Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
July-2015 Volume 10 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2015 Volume 10 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Expression of survivin in adenoid cystic carcinoma of the lacrimal gland and the effect of intervention with arsenic trioxide in vitro

  • Authors:
    • Yingzhe Pan
    • Yiqiao Xing
    • Hui Wang
  • View Affiliations / Copyright

    Affiliations: Department of Xiangyang Hospital, Hubei University of Medicine, Xiangyang, Hubei 441000, P.R. China, Department of Ophthalmology, Renmin Hospital of Wuhan University, Wuhan, Hubei 430060, P.R. China
  • Pages: 330-334
    |
    Published online on: April 30, 2015
       https://doi.org/10.3892/etm.2015.2466
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The aim of the present study was to investigate the role of survivin in adenoid cystic carcinoma of the lacrimal gland (LGACC) and the effect of arsenic trioxide (As2O3) intervention in vitro. In total, 13 patients with LGACC were recruited from Renmin Hospital of Wuhan University between 2007 and 2012. The patients were divided into different groups, namely tumor‑node‑metastasis (TNM)1‑2 and TNM3‑4, according to the TNM classification. A total of eight samples were included in the TNM1‑2 group, while five samples were included in the TNM3‑4 group. In addition, six patients that suffered from other diseases (no tumor), but underwent eye surgery, were selected as the controls. The mRNA and protein expression levels of survivin were analyzed. In addition, primary adenoid cystic carcinoma (ACC) cells were cultured and the expression of survivin was silenced using short interfering RNA (siRNA), after which the cell proliferation was determined. Furthermore, the primary cultured ACC cells were treated with different doses of As2O3 to observe the effect on the apoptosis rate. The mRNA and protein expression levels of survivin in the LGACC groups were higher when compared with the controls (P<0.01). In addition, the expression levels were higher in the TNM3‑4 group when compared with the TNM1‑2 group (P<0.01). After silencing survivin expression using siRNA, the rate of ACC cell proliferation was shown to decrease at days 2, 3, 4 and 5 following culture, particularly in the TNM3‑4 group at days 2 and 3 (P<0.05), day 4 (P<0.01 vs. TNM1‑2 + siRNA); and days 3 and 5 (P<0.05), and day 2 (P<0.01 vs. TNM3‑4 + siRNA). The mRNA expression levels of survivin in the TNM1‑2 and TNM3‑4 groups were significantly decreased following treatment with the various doses of As2O3 (2, 4 and 6 µΜ) for 48 h, and the apoptosis rate of the ACC cells was markedly increased (TNM1‑2 and 3‑4: As2O3 6 µM vs. As2O3 2 µM, As2O3 6 µM vs. As2O3 4 Μm, P<0.01; TNF3‑4, As2O3 4 µM VS. As2O3 2 µM, P<0.01; TNM1‑2, As2O3 4 µM vs. As2O3 2 µM, P<0.05). Therefore, survivin was demonstrated to be highly expressed in ACC cells of the lacrimal gland, and inhibition of survivin gene expression was found to suppress the proliferation of the ACC cells. Furthermore, As2O3 treatment was demonstrated to inhibit the mRNA expression of survivin in the ACC cells, while significantly increasing the apoptosis rate.

Introduction

Adenoid cystic carcinoma (ACC) is rare form of cancer that is not often observed in clinical practice, accounting for ~1% of head and neck malignant tumors. The tumors are most commonly observed in the salivary gland, nasal cavity and sinus, as well as the lacrimal gland (1). Adenoid cystic carcinoma of the lacrimal gland (LGACC) is one of the most common types of malignant epithelial tumor in the lacrimal gland, with an incidence of 29%. In spite of the low clinical incidence, ACC is difficult to be cured and relapse is common following surgery due to the high malignant degree and strong invasion capacity in local tissue. Local lymph node metastasis is rare; however, long distance metastasis is very common (2). In addition, the five-year survival rate is relatively high; however, the survival rate between 10 and 20 years is considerably reduced (3,4). ACC originating from the lacrimal gland had a higher tendency to invade the cranial cavity, as compared with tumors from the salivary gland, and the corresponding incidence rate is between 4 and 22% (5).

However, the current early diagnosis and treatment is far from achieving the considerable clinical requirement. The majority of antitumor drug-mediated cell death occurs via the suppression of cell proliferation and the induction of apoptosis. As a typical anti-apoptosis protein, survivin is characterized by inhibitory functions with regard to cell apoptosis and the regulation of cell division (6). Survivin has also been shown to affect the biological behavior of tumors via inhibiting apoptosis, participating in cellular division and promoting neovascularization, and the protein has been recognized as one of the most powerful anti-apoptosis factors (7,8). In addition, a previous study demonstrated that normal tissue does not express survivin, while the protein is predominantly and specifically expressed in tumor tissues (9). Arsenic trioxide (As2O3) has been demonstrated to induce the apoptosis of ACC-2 cells (10).

Materials and methods

Patients and specimens

In total, 13 patients with LGACC (female, 4; male, 9) were recruited from Renmin Hospital of Wuhan University (Wuhan, China) between 2007 and 2012. None of the patients had undergone any chemotherapy, radiotherapy or hormonotherapy prior to surgery. On the basis of the 7th edition of the American Joint Committee on Cancer TNM Classification for Lacrimal Gland Tumors stages, the 13 patients were divided into two groups, namely the TNM1–2 and TNM3–4 groups. In total, eight samples comprised the TNM1–2 group, while five samples were included in the TNM3–4 group. Primary cells were obtained using tissue culture techniques. Mixed cells were removed via a number of methods and cell morphological characteristics were observed using a phase contrast microscope. In addition, normal lacrimal gland tissues were collected from six patients who underwent eye surgery as a result of a non-tumor-induced disease during the same time period. All the patients provided informed consent and the experiment was approved by the Ethics Committee of Renmin Hospital of Wuhan University.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The mRNA expression levels of survivin were examined using RT-qPCR, and the primers used are shown in Table I. β-actin was used as a control. Total RNA was isolated with TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) and treated with RNase-free DNase I (Takara Bio, Inc., Shiga, Japan) to avoid genomic DNA contamination. Yields and purities were estimated using the A260/A280 ratio using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Samples with an absorbance ratio of 1.9–2.0 were reverse transcribed using a Revert Aid First-Strand cDNA Synthesis kit (Thermo Fisher Scientific) with a random hexamer primer (Shanghai Sangon Biotechnology Co., Ltd., Shanghai, China). PCR amplification of the cDNA template was conducted using Thunderbird SYBR qPCR mix (Toyobo Co., Ltd., Osaka, Japan) on an ABI PRISM 7300 sequence detection system (Applied Biosystems Life Technologies, Carlsbad, CA, USA). The conditions for PCR were as follows: Initial denaturation at 95°C for 5 min, followed by 40 amplification cycles consisting of denaturation at 95°C for 5 sec, annealing at 58°C for 30 sec and elongation at 72°C for 30 sec. PCR assays were run in triplicate, and the results were averaged. All PCR products were visualized by electrophoresis and ethidium bromide staining in 2% agarose gels. The relative expression level of the genes was normalized against an internal β-actin control, using the ddCt method.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

GeneForward primerReverse primer
Survivin CCCAGCACAATGAAGATCAAGATCAT ATCTGCTGGAAGGTGGACAGCGA
β-actin CAGCCCTTTCTCAAGGACCAC GCAAACATCAGGCTCTTCCTC
Western blot analysis

For western blot analysis, 50 µg protein was loaded per well on a 12% sodium dodecyl sulfate-polyacrylamide electrophoresis gel and resolved via standard electrophoresis. Subsequently, the gels were electrophoretically transferred onto nitrocellulose membranes (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The membranes were blocked with 5% bovine serum albumin (Sigma-Aldrich, St. Louis, MO, USA) in phosphate-buffered saline (PBS) containing 0.1% Tween-20 (PBS-T) for 1 h at room temperature. Next, the membranes were probed overnight at 4°C with polyclonal antibodies targeting survivin (1:800; 2803; Cell Signaling Technology, Inc., Danvers, MA, USA) and β-actin (1:600; 4967; Cell Signaling Technology, Inc.). Protein molecular weight markers were included on each blot. To verify that equivalent amounts of the protein samples were loaded, the membranes were probed overnight at 4°C. Subsequently, the membranes were extensively washed in PBS-T and incubated with a peroxidase-conjugated anti-rabbit IgG (1:3,000 w/v; #8888; Cell Signaling Technology, Inc., Danvers, MA, USA) to reveal the presence of the survivin and β-actin primary antibodies. The bands were visualized using an enhanced chemiluminescence kit (PerkinElmer, Inc., Waltham, MA, USA), and their optical densities were measured using the Densitometry Function in the Scion Image software for Windows, beta version 4.02 (NIH Image programme).

Cell culture

Primary human ACC cells and normal cells of the lacrimal gland were prepared and cultured, as described previously (10), with certain minor modifications. The lacrimal gland was decapsulated to remove the majority of other tissues, and the remaining tissue was minced and digested with 1.0 g/l collagenase I (#C0130) and 5.0 mg/l DNase I (#D5025; Sigma-Aldrich) in Dulbecco's modified Eagle's medium (#SH30023.01B, HyClone, Logan, UT, USA): Nutrient mixture F-12 (DMEM/F12) at 37°C for 15 min. The supernatants were diluted with modified DMEM/F12 medium, which contained 10% fetal bovine serum (#SH30084.03; HyClone). Subsequently, the mixtures were centrifuged at 60 × g for 8 min at 4°C, and the resulting cell pellets were resuspended in medium and repelleted, as aforementioned. The cells were plated at a density of ~1×106 cells/ml in six-well plates and incubated in a humidified atmosphere of 5% CO2 at 37°C until the cells had adhered. Six replicates were used. After 24 h, the medium was replaced (2 ml/well).

RNA interference

Primer sequences for survivin were as follows: Forward, 5′-CCC GTT GGC AGA GGT GGC-3′ and reverse, 5′-TGG GAC CAG GCA GCT CCG-3′. Specific short interfering RNA (siRNA) fragments of survivin were obtained using a BLOCK-iT™ Complete Dicer RNAi kit (Invitrogen Life Technologies). Subsequently, the ACC cells of the lacrimal gland were transfected with 25 ng siRNA using 5 ml Lipofectamine 2000 (Invitrogen Life Technologies). At 48 h after transfection, the cells were collected for the subsequent RT-qPCR and MTT assays.

As2O3 treatment

As2O3 treatment was applied following the adoption and modification of a previous method (10). Cells in an exponential growth phase were cultured in serum-free medium for 24 h, after which the cells were seeded into three independent six-well plates and treated with 0, 2, 4 and 6 µM As2O3 (200 µl per well) for 24, 48 and 72 h.

MTT assay

Following As2O3 treatment for 24 and 48 h, cell survival was determined using an MTT assay. The cells were cultured in 96 well-plates at a density of 1×104 cells per well. A 20-µl volume of MTT solution (5 mg/ml) was added to each well and subsequently incubated for 4 h at 37°C. Following removal of the medium, the formazan salts were dissolved in 100 µl dimethyl sulfoxide and the optical absorbance was determined using a microplate reader at a wavelength of 490 nm (BioTek Instruments, Inc., Winooski, VT, USA). Cell viability was expressed as a percentage of the corresponding control.

Statistical analysis

All data were expressed as the mean ± standard error of the means. Comparisons between two groups were performed using the unpaired Students t-test. Differences among groups were determined using one-way analysis of variance followed by Student-Newman-Keuls tests. P<0.05 was considered to indicate a statistically significant difference.

Results

mRNA and protein expression levels of survivin in tumor tissues collected from LGACC patients with a different pathological classification

The mRNA and protein expression levels of survivin in the TNM1–2 and TNM3–4 groups were higher when compared with the control samples (P<0.01). In addition, when comparing the TNM groups, the TNM3–4 patients exhibited higher mRNA and protein expression levels of survivin when compared with the TNM1–2 patients (P<0.01; Fig. 1).

Figure 1.

Relative mRNA and protein expression levels of survivin in human adenoid cystic carcinoma tissues from the lacrimal gland. Results are expressed as the mean ± standard deviation (n=5). **P<0.01, vs. control; ##P<0.01, vs. TNM1–2. TNM, tumor-node-metastasis.

Effects of siRNA interference on the mRNA expression of survivin and the cell proliferation of primary cultured LGACC cells

At 48 h after siRNA interference, the mRNA expression levels of survivin in the TNM1–2 and TNM3–4 groups were significantly decreased when compared with the non-siRNA interference group (P<0.01; Fig. 2). Furthermore, the rate of cell proliferation in the TNM1–2 group was shown to decrease following siRNA treatment, and the cell viability percentages at days 2, 3 and 4 were all lower when compared with the non-siRNA interference control (days 2 and 3, P<0.05; day 4, P<0.01 vs. TNM1–2 + siRNA). The rate of cell proliferation in the TNM3–4 group was also significant decreased following siRNA treatment, and the cell viability percentages at days 2, 3 and 5 were all lower when compared with the non-siRNA interference control (days 3 and 5, P<0.05; day 2, P<0.01 vs. TNM3–4 + siRNA; Fig. 3).

Figure 2.

Relative mRNA expression levels of survivin in primary human adenoid cystic carcinoma cells from the lacrimal gland following treatment with siRNA for 48 h. Results are expressed as the mean ± standard deviation (n=5). **P<0.01, vs. TNM1–2; ##P<0.01, vs. TNM3–4. TNM, tumor-node-metastasis; siRNA, short interfering RNA.

Figure 3.

Integrated optical density values obtained in the MTT assay prior to and following siRNA treatment in the TNM1–2 and TNM3–4 cells. Results are expressed as the mean ± standard deviation (n=5). *P<0.05 and **P<0.01, vs. TNM(1–2) + siRNA; #P<0.05 and ##P<0.01, vs. TNM(3–4) + siRNA. TNM, tumor-node-metastasis; siRNA, short interfering RNA.

Effects of different doses of As2O3 treatment on the mRNA expression levels of survivin

At 48 h after treatment with various doses of As2O3 (2, 4 and 6 µΜ), the mRNA expression levels of survivin in the TNM1–2 group were significantly decreased when compared with the control (P<0.05, P<0.01). Furthermore, As2O3 treatment was shown to dose-dependently decrease the mRNA expression levels of survivin in the TNM3–4 group, particularly at a concentration of 4 and 6 µM As2O3 (Fig. 4; P<0.05, P<0.01).

Figure 4.

Relative mRNA expression levels of survivin in primary human adenoid cystic carcinoma cells from the lacrimal gland after 48 h treatment with As2O3. Results are expressed as the mean ± standard deviation (n=5). *P<0.05 and **P<0.01, vs. control; #P<0.05 and ##P<0.01, vs. As2O3 (2 µΜ) or As2O3 (4 µΜ). TNM, tumor-node-metastasis; As2O3, arsenic trioxide.

Effects of different doses of As2O3 treatment on cell apoptosis

After 72 h of treatment, As2O3 was demonstrated to dose-dependently decrease the cell viability in the TNM1–2 and TNM3–4 groups (P<0.05, P<0.01), indicating that As2O3 was able to significantly promote cell apoptosis. In the TNM1–2 group, the apoptotic rate was shown to increase from 4.80 to 6.51%, and finally to 10.06%, according to the concentration of As2O3 (2, 4 and 6 µM) in 24 h. Furthermore, the apoptotic rates at 48 h were 5.20, 8.02 and 13.24% for the various concentrations, respectively, and 6.40, 10.41 and 20.84% at 72 h, respectively. In the TNM3–4 group, the apoptotic rates following treatment with 2, 4 and 6 µM As2O3 were 4.82, 6.59 and 8.06% at 24 h, respectively, 6.20, 8.02 and 12.19% at 48 h, respectively, and 7.40, 12.59 and 17.84% at 72 h, respectively (Fig. 5).

Figure 5.

Treatment of primary human adenoid cystic carcinoma cells from the lacrimal gland with As2O3 resulted in a time- and dose-dependent increase in apoptotic cells. Results are expressed as the mean ± standard deviation (n=5). **P<0.01, As2O3 (6 µΜ) vs. As2O3 (2 µΜ); ##P<0.01, As2O3 (6 µΜ) vs. As2O3 (4 µΜ); &P<0.05 and &&P<0.01, As2O3 (4 µΜ) vs. As2O3 (2 µΜ). TNM, tumor-node-metastasis; As2O3, arsenic trioxide.

Discussion

Survivin is one of eight members of the inhibitor of apoptosis protein family, which was initially identified in 1997 (11). Although survivin is predominantly expressed in fetal tissues, little or no expression is observed in completely differentiated human tissues. However, multiple malignant tumor tissues, such as human ACC, have been shown to exhibit hyperexpression of survivin (12). In the present study, survivin was demonstrated to be highly expressed in ACC cells of the lacrimal gland, and the corresponding expression levels were shown to correlate with the TNM classification. The expression of survivin in the TNM3–4 group was significantly higher compared with the TNM1–2 group and control.

Survivin plays a vital role in the entire cell cycle since the protein exerts dual functions in inhibiting cell apoptosis and promoting cell proliferation (12). Survivin has been recognized as a putative biomarker and drug target for various types of tumor (9). However, the underlying mechanism remains unknown. A previous study hypothesized that survivin may block apoptosis via inhibiting caspase-3 and −7 (13). In addition, survivin has been proposed to interact with interleukin-3, Fas, Bax and p53 (14,15); however, the underlying mechanisms require further investigation. During mitosis, survivin exists as a multi-protein complex, known as the chromosomal passenger complex. By participating in this complex, survivin may promote cell proliferation by facilitating accurate sister chromatid segregation and the stabilization of microtubules in late mitosis (16). In the present study, silencing survivin expression using siRNA in primary cultured ACC cells of the lacrimal gland was shown to significantly decelerate the rate of cell proliferation, which may be attributed to the ability of survivin to inhibit apoptosis and promote proliferation.

As2O3 is a broad-spectrum anti-cancer drug that has been widely administered over a number of years. The compound can significantly suppress the growth of solid tumors, such as stomach and pulmonary carcinomas. The underlying mechanism is hypothesized to involve As2O3 initiating the mitochondria-mediated apoptosis pathway, which increases the production of reactive oxygen species, subsequently activating cytochrome c pathway-induced apoptosis and thereby facilitating the mutation of mitochondrial DNA in the mitochondria (17). A previous study demonstrated that As2O3 was able to induce the apoptosis of ACC-2 cells, indicating a potential anti-adenocarcinoma effect of As2O3 (10). In the present study, As2O3 was demonstrated to dose-dependently inhibit the mRNA expression of survivin in primary cultured cells isolated from the tumor tissues of the TNM1–2 and TNM3–4 groups. Furthermore, As2O3 was shown to enhance the cell apoptosis rate in the TNM1–2 and TNM3–4 groups in a dose- and time-dependent manner. Therefore, the results of the present study indicate that As2O3 may exert an anti-LGACC effect.

In conclusion, to the best of our knowledge the present study is the first to demonstrate that survivin is expressed in the tumor tissues of patients with LGACC, and is positively associated with tumor deterioration. Furthermore, it was observed that As2O3 induces the apoptosis of LGACC cells by inhibiting survivin expression. Therefore, the results of the present study indicate an association between survivin and LGACC, with the overexpression of survivin suggesting a poor prognosis in patients with LGACC. Survivin may be useful as a diagnostic marker and a potential therapeutic target for the treatment of LGACC and As2O3 may be a feasible future therapy for the treatment of LGACC.

References

1 

Kokemueller H, Eckardt A, Brachvogel P and Hausamen JE: Adenoid cystic carcinoma of the head and neck - a 20 years experience. Int J Oral Maxillofac Surg. 33:25–31. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Zhou Q, Chang H, Han YD, Gao Y and Liu HG: High-grade transformation in adenoid cystic carcinoma: A clinicopathologic study. Zhonghua Bing Li Xue Za Zhi. 42:106–110. 2013.(In Chinese). PubMed/NCBI

3 

Zeng J, Shi JT, Li B, Sun XL, An YZ, Li LQ, Gao F, Xu JP and Jonas JB: Epithelial tumors of the lacrimal gland in the Chinese: a clinicopathologic study of 298 patients. Graefes Arch Clin Exp Ophthalmol. 248:1345–1349. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Civit T, Klein O and Baylac F: Lacrimal gland epithelial tumors. Neurochirurgie. 56:152–157. 2010.(In French). View Article : Google Scholar : PubMed/NCBI

5 

Lee JI, Kim YZ, Lee EH and Kim KH: Skull base invasion of adenoid cystic carcinoma of the lacrimal gland: a case report. J Korean Neurosurg Soc. 44:273–276. 2008. View Article : Google Scholar : PubMed/NCBI

6 

McKenzie JA and Grossman D: Role of the apoptotic and mitotic regulator survivin in melanoma. Anticancer Res. 32:397–404. 2012.PubMed/NCBI

7 

Kanwar JR, Kamalapuram SK and Kanwar RK: Targeting survivin in cancer: Patent review. Expert Opin Ther Pat. 20:1723–1737. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Kanwar JR, Kamalapuram SK and Kanwar RK: Targeting survivin in cancer: The cell-signalling perspective. Drug Discov Today. 16:485–494. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Altieri DC: Survivin, cancer networks and pathway-directed drug discovery. Nat Rev Cancer. 8:61–70. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Zhang B, Mu HB, Xu XG, Liu W and Hu NR: Role of survivin gene on the apoptosis of adenoid cystic carcinoma-2 cells induced by arsenic trioxide. Hua Xi Kou Qiang Yi Xue Za Zhi. 28:246–249. 2010.(In Chinese). PubMed/NCBI

11 

Adida C, Crotty PL, McGrath J, Berrebi D, Diebold J and Altieri DC: Developmentally regulated expression of the novel cancer anti-apoptosis gene survivin in human and mouse differentiation. Am J Pathol. 152:43–49. 1998.PubMed/NCBI

12 

Ryan BM, O'Donovan N and Duffy MJ: Survivin: a new target for anti-cancer therapy. Cancer Treat Rev. 35:553–562. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Shin S, Sung BJ, Cho YS, Kim HJ, Ha NC, Hwang JI, Chung CW, Jung YK and Oh BH: An anti-apoptotic protein human survivin is a direct inhibitor of caspase-3 and −7. Biochemistry. 40:1117–1123. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Tamm I, Wang Y, Sausville E, Scudiero DA, Vigna N, Oltersdorf T and Reed JC: IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases and anticancer drugs. Cancer Res. 58:5315–5320. 1998.PubMed/NCBI

15 

Mirza A, McGuirk M, Hockenberry TN, Wu Q, Ashar H, Black S, Wen SF, Wang L, Kirschmeier P, Bishop WR, Nielsen LL, Pickett CB and Liu S: Human survivin is negatively regulated by wild-type p53 and participates in p53-dependent apoptotic pathway. Oncogene. 21:2613–2622. 2002. View Article : Google Scholar : PubMed/NCBI

16 

Yang D, Welm A and Bishop JM: Cell division and cell survival in the absence of survivin. Proc Natl Acad Sci USA. 101:15100–15105. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Yang CH, Kuo ML, Chen JC and Chen YC: Arsenic trioxide sensitivity is associated with low level of glutathione in cancer cells. Br J Cancer. 81:796–799. 1999. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Pan Y, Xing Y and Wang H: Expression of survivin in adenoid cystic carcinoma of the lacrimal gland and the effect of intervention with arsenic trioxide in vitro. Exp Ther Med 10: 330-334, 2015.
APA
Pan, Y., Xing, Y., & Wang, H. (2015). Expression of survivin in adenoid cystic carcinoma of the lacrimal gland and the effect of intervention with arsenic trioxide in vitro. Experimental and Therapeutic Medicine, 10, 330-334. https://doi.org/10.3892/etm.2015.2466
MLA
Pan, Y., Xing, Y., Wang, H."Expression of survivin in adenoid cystic carcinoma of the lacrimal gland and the effect of intervention with arsenic trioxide in vitro". Experimental and Therapeutic Medicine 10.1 (2015): 330-334.
Chicago
Pan, Y., Xing, Y., Wang, H."Expression of survivin in adenoid cystic carcinoma of the lacrimal gland and the effect of intervention with arsenic trioxide in vitro". Experimental and Therapeutic Medicine 10, no. 1 (2015): 330-334. https://doi.org/10.3892/etm.2015.2466
Copy and paste a formatted citation
x
Spandidos Publications style
Pan Y, Xing Y and Wang H: Expression of survivin in adenoid cystic carcinoma of the lacrimal gland and the effect of intervention with arsenic trioxide in vitro. Exp Ther Med 10: 330-334, 2015.
APA
Pan, Y., Xing, Y., & Wang, H. (2015). Expression of survivin in adenoid cystic carcinoma of the lacrimal gland and the effect of intervention with arsenic trioxide in vitro. Experimental and Therapeutic Medicine, 10, 330-334. https://doi.org/10.3892/etm.2015.2466
MLA
Pan, Y., Xing, Y., Wang, H."Expression of survivin in adenoid cystic carcinoma of the lacrimal gland and the effect of intervention with arsenic trioxide in vitro". Experimental and Therapeutic Medicine 10.1 (2015): 330-334.
Chicago
Pan, Y., Xing, Y., Wang, H."Expression of survivin in adenoid cystic carcinoma of the lacrimal gland and the effect of intervention with arsenic trioxide in vitro". Experimental and Therapeutic Medicine 10, no. 1 (2015): 330-334. https://doi.org/10.3892/etm.2015.2466
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team