Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
January-2018 Volume 15 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2018 Volume 15 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Detection of K‑ras gene mutations in feces by magnetic nanoprobe in patients with pancreatic cancer: A preliminary study

  • Authors:
    • Xiaoguang Wang
    • Jingshuai Wang
    • Fei Chen
    • Zhengxiang Zhong
    • Lifeng Qi
  • View Affiliations / Copyright

    Affiliations: Department of Surgery, Jiaxing Second Hospital, Jiaxing, Zhejiang 314000, P.R. China, Institute for Biomedical Engineering and Nano Science, Tongji University School of Medicine, Shanghai 200092, P.R. China
  • Pages: 527-531
    |
    Published online on: October 24, 2017
       https://doi.org/10.3892/etm.2017.5368
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The present study aimed to investigate the feasibility and effectiveness of detecting K‑ras mutation by using magnetic nanoparticles in fecal samples of patients with pancreatic cancer at different stages. The novel methodology of K‑ras mutation detection was compared to the existing methodology of cancer antigen (CA)19‑9 examination. Patients with pancreatic cancer (n=88), pancreatic benign diseases who displayed chronic pancreatitis (n=35), pancreatic mucinous cyst neoplasms (n=10) and pancreatic serous cyst (n=9) admitted to the Department of Surgery, Jiaxing Second Hospital were enrolled in the present study. Fecal samples were collected from all patients, DNA was extracted and magnetic nanoprobe was then used to detect K‑ras mutation. The results obtained using the novel magnetic nanoprobe detection technique showed a K‑ras mutation rate of 81.8% (72/88) in the patients with pancreatic cancer and 18.5% (10/54) in patients with pancreatic benign diseases. In patients with pancreatic cancer, the K‑ras mutation rate was comparable in stages I + IIA and IIB + III + IV (78.9 vs. 84.0%; P>0.05). The sensitivity and specificity of K‑ras mutation for detection of pancreatic cancer was 81.8 and 81.5%, respectively. Sixty‑eight pancreatic cancer patients had >37 U/ml CA99 with a sensitivity and specificity for pancreatic cancer detection of 77.3 and 77.8%, which was not significantly lower than detection by the fecal K‑ras mutations (P>0.05). Combinational detection of fecal K‑ras mutations and serum CA19‑9 significantly increased the sensitivity regarding pancreatic cancer detection to 97.7% (P<0.05), while the specificity was not enhanced (80.9%; P>0.05) compared with fecal K‑ras mutations or CA19‑9 alone. The findings showed that the magnetic nanoprobe is able to detect fecal K‑ras mutations in different stages of pancreatic cancer, with comparable sensitivity and specificity to CA19‑9 examination for differentiating pancreatic cancer. Furthermore, combined detection of CA19‑9 and K‑ras mutations has enhanced sensitivity compared with CA19‑9 alone.

Introduction

Pancreatic cancer is one of the most malignant types of gastrointestinal tract tumor with a 5-year survival rate of <5% (1). In recent years, the incidence of pancreatic cancer has been increasing. Early detection of pancreatic cancer is difficult due to its nonspecific clinical manifestations and therefore, a large proportion of patients are diagnosed at the advanced stage beyond the time window for radical surgery (2). Cancer antigen (CA)19-9 is the main tumor biomarker for diagnosing pancreatic cancer with a reported sensitivity of 65% and a specificity of 78–94% (3,4). Considering that CA19-9 cannot be used as an early detection marker for pancreatic cancer and is also detected in benign pancreatobiliary diseases, particularly chronic pancreatitis (5), its specificity and effectiveness may not be satisfactory. Thus, there is a requirement for developing novel methodologies to detect pancreatic cancer at different stages and make earlier diagnoses, which will ultimately lead to a better prognosis for patients.

With the development of modern molecular biological techniques, numerous novel and efficient detection methods have been developed, including those for the detection of tumor-associated genetic mutations, which is also a current focus of research on pancreatic cancer. The K-ras gene is closely associated with the development and progression of pancreatic cancer. K-ras mutation is an important and early event in tumorigenesis (6–8). K-ras is able to bind guanine nucleotides within a growth factor signal transduction pathway, while pathological mutations of K-ras lead to cell proliferation (9). The detection of K-ras mutations in biopsy specimens, pancreatic juice, bile and blood has been previously reported (10,11). Genetic mutations detected in biopsy specimens and pancreatic juice may be a reliable method for diagnosing pancreatic cancer; however, it is challenging to obtain adequate samples (12). Conversely, K-ras detection in blood has a relatively low sensitivity of 66–71% and requires combination with other examinations to increase the diagnostic rate (13–15). Recent studies have demonstrated that it is possible to extract and sequence fecal DNA (16,17). However, K-ras mutation has not been investigated in pancreatic cancer by magnetic nanoprobe. The present study introduced a nanoparticle trace capture probe, which is widely applied in detecting trace genetic variants (18,19), to detect K-ras mutations in the feces of patients with pancreatic cancer at different stages and further explored the sensitivity and specificity of the novel K-ras mutation detection method and the existing CA19-9 examination method as well as their combination regarding pancreatic cancer diagnosis.

Patients and methods

Patients

Patients with pancreatic diseases admitted to the Department of Surgery, Jiaxing Second Hospital (Jiaxing, China) from January 2013 to August 2015 were enrolled in the present study, including patients with diagnoses of pancreatic cancer (n=88), chronic pancreatitis (n=35), pancreatic mucinous cyst (n=10) and pancreatic serous cyst (n=9). Thirty one healthy individuals were also included as controls. Pancreatic tissue was obtained from patients after surgical resection at the Department of Surgery, Jiaxing Second Hospital. Tissue samples were obtained at the time of resection, during analysis of frozen sections or both, in accordance with the in-house protocol. Clinicopathological [i.e., clinical manifestation, tumor location, CA19-9, carcino-embryonic antigen (CEA)] and demographic data (i.e., age, sex, histology and tumor stage) were collected and analyzed. Informed consent was obtained from all the patients and the present study was approved by the Ethics Committee of Jiaxing Second Hospital.

DNA extraction from fecal specimens

Fecal samples were stored at −80°C. DNA was extracted by phenol-chloroform extraction from 200 mg feces and purified using a Qiagen purification kit (Qiagen, Hilden, Germany). DNA concentrations were measured using a ND-1000 NanoDrop (Thermo Fisher Scientific, Inc., Waltham, MA, USA).

Establishment of nanoparticle trace capture probe system

A solution of 1 M NaOH (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and 0.1 M salicylic acid (SA, Sigma-Aldrich; Merck KGaA) with volume at 100 µl each was added to a sterilized three-necked flask to increase the pH of the whole reaction solution to ~11.0 under vigorous stirring in an argon gas atmosphere, followed by the addition of an aqueous solution comprising a mixture of Fe(III) and Fe(II) oxide salts (Fe2O3 and Fe3O4; Merck KGaA) with a molar ratio of 2X Fe(III)/1X Fe(II)/4X SA until a black suspension was obtained. After refluxing at 90°C for 4 h, a dark-brown suspension was formed. The morphology of the magnetic nanoparticles was observed by transmission electron microscopy (Fig. 1).

Figure 1.

Morphology of magnetic nanoparticles by electron microscopy.

Detection of K-ras using magnetic nanoparticles. A capture probe for K-ras (10 µM, Foxgene Co., Ltd., Wuxi, China) was conjugated with 1 µM magnetic nanoparticles by 1-ethyl-3-(−3-dimethylaminopropyl) carbodiimide hydrochloride chemistry (Sigma-Aldrich; Merck KGaA) and purified by a magnetic field, followed by redispersion in Tris-EDTA buffer (20). PCR detection of K-Ras mutation system contained the final concentrations of each upstream and downstream primer, blocker (Shanghai Sangon, Shanghai, China) and capture probe as 0.9, 0.9, 0.9 and 0.20 mmol/l, respectively. The assay was set up as follows: A total of 20 ng DNA was used and the reaction was performed in a final volume of 20 ml. Detection sensitivity and specificity of K-ras (G12V or G13D) were estimated by using serial dilutions of the corresponding mutant SW480 cell line DNA (Type Culture Collection of the Chinese Academy of Sciences, Shanghai, China) mixed with wild-type DNA (5, 1, 0.5 and 0.1% mutant DNA solutions were prepared). The data were collected and analyzed using ABI 7500 fast System SDS software v1.4.1 (Applied Biosystems; Thermo Fisher Scientific, Inc.). PCR data were analyzed with a manual threshold of 0.1 and baseline from 5 to 15 to obtain cycle threshold (Cq) values for FAM and VIC channels. The assay was considered valid when the β-actin CT value was ≤20, the specific mutant gene CT was 21–37 (w3 copies) and all No Template Controls had an undetectable CT. PCR aliquots were also analyzed by 0.8% agorose gel electrophoresis. Relative quantification was performed using the comparative threshold cycle (2−ΔΔCq) method (21). The qRT-PCR reaction was performed at 50°C for 2 min and 95°C for 30 sec, followed by 40 cycles of denaturation at 95°C for 5 sec and annealing at 60°C for 45 sec. All reactions were performed in triplicate. The probe, primers and blockers used were as follows: Kras capture probe, 5′-CTCTATTGTTGGATCATATTCGTCCACAAAATGATTCTGAATTA-3′; G12V forward primer, 5′-ACTTGTGGTAGTTGGACCT-3′; G12V reverse primer, 5′-TAACTTGAAACCCAAGGTAC-3′; blocker, CCTACGCCACCAGCT (with 4 pentabases); G13D forward primer, 5′-GTTCTAATATAGTCACATTTTCATTATTTTTATTATAAAGC-3′; G13D reverse primer, 5′-GTCAAGGCACTCTTGCCTAGG-3′; blocker, CTTGCCTACGCCACCA (with 4 pentabases); β-actin forward, CTCCATCCTGGCCTCGCTGTβ-actin reverse primer, GCTGTCACCTTCACCGTTCC.

Statistical analysis

All statistical analyses were performed using SPSS 19.0 software (International Business Machines, Corp., Armonk, NY, USA). Continuous and categorical data are shown as the mean ± standard deviation or the percentage, which were compared by Student's t-test and the χ2 test, respectively. The correlation of K-ras and CA19-9 was analyzed by the χ2 test and the specificity, sensitivity, Youden's index (YI), positive predictive value (PPV) and negative predictive value (NPV) were also calculated. P<0.05 was considered to indicate a statistically significant difference.

Results

K-ras mutation detection in fecal DNA by nanoparticle capture probe has predictive value for pancreatic cancer

DNA was successfully extracted and validated from all fecal samples. G12V and G13D mutations in the K-ras gene were detected using the magnetic s. The CT value was determined and ranged from 41.71 to 62.61 in patients carrying G12V and/or G13D mutations. Of the 88 patients with pancreatic cancer, K-ras mutations were found in 72 (81.8%), including G12V (n=64) and G13D (n=8) (Table I). The mutation rate in samples from patients with pancreatic benign diseases was 18.5% (10/54), including G12V (n=8) and G13D (n=2). Among the 10 cases with K-ras mutations in the benign group, 7 cases were of chronic pancreatitis, 2 had a pancreatic mucinous cyst neoplasm and 1 had a pancreatic serous cyst. Among them, K-ras mutations were also detected in 9 cases. No mutations were detected in the healthy controls. Taken together, the K-ras mutation rate in pancreatic cancer was significantly higher than in that in pancreatic non-malignant diseases (P<0.05; Table I).

Table I.

Fecal K-ras mutations in pancreatic cancer, pancreatic benign diseases and healthy control group.

Table I.

Fecal K-ras mutations in pancreatic cancer, pancreatic benign diseases and healthy control group.

GroupCases (n)Cases carrying K-ras mutations, n (%)χ2P-value
Pancreatic cancer8872 (81.8)
Pancreatic benign diseases5410 (18.5)54.954 <0.001a
Healthy control310 (0)5.0430.025a

a P<0.05 vs. pancreatic cancer group.

Detection of K-ras mutations in fecal DNA has high sensitivity and specificity for pancreatic cancer

The sensitivity and specificity of K-ras mutations in fecal samples for detection of pancreatic cancer was 81.8 and 81.5%, respectively (Table II). Sixty-eight pancreatic cancer patients had >37 U/ml CA19-9 and the sensitivity and specificity were 77.3 and 77.8%, respectively, which were not significantly different from those of the K-ras mutations (P>0.05; Table II). Combined detection using fecal K-ras mutations and CA19-9 had a sensitivity and specificity of 97.7 and 80.9%, respectively, indicating that this combination significantly increased the sensitivity of detection of pancreatic cancer to >95% (P<0.05). The specificity was not enhanced compared with that of detection by K-ras mutations or CA19-9 alone (P>0.05; Table II).

Table II.

Fecal K-ras mutation and serum CA19-9 in the diagnosis of pancreatic cancer.

Table II.

Fecal K-ras mutation and serum CA19-9 in the diagnosis of pancreatic cancer.

ParameterSensitivity (%)χ2P-valueSpecificity (%)χ2P-valueYIPPV (%)NPV (%)
Serum CA19-977.3––77.8––0.55185.067.7
Fecal K-ras81.80.280.59781.50.060.8060.63387.873.3
K-ras+CA19-997.716.06<0.00180.90.680.5130.78686.194.4

[i] P-values refer to comparison with serum CA19-9. YI, Youden's index; PPI, positive predictive value; NPV, negative predictive value; CA, cancer antigen.

K-ras mutations were not significantly correlated with any of the clinical features assessed, including age, sex, clinical manifestations, tumor size, CA19-9 and CEA level, and tumor-nodes-metastasis stage of pancreatic cancer (Table III). The K-ras mutation rate was comparable in patients with I+IIA and IIB + III + IV pancreatic cancer (78.9 vs. 84.0%; P>0.05).

Table III.

Association of the presence of fecal K-ras mutations with certain biomarkers for pancreatic cancer.

Table III.

Association of the presence of fecal K-ras mutations with certain biomarkers for pancreatic cancer.

Fecal K-ras point mutations

VariableYesNoP-value
Sex 0.367
  Male34 (73.9)12 (26.1)
  Female36 (81.8)8 (18.2)
Age (years)67.00±10.6369.25±11.330.451
Clinical manifestations 0.152
  Yes40 (76.9)12 (23.1)
  No32 (88.9)4 (11.1)
Location 0.396
  Pancreatic head and neck46 (79.3)12 (20.7)
  Pancreatic body and tail26 (86.7)4 (13.3)
  Tumor diameter (cm)4.08±1.223.50±0.730.07
Differentiation 0.152
  Well40 (76.9)12 (23.1)
  Poor32 (88.9)4 (11.1)
CA19-9 level (U/l) 0.454
  ≥3754 (79.4)14 (20.6)
  <3718 (90.0)2 (10.0)
CEA level (U/l) 0.517
  ≥524 (85.7)4 (14.3)
  <548 (80.0)12 (20.0)
TNM stage 0.543
  I+IIA30 (78.9)8 (21.1)
  IIB+III+IV42 (84.0)8 (16)

[i] Values are expressed as the mean ± standard deviation or n and percentages. CA, cancer antigen; CEA, carcinoembryonic antigen; TNM, tumor-nodes-metastasis.

Discussion

Pancreatic cancer has a low early detection and survival rate, and radical resection is the only treatment available with curative potential. Radical surgery for a pancreatic cancer sized ≤2 cm has been reported to increase the 5-year survival rate to 19–52.9% (22,23). The early diagnosis of pancreatic cancer remains challenging and it is vital that more sensitive and specific methods are developed to detect pancreatic cancer. The present study investigated the feasibility and efficacy of magnetic nanoprobes to detect K-ras mutations in fecal samples from patients with pancreatic cancer at various stages. Magnetic nanoparticles were used to extract DNA from the fecal samples and the probe was able to specifically capture the point mutation. The results indicated that this detection was sensitive, reliable, repeatable and cheap.

The novel K-ras mutation detection method used in the present study had greater sensitivity and specificity than the previous CA19-9 method. The mutation rate of the K-ras gene in pancreatic cancer was 81.8%, which is higher than that reported by previous studies (24,25). Fecal DNA from pancreatic cancer patients had a higher mutation rate than that of patients with pancreatic benign diseases and healthy controls (P<0.05). The nanoparticle capture probe is intended to detect trace DNA content, which means that smaller clinical samples are required. The present study also found that the K-ras mutation rate in fecal DNA from patients with early pancreatic cancer (n=19) was comparable with that in samples from advanced pancreatic cancer patients (n=25; 78.9 vs. 84.0%; P>0.05). These results supported that K-ras mutations participate in the initiation of pancreatic cancer, which is consistent with previous findings. For instance, Wilentz et al (26) reported that 75–100% of pancreatic cancer patients had a mutation in K-ras codon 12, suggesting that K-ras detection may be used as an early detection marker for pancreatic cancer. In addition, K-ras mutation increased the risk of pancreatic cancer in patients with chronic pancreatitis (27), while K-ras mutations were also observed in certain benign pancreatic diseases (28). In the patient cohort of the present study, a certain percentage of cases with pancreatic benign diseases had fecal K-ras mutations. Whether K-ras mutations are an independent risk factor for pancreatic cancer should be assessed in future studies.

CA19-9 >37 U/ml is widely acknowledged as an important serum biomarker for pancreatic cancer (29), but its sensitivity and specificity are only 70–80%. In the present study, the diagnostic value of K-ras mutations in fecal samples and serum CA19-9 levels were compared. The sensitivity and specificity of K-ras mutations for pancreatic cancer detection were higher than those of CA19-9 (sensitivity, 81.8 vs. 77.3%; specificity, 81.5 vs. 77.8%), but the differences were not statistically different. Of note, the use of the two diagnostic markers K-ras and CA19-9 in combination had a significantly increased sensitivity (97.7%; P<0.05), and therefore represents a promising early detection method for pancreatic cancer. Although fecal K-ras mutation detection is of particular translational significance, its false-negative rate, which may result from the degradation of DNA, high content of bilirubin and limited detached tumor cells in feces, should not be neglected. These issues may be prevented by modifying the fecal DNA extraction method and multi-genetic multi-locus detection.

In summary, the novel magnetic nanoprobe system used in the present study was able to detect K-ras mutations in fecal samples of patients with pancreatic cancer with higher prevalence than that in samples from patients with benign pancreatic diseases and healthy controls. Based on these results, fecal K-ras mutation detection may be recommended for screening high-risk populations, and its combination with CA19-9 may improve the early detection rate in pancreatic cancer. The method has the advantage of being non-invasive. The present study might serve as a pilot analysis of the clinical significance of fecal K-ras mutation detection in pancreatic cancer, and its diagnostic potential still requires to be comprehensively validated in larger cohorts prior to being introduced into clinical practice. In conclusion, detecting K-ras mutation in fecal matter by novel magnetic nanoprobe may be used as a potential tumor marker for diagnosing patients with pancreatic carcinoma in the future.

Acknowledgements

The present study was supported by NSFC (grant no. 81371682), awarded to Professor Lifeng Qi and the Zhejiang Provincial Science and Technology Department (grant no. 2014C33139), awarded to Dr Zhengxiang Zhong.

References

1 

Sergeant G, Vankelecom H, Gremeaux L and Topal B: Role of cancer stem cells in pancreatic ductal adenocarcinoma. Nat Rev Clin Oncol. 6:580–586. 2009. View Article : Google Scholar : PubMed/NCBI

2 

Li D, Xie K, Wolff R and Abbruzzese JL: Pancreatic cancer. Lancet. 363:1049–1057. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Joergensen MT, Brünner N and DeMuckadell OB: Comparison of circulating MMP-9, TIMP-1 and CA19-9 in the detection of pancreatic cancer. Anticancer Res. 30:587–592. 2010.PubMed/NCBI

4 

Rosty C and Goggins M: Early detection of pancreatic carcinoma. Hematol Oncol Clin North Am. 16:37–52. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Watanabe H, Kawakami H, Yamakawa O, Satomura Y, Ohta H, Motoo Y, Okai T and Sawabu N: Clinical usefulness of tumor markers associated with pancreatic cancer. Rinsho Byori. 42:127–138. 1994.(In Japanese). PubMed/NCBI

6 

Huang C, Wang WM, Gong JP and Yang K: Oncogenesis and the clinical significance of K-ras in pancreatic adenocarcinoma. Asian Pac J Cancer Prev. 14:2699–2701. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Minamoto T: Detection and characterization of oncogene mutations in preneoplastic and early neoplastic lesions. Methods Mol Biol. 1105:381–398. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Dabritz J, Preston R, Hänfler J and Oettle H: Follow-up study of K-ras mutations in the plasma of patients with pancreatic cancer: Correlation with clinical features and carbohydrate antigen 19-9. Pancreas. 38:534–541. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Duffy MJ, Sturgeon C, Lamerz R, Haglund C, Holubec VL, Klapdor R, Nicolini A, Topolcan O and Heinemann V: Tumor markers in pancreatic cancer: A European Group on Tumor Markers (EGTM) status report. Ann Oncol. 21:441–447. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Shin SH, Kim SC, Hong SM, Kim YH, Song KB, Park KM and Lee YJ: Genetic alterations of K-ras, p53, c-erbB-2, and DPC4 in pancreatic ductal adenocarcinoma and their correlation with patient survival. Pancreas. 42:216–222. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Singh N, Gupta S, Pandey RM, Chauhan SS and Saraya A: High levels of cell-free circulating nucleic acids in pancreatic cancer are associated with vascular encasement, metastasis and poor survival. Cancer Invest. 33:78–85. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Fuccio L, Hassan C, Laterza L, Correale L, Pagano N, Bocus P, Fabbri C, Maimone A, Cennamo V, Repici A, et al: The role of K-ras gene mutation analysis in EUS-guided FNA cytology specimens for the differential diagnosis of pancreatic solid masses: A meta-analysis of prospective studies. Gastrointest Endosc. 78:596–608. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Teich N and Mossner J: Molecular analysis of pancreatic juice: A helpful tool to differentiate benign and malignant pancreatic tumors? Dig Dis. 22:235–238. 2004. View Article : Google Scholar : PubMed/NCBI

14 

Däbritz J, Preston R, Hänfler J and Oettle H: Follow-up study of K-ras mutations in the plasma of patients with pancreatic cancer: Correlation with clinical features and carbohydrate antigen 19-9. Pancreas. 38:534–541. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Gu J, Wang D, Huang Y, Lu Y and Peng C: Diagnostic value of combining CA 19-9 and K-ras gene mutation in pancreatic carcinoma: A meta-analysis. Int J Clin Exp Med. 7:3225–3234. 2014.PubMed/NCBI

16 

Loktionov A, O'Neill IK, Silvester KR, Cummings JH, Middleton SJ and Miller R: Quantitation of DNA from exfoliated colonocytes isolated from human stool surface as a novel noninvasive screening test for colorectal cancer. Clin Cancer Res. 4:337–342. 1998.PubMed/NCBI

17 

Klaassen CH, Jeunink MA, Prinsen CF, Ruers TJ, Tan AC, Strobbe LJ and Thunnissen FB: Quantification of human DNA in feces as a diagnostic test for the presence of colorectal cancer. Clin Chem. 49:1185–1187. 2003. View Article : Google Scholar : PubMed/NCBI

18 

Qi L, Wu L, Zheng S, Wang Y, Fu H and Cui D: Cell-penetrating magnetic nanoparticles for highly efficient delivery and intracellular imaging of siRNA. Biomacromolecules. 13:2723–2730. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Qi L and Gao X: Quantum dot-amphipol nanocomplex for intracellular delivery and real-time imaging of siRNA. ACS Nano. 2:1403–1410. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Yuan H, Zhang L and Zhang Y: Preparation of high efficiency and low carry-over immobilized enzymatic reactor with methacrylic acid-silica hybrid monolith as matrix for on-line protein digestion. J Chromatogr A. 1371:48–57. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta DeltaC(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Schnelldorfer T, Ware AL, Sarr MG, Smyrk TC, Zhang L, Qin R, Gullerud RE, Donohue JH, Nagorney DM and Farnell MB: Long-term survival after pancreatoduodenectomy for pancreatic adenocarcinoma: Is cure possible? Ann Surg. 247:456–462. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Benassai G, Mastrorilli M, Quarto G, Cappiello A, Giani U and Mosella G: Survival after pancreaticoduodenectomy for ductal adenocarcinoma of the head of the pancreas. Chir Ital. 52:263–270. 2000.PubMed/NCBI

24 

Haug U, Wente MN, Seiler CM, Jesenofsky R and Brenner H: Stool testing for the early detection of pancreatic cancer: Rationale and current evidence. Expert Rev Mol Diagn. 8:753–759. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Lu X, Xu T, Qian J, Wen X and Wu D: Detecting K-ras and p53 gene mutation from stool and pancreatic juice for diagnosis of early pancreatic cancer. Chin Med J (Engl). 115:1632–1636. 2002.PubMed/NCBI

26 

Wilentz RE, Chung CH, Sturm PD, Musler A, Sohn TA, Offerhaus GJ, Yeo CJ, Hruban RH and Slebos RJ: K-ras mutations in the duodenal fluid of patients with pancreatic carcinoma. Cancer. 82:96–103. 1998. View Article : Google Scholar : PubMed/NCBI

27 

Arvanitakis M, Van Laethem JL, Parma J, De Maertelaer V, Delhaye M and Devière J: Predictive factors for pancreatic cancer in patients with chronic pancreatitis in association with K-ras gene mutation. Endoscopy. 36:535–542. 2004. View Article : Google Scholar : PubMed/NCBI

28 

Pugliese V, Pujic N, Saccomanno S, Gatteschi B, Pera C, Aste H, Ferrara GB and Nicolò G: Pancreatic intraductal sampling during ERCP in patients with chronic pancreatitis and pancreatic cancer: Cytologic studies and k-ras-2 codon 12 molecular analysis in 47 cases. Gastrointest Endosc. 54:595–599. 2001. View Article : Google Scholar : PubMed/NCBI

29 

Ballehaninna UK and Chamberlain RS: Serum CA 19-9 as a biomarker for pancreatic cancer-A comprehensive review. Indian J Surg Oncol. 2:88–100. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang X, Wang J, Chen F, Zhong Z and Qi L: Detection of K‑ras gene mutations in feces by magnetic nanoprobe in patients with pancreatic cancer: A preliminary study. Exp Ther Med 15: 527-531, 2018.
APA
Wang, X., Wang, J., Chen, F., Zhong, Z., & Qi, L. (2018). Detection of K‑ras gene mutations in feces by magnetic nanoprobe in patients with pancreatic cancer: A preliminary study. Experimental and Therapeutic Medicine, 15, 527-531. https://doi.org/10.3892/etm.2017.5368
MLA
Wang, X., Wang, J., Chen, F., Zhong, Z., Qi, L."Detection of K‑ras gene mutations in feces by magnetic nanoprobe in patients with pancreatic cancer: A preliminary study". Experimental and Therapeutic Medicine 15.1 (2018): 527-531.
Chicago
Wang, X., Wang, J., Chen, F., Zhong, Z., Qi, L."Detection of K‑ras gene mutations in feces by magnetic nanoprobe in patients with pancreatic cancer: A preliminary study". Experimental and Therapeutic Medicine 15, no. 1 (2018): 527-531. https://doi.org/10.3892/etm.2017.5368
Copy and paste a formatted citation
x
Spandidos Publications style
Wang X, Wang J, Chen F, Zhong Z and Qi L: Detection of K‑ras gene mutations in feces by magnetic nanoprobe in patients with pancreatic cancer: A preliminary study. Exp Ther Med 15: 527-531, 2018.
APA
Wang, X., Wang, J., Chen, F., Zhong, Z., & Qi, L. (2018). Detection of K‑ras gene mutations in feces by magnetic nanoprobe in patients with pancreatic cancer: A preliminary study. Experimental and Therapeutic Medicine, 15, 527-531. https://doi.org/10.3892/etm.2017.5368
MLA
Wang, X., Wang, J., Chen, F., Zhong, Z., Qi, L."Detection of K‑ras gene mutations in feces by magnetic nanoprobe in patients with pancreatic cancer: A preliminary study". Experimental and Therapeutic Medicine 15.1 (2018): 527-531.
Chicago
Wang, X., Wang, J., Chen, F., Zhong, Z., Qi, L."Detection of K‑ras gene mutations in feces by magnetic nanoprobe in patients with pancreatic cancer: A preliminary study". Experimental and Therapeutic Medicine 15, no. 1 (2018): 527-531. https://doi.org/10.3892/etm.2017.5368
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team