the Nav1.5 mutation, A1428S, revealed that the fifth α-helical transmembrane segment of DIII-S5/S6 did not regulate the recovery from inactivation, or steady-state activation or inactivation. However, the decreased Nav1.5 activity caused by the A1428S mutation supports the hypothesis that a reduction in Nav1.5 function is involved in the pathogenesis of BrS. This structural-functional study of the Nav1.5 channel enhances the current understanding of the pathophysiological function of the channel and provides potential preventive and therapeutic approaches to heart disease.

Acknowledgements

This study was supported by grants from the National Natural Science Foundation of China (nos. 31301024 and 81400462) and the Natural Science Foundation of Hubei Province of China (no. 2012FKB02441).

Abbreviations:

References