Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
September-2016 Volume 12 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2016 Volume 12 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

A polymorphism at the microRNA binding site in the 3'-untranslated region of C14orf101 is associated with the risk of gastric cancer development

  • Authors:
    • Cuiju Wang
    • Yufei Zhao
    • Yanming Ming
    • Shengnan Zhao
    • Zhanjun Guo
  • View Affiliations / Copyright

    Affiliations: Department of Gynaecology Ultrasound, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050011, P.R. China, Department of Gastroenterology and Hepatology, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050011, P.R. China
  • Pages: 1867-1872
    |
    Published online on: July 13, 2016
       https://doi.org/10.3892/etm.2016.3521
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

MicroRNAs (miRNAs) bind to the 3'-untranslated regions (3'-UTRs) of mRNAs, affecting translation and regulating cell differentiation, tumorigenesis and apoptosis. Genetic polymorphisms in these regions in target genes are able to affect the binding affinity between miRNA and target genes, ultimately affecting the expression of individual miRNAs. In the present case‑control study, genotyping of 5 microRNA single nucleotide polymorphisms (SNPs) located at the binding site of the 3'‑UTR of RYR3 (rs1044129), C14orf101 (rs4901706), KIAA0423 (rs1053667), GOLGA7 (rs11337) and KRT81 (rs3660) genes was assessed in order to investigate its role in gastric cancer (GC). The results indicated that the rs4901706 SNP, which is located in the 3'‑UTR of C14orf101, was associated with GC development risk, as determined by χ2 analysis (relative risk, 1.630; 95% confidence interval, 1.070‑2.483; P=0.022). A Renilla/luciferase reporter assay also indicated the different binding affinity between the SNP of rs4901706 and microRNA. In conclusion, rs4901706 SNP of C14orf101 gene in the microRNA binding site may be used as a valuable biomarker when predicting GC risk.

Introduction

Gastric cancer (GC) is associated with high morbidity and mortality rates. It is fourth most common type of cancer and one of the leading causes of cancer-associated mortality around the world (1–3). Based on the GLOBOCAN 2012 data from the World Health Organization (http://globocan.iarc.fr/Pages/fact_sheets_cancer.aspx), ~1 million new cases of stomach cancer have occurred in 2012 (952,000 cases and 6.8% of the total cancer) with 70% of cases occurring in developing countries, particularly in Eastern Asia. Half the world total occurred in Eastern Asia, which made it the fifth most common malignancy in the world. Stomach cancer is also the third leading cause of cancer death in both genders worldwide (723,000 deaths and 8.8% of the total cancer). GC is a multifactorial disease, with environmental and genetic factors contributing to its etiology (4,5). Although advancements have been achieved in the treatment of GC in recent years, GC is still associated with a poor prognosis, particularly due to delayed diagnosis (6).

MicroRNAs (miRNAs) are ~22-nucleotide long molecules that regulate the expression of mRNAs by base pairing to their 3′-untranslated region (3′-UTR), thereby preventing translation (7,8). A great number of studies have indicated that miRNAs are critical in numerous biological processes, including apoptosis, proliferation, insulin secretion, tumorigenesis and cellular differentiation (7,8). In humans, >700 miRNAs have been identified, and these miRNAs regulate the expression of 30% of protein-coding genes (9). In fact, miRNAs target nucleotides in the ‘seed region’ of the 3′-UTR (2–8 nucleotides in the 5′ end) of the mRNA. Perfect complementarity between the miRNA and its target mRNA sequence leads to RNA silencing, and thus, the protein levels are reduced (10,11). It has been demonstrated that single nucleotide polymorphisms (SNPs) in the 3′-UTR alter target gene expression, affecting the risk of cancer development in individuals (12,13).

A study by Yu et al (14) identified 12 SNPs associated with cancer development risk, which were located in the miRNA target site. These SNPs were then genotyped in healthy subjects from the Hebei area in China, and 6 SNPs were excluded (14) due to presenting a minor allele frequency of <5%. The SET8 expression have been proven to be associated with the outcome of gastric cancer (15). The potential value of one of these SNPs, rs16917496, in the SET8 gene was examined in a preliminary study to evaluate the correlation between rs16917496 polymorphisms and SET8 expression in GC patients (unpublished data). Thus, the present study aimed to investigate the remaining 5 miRNA binding-site SNPs in the 3′-UTR of RYR3 (rs1044129), C14orf101 (rs4901706), KIAA0423 (rs1053667), GOLGA7 (rs11337) and KRT81 (rs3660) in GC patients in order to assess their association with the risk of cancer development.

Materials and methods

Tissue specimen collection and DNA extraction

Blood samples were collected before GC resection from a total of 153 GC patients (112 males and 41 females) who underwent GC resection at the Department of General Surgery at the Fourth Hospital of Hebei Medical University (Shijiazhuang, China) prior to the operation between February 2008 and November 2010. All GC patients were diagnosed preoperatively via histopathological examination (16). The TNM system was used to determine the different lymph node metastasis and clinical stages (17). In addition, blood samples were collected from 233 healthy subjects (169 males, 64 females) with no previous history of cancer. The characteristics of patients and controls were listed in Table I. Patients provided their informed consent for participation in the present study. All procedures were supervised and approved by the Human Tissue Research Committee of the Fourth Hospital of Hebei Medical University (Shijiazhuang, China).

Table I.

Clinical characteristics of gastric cancer patients and healthy controls.

Table I.

Clinical characteristics of gastric cancer patients and healthy controls.

CharacteristicCases, nControls, nP-value
Gender 0.885
  Male112169
  Female  41  64
Age (years) 0.209
  ≤60  61108
  >60  92125
Tumor size (diameter)
  ≤6 cm  76
  >6 cm  77
Tumor location
  Upper  55
  Middle  47
  Lower  51
Lymph node metastasis
  N0  43
  N1  36
  N2  34
  N3  40
Clinical stages
  I+II  46
  III+IV  90
Extent of differentiation
  Moderate  96
  Poor  57
Pathological subtype
  Diffuse100
  Intestinal  27
  Mixed  26

Genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (A1125; Promega Corp., Madison, WI, USA). Briefly, 100 µl blood was added to the cell lysis solution for red blood cells, followed by lysis of the white blood cells and their nuclei in the Nuclei Lysis Solution with RNase. The cellular proteins were then removed by a salt-precipitation step. Finally, the genomic DNA was concentrated and desalted by isopropanol precipitation.

SNP genotyping of microRNA binding-site SNPs

The miRNA SNPs located at the binding site, including RYR3 (rs1044129), C14orf101 (rs4901706), KIAA0423 (rs1053667), GOLGA7 (rs11337) and KRT81 (rs3660), were genotyped using the ligation detection reaction method (18), featuring forward and reverse primers, in order to amplify DNA fragments flanking the SNPs. This procedure was performed according to the SNP database of the National Center for Biotechnology Information (Bethesda, MD, USA; http://www.ncbi.nlm.nih.gov/snp/).

Polymerase chain reaction (PCR) was performed with 50 ng genomic DNA, 1 µl of 10 nm primer pairs, 12.5 µl of Master Mix and distilled water to a final volume of 25 µl using a PCR Master Mix kit (K1081; Promega Corp.), according to the manufacturer's instructions, and for 35 thermal cycles. The primer and probe sequences used in PCR are shown in Table II. Ligation was performed with various probes, which were matched to the SNPs. Subsequently, the ABI PRISM 3730xl DNA Analyzer (Applied Biosystems; Thermo Fisher Scientific, Inc., Foster City, CA, USA) was used to separate the ligated products. SNPs were detected and verified based on differences in the length of ligated products. The experiment was performed once if it was successful.

Table II.

Primers and probes used for genotyping of miRNA SNPs.

Table II.

Primers and probes used for genotyping of miRNA SNPs.

Geners NCBIPrimer sequenceProbe sequence
RYR3rs1044129F: ATGGAGTAATGCTTTATGGTCS1: TTTAGGTGAATCTCCTCAAATACAA
(A/G)R: CAGTCACAGAGTGGTTGTAGAS2: TTTTTTAGGTGAATCTCCTCAAATACAG
S3: TGAAGTGCCCACTGCAATAAAGTAA
KIAA0423rs1053667F: CATGAAATCTGAGTCACATGGS1: TTTTAGTAATCATGTTTTAATGTAGAACC
(C/T)R: GCTGAGAAATGAGACATACCAS2: TTTTTTTAGTAATCATGTTTTAATGTAGAA
S3: TCAAACAGGATGGAACATCAGTGGATTT
C14orf101rs4901706F: AAACTAAGTCATCTCCCAGATAS1: TTTTTTTTTTAATGGGGTATTCAGTGACTAAGA
(A/G)R: GTCATCTGGTGAAAGACTGGAS2: TTTTTTTTTTTTTAATGGGGTATTCAGTGACTAAGG
S3: TCTGCTATTTATGCAAAATTCTGTTTTTTTT
GOLGA7rs11337F: CGCTGTATTTGGGAGAGAGTTS1: TTTTTTTTTTTTACCATTAAAAGTTTCACTGTCAGAG
(G/T)R: CAGGCTGTAAAGTAACAAATGAGS2: TTTTTTTTTTTTTTTACCATTAAAAGTTTCACTGTCAGAT
S3: ATATTGTAGGTGCTAATACTGGATTTTTTTTTTT
KRT81rs3660F: GTTAGGCACCCCAACTCAAGTS1: TTTTTATTTTTGAGAAAAGTCCTGCTCAC
(G/C)R: GCCAGCGGACTTCTTTCTAGGS2: TTTTTTTTATTTTTGAGAAAAGTCCTGCTCAT
S3: TTGCACTATTCTATAGAAACTACAATTT

[i] F represents the forward primer. R represents reverse primer. S1 and S2 represent probes that match to different alleles of the SNP. S3 represents probes downstream of the SNP. miR, microRNA; SNP, single nucleotide polymorphism; NCBI, National Center for Biotechnology Information.

Renilla/luciferase reporter assays

A total of 4 oligonucleotides were synthesized based on dbSNP, the NCBI database of genetic variation, which consisted of the following parts (from 5′ to 3′): A XhoI sticky end (5 bp), a fragment from the 3′-UTR of the C14orf101 gene containing the GG or AA genotype (rs4901706; 47 bp), and a NotI sticky end (2 bp). The following sequences were used: GG-containing sense, 5′-TCGAGAGTGCTCAGCTACTTCTCCTCCACTTTGAAAGACCCCTCCCAGATCTGC-3′, and antisense, 5′-GGCCGCAGATCTGGGAGGGGTCTTTCAAAGTGGAGGAGAAGTAGCTGAGCACTC-3′; AA-containing sense, 5′-TCGAGAGTGCTCAGCTACTTCTCCTGCACTTTGAAAGACCCCTCCCAGATCTGC-3′, and antisense, 5′-GGCCGCAGATCTGGGAGGGGTCTTTCAAAGTGCAGGAGAAGTAGCTGAGCACTC-3′. The four oligonucleotides were incubated for 5 min with 1X NEBuffer 2 (New England Biolabs, Ipswich, MA, USA) in a heating block at 95°C. Next, the temperature was gradually reduced until it reached room temperature. The psiCheck-2 vector featuring the Renilla/luciferase and controlled firefly luciferase genes was linearized by digestion with NotI and XhoI (New England Biolabs), and the vector was then purified using a 1% agarose gel electrophoresis. The oligonucleotides were ligated in the linearized psiCheck-2 vector (Promega Corp.) into the cloning sites (NotI and XhoI), which were downstream of the Renilla luciferase reporter gene with T4 DNA ligase (Promega Corp.). Subsequently, the ligated vectors were transformed in Escherichia coli-competent cells, as follows: Competent cells were taken from −80°C freezer and thawed on ice for 20 min. 1 µl of ligated vector was mixed into 100 µl of competent cells in a microcentrifuge. The competent cell/DNA mixture was then placed on ice for 20–30 min and each transformation tube was heat shocked by placing the tube into a 42°C water bath for 90 sec. The tubes were placed back on the ice for 2 min and 500 µl of Luria-Bertani (LB) medium was added. The cells were grown at 37°C in a shaking incubator for 45 min. All of the transformations were plated onto a 10 cm LB agar plate and the plates were incubated at 37°C overnight. A total of 3 bacterial colonies were selected and the bacterial culture was incubated at 37°C for 12–18 h in a shaking incubator. The bacterial fluid samples were sequenced by the methods of Sanger dideoxy (Sangon Biotech, Shanghai, China), and sequencing was used to identify and select positive clones.

A human GC cell line (SGC 7901) purchased from the Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China) was seeded in 48-well plates and transfected with the modified psiCheck-2 vector (800 ng) using Lipo 2000 (11668-027; Invitrogen, CA, USA) at 37°C for 4–6 h with the GG or AA genotype. At 48 h after transfection, the Renilla luciferase activity was assessed using the Dual-Lucy Assay kit (Vigorous Instrument Co., Ltd., Beijing, China) and a luminometer BioFix Lumi-10 (Macherey-Nagel, Dusseldorf, Germany). The transfection efficiency was normalized against the firefly luciferase activity.

Statistical analysis

The χ2 test was performed to analyze dichotomous variables, including the presence or absence of an individual SNP in the patients and healthy controls. The odds ratio (OR) and 95% confidence interval (CI) were calculated using an unconditional logistic regression model. In addition, Student's t-test was used to compare the differential expression levels between genotypic groups in the Renilla/luciferase reporter assays. SPSS version 18.0 software (SPSS, Inc., Chicago, IL, USA) was used to perform statistical analyses. Statistically significant differences were defined when the P-value was <0.05.

Results

Patient characteristics

A total of 153 patients and 233 healthy controls were included in the present study. The clinical characteristics of patients including gender, age, tumor size and location, metastasis, clinical stage, differentiation status and pathological types were listed in Table I. The characteristics of the control, including gender and age were also listed in Table I. The distribution frequency was not identified to be different between patients and controls with respect to their age and gender (P=0.885 and 0.209) respectively. In addition, the mean age between patients and controls was not statistically different. An analysis for these patients and the controls was subsequently performed.

Association of C14orf101 SNP with risk of GC

In the present study, miRNA binding-site SNPs were genotyped in the patients and healthy controls, including C14orf101 (rs4901706), RYR3 (rs1044129), GOLGA7 (rs11337), KRT81 (rs3660) and KIAA0423 (rs1053667) to evaluate their association with the risk for cancer. The cancer risk association was evaluated for the distribution frequency of rs4901706 (GG vs. AG+AA), rs1044129 (AA vs. AG+GG), rs11337 (GG vs. GT+TT), rs3660 (GG vs. CG+CC) and rs1053667 (TT vs. CT+CC) between patients and controls using the χ2 test. As shown in Table III, the rs1044129 AA carriers were 47 in GC patients and 67 in the controls whereas the AG+GG carriers were 106 in GC patients and 166 in the controls; the rs1053667 TT carriers were 113 in GC patients and 161 in the controls whereas the CT+TT carriers were 40 in GC patients and 72 in the controls. In addition, the rs11337 GG carriers were 92 in GC patients and 141 in the controls while the GT+TT carriers were 61 in GC patients and 92 in the controls; Finally, the rs3660 GG carriers were 97 in GC patients and 145 in the controls while CG+CC carriers were 56 in GC patients and 88 in the controls. The rs 1044129 (relative risk, 1.099; 95% CI, 0.704–1.715; P=0.679), rs11337 (relative risk, 0.984; 95% CI, 0.649–1.493; P=0.940), rs3660 (relative risk, 1.023; 95% CI, 0.662–1.583; P=0.917) and rs1053667 (relative risk, 1.263; 95% CI, 0.801–1.992; P=0.314) were not associated with cancer risk by the analysis of the present study. The GG carriers were 100 in GC patients and 125 in the controls whereas the AG+AA were 53 in GC patients and 108 in the controls. It was also noted that the GG genotype was susceptible to GC carcinogenesis (relative risk, 1.630; 95% CI, 1.070–2.483; P=0.022). The data of the present study demonstrated that the rs4901706 SNP of C14orf101 was a predictive marker for GC risk.

Table III.

Distribution frequency of miRNA-binding SNPs between GC patients and healthy controls.

Table III.

Distribution frequency of miRNA-binding SNPs between GC patients and healthy controls.

VariantGeneGenotypeCasesControlsP-valueOR95% CI
rs1044129RYR3AA  47  670.6791.0990.704–1.715
AG+GG106166
rs1053667 KIAA0423TT1131610.3141.2630.801–1.992
CT+CC  40  72
rs4901706 C14orf101GG1001250.0221.6301.070–2.483
AG+AA  53108
rs11337GOLGA7GG  921410.9400.9840.649–1.493
GT+TT  61  92
rs3660KRT81GG  971450.9171.0230.662–1.583
CG+CC  56  88

[i] miRNA, microRNA; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval.

rs4901706 SNP in C14orf101 affects protein translation in GC cells

A vector named psiCheck-2 was constructed containing the rs4901706 AA or GG genotypes downstream of the Renilla/luciferase reporter gene in order to assess their functional effect on C14orf101 expression. The vector was transfected into the GC cell line SGC 7901. As shown in Fig. 1, a significant reduction of Renilla/luciferase activity was observed in GG genotypes compared with that of the AA genotypes (P=0.007). These data demonstrated that rs4901706 SNP may change the binding affinity between the rs4901706 genotype at the 3′UTR of C14orf101 and the corresponding miRNA.

Figure 1.

Renilla luciferase assay performed on the GG and AA genotypes at 48 h after transfection with modified psiCheck-2 vector transfected in SGC 7901 cell lines. The data are presented as the ratio of the Renilla luciferase activity against the firefly luciferase activity.

Discussion

In the present study, the SNPs of miRNA binding sites, including RYR3 (rs1044129), C14orf101 (rs4901706), KIAA0423 (rs1053667), GOLGA7 (rs11337) and KRT81 (rs3660), were examined for their ability to predict GC cancer risk. The results revealed that the rs4901706 SNP of C14orf101 gene is a possible risk biomarker for GC. To the best of our knowledge, the current study is the first to investigate the miRNA binding-site SNPs at the 3′-UTR of C14orf101, which exhibit the ability to predict GC risk. The miR-SNPs defined as the SNP at the miRNA binding site, the miRNAs and miRNAs processing machinery genes, are critically involved in disease phenotypes (19,20). We have identified gastric cancer associated miR-SNP of miRNAs processing machinery genes in previous study (21). Yu et al (14) performed a genome-wide analysis of SNPs located in the miRNA-binding sites of the 3′-UTR of various human genes and revealed that some miRNA-binding SNP distribution frequencies between the human cancer EST libraries and the dbSNP database was significantly different. Furthermore, they identified that twelve miRNA-binding SNPs displayed an aberrant allele frequency in human cancers using human cancer specimens against the dbSNP database for case-control association studies. Finally, they deduced that SNPs located in miRNA-binding sites was potentially associated with cancer by affecting miRNA target expression and function (14). Consistent with these previous findings, the frequent allele G of rs4901706 was found to be associated with GC risk in the present study.

MiRNAs appear to be critical in the response of patients to various treatments, particularly cancer treatment (22). In addition, the rs4901706 SNP of the C14orf101 gene has been previously demonstrated to be associated with cancer risk, since it serves as an miRNA binding site; however, the miRNA binding to this site that modulates the C14orf101 expression was not specified (14,23). In a previous study, we demonstrated that this SNP was also associated with survival in patients with non-Hodgkin lymphoma G allele carriers that exhibited a long life span (24). The data demonstrated that the GG genotype of C14orf101 would modify both the carcinogenesis and outcome of the cancer.

C14orf101, also known as transmembrane protein 260 (TMEM260), is conserved in chimpanzees, rhesus macaque monkeys, canines, cattle, mice, rats, chickens and zebrafish. However, a functional study of this gene has not been reported to date. The results of the current study suggest that the miRNA-binding SNPs of C14orf101 have an effect on cancer development. A Renilla/luciferase reporter assay highlighted the different binding affinity between the SNP of rs4901706 and miRNA binding to the rs4901706 site. Furthermore, the A to G transition of rs4901706 in the 3′-UTR of C14orf101 may result in the destruction of the A:T bond at the miRNA binding site, so as to alter the affinity of C14orf101 in binding with miRNAs. This may modulate the expression of the gene, thereby initiating GC carcinogenesis. However, the current study should be replicated in other populations and in laboratory-based functional studies in order to validate the results. The miRNA binding to C14orf101 should be identified, and the change in the expression of C14orf101 on proliferation, invasion and apoptosis of gastric cancer cells should be evaluated in future studies.

In conclusion, SNPs in the C14orf101 miRNA binding site appeared to represent a biomarker for cancer risk. rs4901706 SNP was a potential maker for early diagnosis of gastric cancer and valuable for gastric cancer prevention. Further analyzing the genetic polymorphisms of miRNA binding sites may result in better identification of patients susceptible to GC development. The miRNA binding to C14orf101 should be identified as well as the role of the expressional change of C14orf101 on proliferation, invasion and apoptosis of gastric cancer cells in future studies.

Acknowledgements

This study was supported by a grant from the Key Basic Research Program of Hebei (grant no. 14967713D).

References

1 

Parkin DM: International variation. Oncogene. 23:6329–6340. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Parkin DM, Bray FI and Devesa SS: Cancer burden in the year 2000. The global picture. Eur J Cancer. 37(Suppl 8): S4–S66. 2001. View Article : Google Scholar : PubMed/NCBI

3 

Stadtländer CT and Waterbor JW: Molecular epidemiology, pathogenesis and prevention of gastric cancer. Carcinogenesis. 20:2195–2208. 1999. View Article : Google Scholar : PubMed/NCBI

4 

Crew KD and Neugut AI: Epidemiology of gastric cancer. World J Gastroenterol. 12:354–362. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Forman D and Burley VJ: Gastric cancer: Global pattern of the disease and an overview of environmental risk factors. Best Pract Res Clin Gastroenterol. 20:633–649. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Xia J, Guo X, Yan J and Deng K: The role of miR-148a in gastric cancer. J Cancer Res Clin Oncol. 140:1451–1456. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Ambros V: The functions of animal microRNAs. Nature. 431:350–355. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Lewis BP, Burge CB and Bartel DP: Conserved seed pairing, often flanked by adenosines, indicateds that thousands of human genes are microRNA targets. Cell. 120:15–20. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Zeng Y, Yi R and Cullen BR: MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc Natl Acad Sci USA. 100:9779–9784. 2003. View Article : Google Scholar : PubMed/NCBI

11 

Zeng Y, Wagner EJ and Cullen BR: Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells. Mol Cell. 9:1327–1333. 2002. View Article : Google Scholar : PubMed/NCBI

12 

Chin LJ, Ratner E, Leng S, Zhai R, Nallur S, Babar I, Muller RU, Straka E, Su L, Burki EA, et al: A SNP in a let-7 microRNA complementary site in the KRAS 3′ untranslated region increases non-small cell lung cancer risk. Cancer Res. 68:8535–8540. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Brendle A, Lei H, Brandt A, Johansson R, Enquist K, Henriksson R, Hemminki K, Lenner P and Försti A: Polymorphisms in predicted microRNA-binding sites in integrin genes and breast cancer: ITGB4 as prognostic marker. Carcinogenesis. 29:1394–1399. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Yu Z, Li Z, Jolicoeur N, Zhang L, Fortin Y, Wang E, Wu M and Shen SH: Aberrant allele frequencies of the SNPs located in microRNA target sites are potentially associated with human cancers. Nucleic Acids Res. 35:4535–4541. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Shi XL, Guo ZJ, Wang XL, Liu XL and Shi GF: SET8 expression is associated with overall survival in gastric cancer. Genet Mol Res. 14:15609–15615. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Kaneko S and Yoshimura T: Time trend analysis of gastric cancer incidence in Japan by histological types, 1975–1989. Br J Cancer. 84:400–405. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Washington K: 7th edition of the AJCC cancer staging manual: Stomach. Ann Surg Oncol. 17:3077–3079. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Yi P, Lu W, Guo J, Liu Q, Chen Z, Han J and Li L: Development of a PCR/ligase detection reaction/nanogold-based universal array approach for the detection of low-abundant DNA point mutations. Cell Biochem Biophys. 61:629–636. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Horikawa Y, Wood CG, Yang H, Zhao H, Ye Y, Gu J, Lin J, Habuchi T and Wu X: Single nucleotide polymorphisms of microRNA machinery genes modify the risk of renal cell carcinoma. Clin Cancer Res. 14:7956–7962. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Hu Z, Chen J, Tian T, Zhou X, Gu H, Xu L, Zeng Y, Miao R, Jin G, Ma H, et al: Genetic variants of miRNA sequences and non-small cell lung cancer survival. J Clin Invest. 118:2600–2608. 2008.PubMed/NCBI

21 

Xie Y, Wang Y, Zhao Y and Guo Z: Single-nucleotide polymorphisms of microRNA processing machinery genes are associated with risk for gastric cancer. Onco Targets Ther. 8:567–571. 2015.PubMed/NCBI

22 

Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M, et al: MicroRNA gene expression deregulation in human breast cancer. Cancer Res. 65:7065–7070. 2005. View Article : Google Scholar : PubMed/NCBI

23 

Ryan BM, Robles AI and Harris CC: Genetic variation in microRNA networks: The implications for cancer research. Nat Rev Cancer. 10:389–402. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Yang B, Liu C, Diao L, Wang C and Guo Z: A polymorphism at the microRNA binding site in the 3′ untranslated region of C14orf101 is associated with non-Hodgkin lymphoma overall survival. Cancer Genet. 207:141–146. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang C, Zhao Y, Ming Y, Zhao S and Guo Z: A polymorphism at the microRNA binding site in the 3'-untranslated region of C14orf101 is associated with the risk of gastric cancer development. Exp Ther Med 12: 1867-1872, 2016.
APA
Wang, C., Zhao, Y., Ming, Y., Zhao, S., & Guo, Z. (2016). A polymorphism at the microRNA binding site in the 3'-untranslated region of C14orf101 is associated with the risk of gastric cancer development. Experimental and Therapeutic Medicine, 12, 1867-1872. https://doi.org/10.3892/etm.2016.3521
MLA
Wang, C., Zhao, Y., Ming, Y., Zhao, S., Guo, Z."A polymorphism at the microRNA binding site in the 3'-untranslated region of C14orf101 is associated with the risk of gastric cancer development". Experimental and Therapeutic Medicine 12.3 (2016): 1867-1872.
Chicago
Wang, C., Zhao, Y., Ming, Y., Zhao, S., Guo, Z."A polymorphism at the microRNA binding site in the 3'-untranslated region of C14orf101 is associated with the risk of gastric cancer development". Experimental and Therapeutic Medicine 12, no. 3 (2016): 1867-1872. https://doi.org/10.3892/etm.2016.3521
Copy and paste a formatted citation
x
Spandidos Publications style
Wang C, Zhao Y, Ming Y, Zhao S and Guo Z: A polymorphism at the microRNA binding site in the 3'-untranslated region of C14orf101 is associated with the risk of gastric cancer development. Exp Ther Med 12: 1867-1872, 2016.
APA
Wang, C., Zhao, Y., Ming, Y., Zhao, S., & Guo, Z. (2016). A polymorphism at the microRNA binding site in the 3'-untranslated region of C14orf101 is associated with the risk of gastric cancer development. Experimental and Therapeutic Medicine, 12, 1867-1872. https://doi.org/10.3892/etm.2016.3521
MLA
Wang, C., Zhao, Y., Ming, Y., Zhao, S., Guo, Z."A polymorphism at the microRNA binding site in the 3'-untranslated region of C14orf101 is associated with the risk of gastric cancer development". Experimental and Therapeutic Medicine 12.3 (2016): 1867-1872.
Chicago
Wang, C., Zhao, Y., Ming, Y., Zhao, S., Guo, Z."A polymorphism at the microRNA binding site in the 3'-untranslated region of C14orf101 is associated with the risk of gastric cancer development". Experimental and Therapeutic Medicine 12, no. 3 (2016): 1867-1872. https://doi.org/10.3892/etm.2016.3521
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team