Open Access

Evaluation of circulating placenta‑related long noncoding RNAs as potential biomarkers for preeclampsia

  • Authors:
    • Xin Wang
    • Yanhong Chen
    • Lili Du
    • Xiaomei Li
    • Xiuying Li
    • Dunjin Chen
  • View Affiliations

  • Published online on: March 20, 2018     https://doi.org/10.3892/etm.2018.5968
  • Pages: 4309-4317
  • Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Increasing evidence has indicated that circulating placental RNAs may reflect the pathophysiology of the placenta. In the current study, circulating placenta-related long noncoding RNAs (lncRNAs) were evaluated as potential biomarkers for preeclampsia (PE). Two parts of the case‑control study were simultaneously executed, including the following sets: 52 patients with late‑onset PE (LOPE) (diagnosed after 34 weeks) and 52 gestational age (GA)‑matched controls; 58 patients with early‑onset PE (EOPE) (diagnosed before 34 weeks) and 58 GA‑matched controls. LncRNA expression was detected in the placenta analysis part, and the participants were delivered by caesarean sections. The levels of circulating placenta-associated lncRNAs were measured in the plasma analysis part and all pregnant women were included. Using microarray analysis, 163 differentially expressed lncRNAs were identified in placental samples from patients with LOPE, some of which were also detected in plasma samples from pregnant women. There were significant positive correlations between plasma, and placental expression levels of NONHSAT116812 and NONHSAT145880, which in plasma provided high diagnostic efficiencies for LOPE and EOPE. The present study demonstrated that circulating placenta‑associated lncRNAs, paticularly NONHSAT116812 and NONHSAT145880 have potential as biomarkers for PE.

Introduction

Preeclampsia (PE) is a pregnancy-specific multisystem disorder that contributes substantially to maternal, fetal, and neonatal mortality and morbidity rates worldwide (1). Despite extensive research, causes of PE remain unclear, and removal of the placenta is the only effective cure for the disease (2). Researchers have speculated that placental defects, especially shallow placental implantation, can induce the clinical disease (3,4). Others have suggested that long noncoding RNAs (lncRNAs) in human placenta may play roles in regulating trophoblast cell invasion and inducing PE (5,6).

LncRNAs comprise a diverse class of RNA transcripts that exceed 200 nucleotides in length with limited protein-coding potential, which were believed to have surprisingly complex and diverse functions (7). Misregulation of lncRNAs have been identified to be involved in various disorders such as cancer, cardiovascular disease and PE (8). In addition to their possible role in the biological functions, circulating lncRNAs have been characterized as a new class of potential biomarkers in the diagnosis and prognosis of different types of malignant tumors and for possibly predicting and monitoring treatment response (9,10). Recently, two papers described the differentially expressed lncRNAs in PE placenta using microarray, and revealed that many of these lncRNAs may be involved in the pathological mechanisms of PE (11,12). Therefore, We postulated that placenta-related lncRNAs might be also released into the maternal circulation in pregnancy and could be utilized to detect and monitor PE.

Materials and methods

Participant enrollment

All study participants were pregnant and non-pregnant women of the Department of Obstetrics and Gynecology of the Affiliated Third Hospital of Guangzhou Medical University (Guangzhou, China) between February 2015 and February 2017. This case-control study involved the following sets of cases and controls: late-onset PE (LOPE) patients (diagnosed after 34 weeks, n=52) and gestational age (GA)-matched healthy pregnant women (control group 1, n=52); early-onset PE (EOPE) patients (diagnosed before 34 weeks, n=58) and GA-matched healthy pregnant women who underwent routine outpatient antenatal examination and did not develop hypertension during their pregnancies (control group 2, n=58). Of these, 21 LOPE patients and all EOPE patients received anti-hypertensive drugs and/or magnesium sulfate prior to and following the termination of pregnancy. In addition, 30 healthy never-pregnant women were also recruited in this study. All pregnant women had singleton pregnancies and none of the PE patients had any other maternal complications. PE is defined according to the criteria of the American College of Obstetricians and Gynecologists (1). Demographic and clinical characteristics of all participants are summarized in Table I. This study was approved by the ethics committee of the Third Affiliated Hospital of Guangzhou Medical University. Informed consent was obtained from all individual participants included in the study.

Table I.

Demographic and clinical characteristics of the study groups.

Table I.

Demographic and clinical characteristics of the study groups.

VariableLOPE (n=52)EOPE (n=58)Control group 1 (n=52)Control group 2 (n=58)Non-pregnant (n=30)
Age (years)31.1±5.5   30.9±6.1   30.8±5.7   30.4±4.3   31.0±2.3
Prepregnancy BMI (kg/m2)21.6±2.5   21.7±3.1   21.4±2.3   21.5±2.9   21.5±2.6
Nulliparity n (%)26 (50.0%)30 (51.7%)25 (48.1%)29 (50.0%)30 (100.0%)
SBP (mmHg)   162.8±18.3a   171.1±22.1a119.1±7.2118.8±7.7117.5±6.2
DBP (mmHg)   103.9±13.1a   108±17.4a   78.4±6.7   77.9±6.5   77.8±5.8
24-h urine protein (g)   3.1±2.2   4.9±3.9NDNDND
GA at blood collection (weeks)38.2±2.4   31.9±3.0   38.8±1.6   32.0±1.90
Birth weight (g) 3,090.7±509.1a1,575.2±364.7   3,456.1±474.4ND0

{ label (or @symbol) needed for fn[@id='tfn1-etm-0-0-5968'] } Data are presented as mean ± standard deviation or number (%) and compared by independent samples t-tests for continuous variables or chi-square test for categorical variables. LOPE, late-onset preeclampsia; EOPE, early-onset preeclampsia; BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; GA, gestational age; ND, not determined. Control group 1, LOPE-matched normal pregnant women; Control group 2, EOPE-matched healthy pregnant women who underwent routine outpatient antenatal examination and did not develop hypertension during their pregnancies; Non-pregnant: healthy never-pregnant women.

a P<0.05 vs. control group 1 or 2.

Sample collection and preparation

Peripheral venous blood samples were collected from all of the participants, particularly blood samples from women who had delivered were obtained within 48 h before termination of pregnancy, without spontaneous or nonspontaneous labor. Up to 2.5 ml of blood was drawn from each nonfasting subject into an anticoagulation tube containing K2EDTA. Blood was processed within 30 min of collection. Plasma was collected via a two-step centrifugation protocol of 1,800 g for 10 min at 4°C and 12,000 g for 10 min at 4°C. This process ensured the thorough elimination of peripheral blood cells and platelets. Separated plasma samples were transferred to an RNase/DNase-free tube and stored at −80°C until total RNA extraction. Blood samples with hemolysis were excluded from analysis.

Placental tissues were obtained during elective caesarean sections (C/S) from women who delivered in the absence of labor. Of the 117 placental tissue samples, 40 were from the LOPE group, 35 were from control group 1, and 42 were from the EOPE group. Placental tissue that was about 2 cm away from the attachment site of the umbilical cord in the placenta was randomly dissected within 5 min of delivery, including a full-thickness of placenta. Harvested samples were washed extensively in cold saline immediately after resection and stored in sufficient quantities of RNAlater (AM7020; Ambion, Thermo Fisher Scientific, Inc., Waltham, MA, USA) to protect RNA from degradation. Liquid was removed after 24 h of storage, and placental samples were stored at −80°C until use.

LncRNA microarray analysis

For microarray analysis, 8 randomly and blindly selected placental samples from LOPE patients and matched controls (4 samples per group) were used to extract total RNA. The expression profiles of the placental lncRNAs were detected using the Agilent Human lncRNA Microarray V4.0 (OE Biotech, Shanghai, China). The threshold for a dysregulated lncRNA was set as a fold-change (FC) value of 2.0 or greater. Gene Ontology (GO; ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/gene2go.gz, October 2015) and Kyoto Encyclopedia of Genes and Genomes (KEGG; http://www.genome.jp/kegg/, Release 76.0) analyses were applied to explore the roles of the differentially expressed lncRNAs that exhibited a significance value of P<0.05.

RNA extraction from placenta and plasma

Total RNA was extracted from placenta tissue using Trizol Reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The RNA integrity was evaluated using agarose gel electrophoresis stained with GelRed. For plasma, total RNA was extracted from 800 µl of each sample using the mirVana PARIS kit (1556; Ambion, Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The average recovery volume was 45 µl, and the RNA yield calculated using spectrophotometry was approximately 11.3 ng/µl.

Quantitative polymerase chain reaction (qPCR)

A total of 1 µg or 7 µl of RNA from each placental tissue or plasma was reverse transcribed to cDNA using the PrimeScript™ RT reagent kit with gDNA Eraser (RR047A; Takara Biotechnology Co., Ltd., Dalian, China) in a 20-µl reaction volume. All primers used in this study were designed and synthesized by Shanghai Generay Biotech Co., Ltd. (Shanghai, China), a ccording ddto the sequences obtained from the National Center for Biotechnology Information Database. Then, qPCR was performed on a StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific, Inc.) using SYBR® Premix EX Tag II (RR820A; Takara Biotechnology Co., Ltd.) in a 20-µl reaction volume, and each sample was analyzed in triplicate and the specificity of each PCR reaction was confirmed by melt curve analysis. The qPCR reaction conditions were as follows: A denaturation step at 95°C for 30 sec, followed by 40 PCR cycles at 95°C for 5 sec and 60°C for 30 sec. Relative expression levels of lncRNAs were quantified based on the Cquantification cycle values and normalized to the internal control housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH), which has been shown to be the optimal endogenous control for lncRNA expression in tissues and plasma (10,13). Expression levels were calculated by using the ΔCq method. A smaller ΔCq value indicates higher expression, and relative lncRNA expression was calculated by the 2−ΔΔCq method normalized to GAPDH.

Statistical analyses

All statistical analyses were performed with the Statistical Package for Social Sciences software version 22.0 (SPSS, Inc., Chicago, IL, USA). Comparisons between two subgroups were estimated by using the independent samples t-test or Mann-Whitney U-test for continuous data and Fisher's exact test for categorical data. Comparisons between multiple subgroups were performed by one-way analysis of variance (ANOVA). Spearman's rank analysis was used for correlation analysis. All reported P-values are two-sided, and P<0.05 was considered to indicate a statistically significant difference.

Results

Microarray analysis and functional prediction

We identified 163 lncRNAs that were differentially expressed between LOPE placentas and healthy controls, with 38 up- and 125 downregulated lncRNAs. NONHSAT084322 (CUST_4347_PI429545410) was the most upregulated (FC=9.202518) and NONHSAT028367 (CUST_33686_PI429545402) was the most downregulated lncRNA (FC=16.553854). The lncRNA microarray expression results have been uploaded to NCBI Gene Expression Omnibus (GEO) and are accessible with the GEO series accession number GSE97898 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE97898).

Using the same criteria as the lncRNAs, we found 14 upregulated and 67 downregulated mRNA transcripts. The most upregulated and downregulated mRNA transcripts were GSTT1 (A_23_P254944) and KRT6A (A_33_P3292886), with FCs of 9.89536 and 22.835077, respectively. Hierarchical clustering of the expression of those lncRNAs and mRNAs based on centered Pearson correlation clearly separated LOPE from normal tissues (Fig. 1). Differentially expressed lncRNAs were clustered into hundreds of GO and KEGG pathway annotations. According to enrichment counting, the significantly enriched GO terms corresponded to biological processes, involving musculoskeletal movement, immune responses, and metabolic processes, and the most enriched KEGG pathways included oxidative phosphorylation and metabolic pathways (Fig. 2).

Confirmation of lncRNAs by qPCR

For practical purposes, to validate the microarray results and to increase the detection probability of plasma lncRNAs, we first selected differentially expressed lncRNAs that have high normalized probe signal values on the array platform, and then subjected to qPCR validation in placental tissues from the LOPE patients (n=40) and controls (n=35) delivered by caesarean section. Demographic and clinical characteristics of all of the pregnant women are summarized in Table II. Finally, 9 highest expressed lncRNAs in placental tissues were selected as candidate targets for subsequent circulating lncRNA assay, and their primers used are shown in Table III. The qPCR results showed the same tendencies (upregulation or downregulation) as the microarray data (Fig. 3).

Table II.

Demographic and clinical characteristics of LOPE patients and controls delivered by caesarean section.

Table II.

Demographic and clinical characteristics of LOPE patients and controls delivered by caesarean section.

VariableLOPE (n=40)Control (n=35)P-value
Age (years)31.0±5.8   30.9±5.70.757
Prepregnancy BMI (kg/m2)21.5±2.9   21.3±2.40.533
Nulliparity n (%)21 (52.5%)18 (51.4%)0.425
SBP (mmHg)163.2±18.4120.1±7.8<0.001
DBP (mmHg)103.8±13.7   79.3±6.5<0.001
24-h urine protein (g)   3.3±2.4ND<0.001
Gestational age at delivery (weeks)38.3±2.3   38.9±1.30.086
Birth weight (g)   3,068±625.7   3,422±437.6<0.001

[i] Data are presented as mean ± standard deviation or numbers (%), and compared by independent samples t-tests for continuous variables or chi-square test for categorical variable. LOPE, late-onset preeclampsia; BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; ND, not determined.

Table III.

The nine lncRNAs and their primers used in this study.

Table III.

The nine lncRNAs and their primers used in this study.

Target IDFC(abs)Primer sequnce (5′ to 3′)Product (bp)
NONHSAT1458802.5↑Forward TGTCAAGAAATACCCTGAGCC165
Reverse AGCCTGGGCGACAAAGTGA
ENST000005872402.2↑Forward TTTACCCCTCAACATACACC144
Reverse TACGGCTTCCAACAATGA
NONHSAT1168122.6↓Forward GAGGCGGATGGCTGTGAC87
Reverse CCCTTGGGGCCTGAGTAG
NONHSAT1045362.6↓Forward CTTGGGTTCAAGGCTTTGTT143
Reverse TCTCCTCTGCACTGGCTGTT
FR3396002.5↓Forward GCAGAGCCAACATACACC59
Reverse AGGCAAGGCACATACAAA
NONHSAG0189072.1↓Forward ACCTGAAAAGTGGAAATGATAG96
Reverse AGTAAGAGCAGCAACACACA
TCONS_l2_000147822.1↓Forward CCTCCTGACAGCCCCATTA184
Reverse GAGGCATCACCCAGTTGTTT
NONHSAT1344322.0↓Forward AGTGGAGAGGGTGAGGAG146
Reverse GGAGGAAGGAACAGAGGA
NONHSAG0243182.0↓Forward GGGTGCAGTTAGGTCACCCT113
Reverse CAGCACAAATTCCTCCGTCT
GAPDHNDForward AAGAAGGTGGTGAAGCAGG144
Reverse GTCAAAGGTGGAGGAGTGG

[i] FC(abs), fold-change(absolute); ND, not determined; ↑, upregulation; ↓, downregulation.

Presence of placental lncRNAs in human plasma

To explore whether the nine placenta-related lncRNAs were present at detectable levels in maternal plasma, we used qPCR to examine lncRNA expression levels in plasma samples from the LOPE group and control group 1 (52 samples per group, 104 samples total) and from the EOPE group and control group 2 (58 samples per group, 116 samples total). As shown in Fig. 4, the expression level of NONHSAT116812 and NONHSAT145880 was significantly lower or higher in PE patients than in healthy controls with a 100% detection rate, respectively. The other seven lncRNAs had detection rates below 30% in both PE plasma samples and healthy controls and, therefore, were excluded from subsequent analyses. To verify that these two lncRNAs were present in plasma samples which were obtained from PE patients and healthy controls, the qPCR products (165 bp of NONHSAT145880 and 87 bp of NONHSAT116812) were followed by Sanger sequencing with the primers used for qPCR, using BigDye™ Terminator v3.1 Cycle Sequencing kit (Applied Biosystems: 4337455) by Guangzhou Ige Biotech Co., Ltd. (Guangzhou, China). As expected, their sequences were identical to those derived from NONHSAT116812 (http://noncode.org/show_rna.php?id=NONHSAT116812) and NONHSAT145880 (http://noncode.org/show_rna.php?id=NONHSAT145880) (Fig. 5). However, these two lncRNAs were also detected in plasma samples from non-pregnant individuals at a rate of 100%, whereas other lncRNAs were not detectable. Therefore, we compared expression levels of NONHSAT116812 and NONHSAT145880 in plasma samples from pregnant women (n=52 from the LOPE group, n=52 from control group 1, n=58 from the EOPE group, and n=58 from control group 2) and non-pregnant women (n=30) by measuring the ΔCt value in the plasma. As expected, we found significantly larger ΔCt values of these two lncRNAs in never-pregnant women than in pregnant women, and significantly smaller ΔCt values in PE patients than in healthy pregnant women (Table IV).

Table IV.

Comparison of plasma ΔCq value in each group.

Table IV.

Comparison of plasma ΔCq value in each group.

LncRNALOPE (n=52)EOPE (n=58)Control group 1 (n=52)Control group 2 (n=58)Non-pregnant (n=30)
NONHSAT116812 5.308±1.509a 5.419±1.736a4.295±1.2104.336±1.427 7.319±1.385b
NONHSAT145880 5.131±1.308a 5.071±1.565a5.993±1.4506.018±1.6037.208 ±1.267b

{ label (or @symbol) needed for fn[@id='tfn5-etm-0-0-5968'] } Data are presented as mean±standard deviation and compared by independent samples t-tests for continuous variables. LOPE, late-onset preeclampsia; EOPE, early-onset preeclampsia. Control group 1, LOPE-matched normal pregnant women; Control group 2, EOPE -matched healthy pregnant women who underwent routine outpatient antenatal examination and did not develop hypertension during their pregnancies; Non-pregnant: healthy never-pregnant women.

a P<0.05 vs. control group 1 or 2

b P<0.05 vs. LOPE or EOPE or control group 1 or 2.

Correlation of lncRNA levels between plasma and placenta

To determine whether expression levels of lncRNAs in plasma and placentas were related, we compared expression levels of NONHSAT116812 and NONHSAT145880 in paired plasma and placental samples from 117 pregnant women delivered by C/S (n=42 from EOPE group, n=40 from LOPE group, and n=35 from control group 1). The data showed that plasma and placental measurements were strongly correlated for NONHSAT116812 (r=0.841, P<0.001) and NONHSAT145880 (r=0.739, P<0.001) (Fig. 6).

Evaluation of plasma lncRNAs as biomarkers for detecting PE

We evaluated the ability of these two placenta-related lncRNAs to be used as plasma biomarkers for PE. Receiver operating characteristic (ROC) curves and areas under the ROC curves (AUCs) were obtained from the data of all pregnant women. Strong separation was found between ROC curves from the LOPE patients (n=52) and the healthy controls (n=52). NONHSAT116812 showed an AUC of 0.828 (95% CI: 0.750–0.907, P<0.001), sensitivity of 86.5%, and specificity of 63.5%. NONHSAT145880 showed an AUC of 0.815 (95% CI: 0.734–0.896, P<0.001), sensitivity of 82.7%, and specificity of 67.3%. ROC curves also discriminated the EOPE patients (n=58) from the healthy controls (n=58), with an AUC of 0.864 (95% CI: 0.797–0.930, P<0.001), 72.4% sensitivity, and 91.4% specificity for NONHSAT116812, and with an AUC of 0.859 (95% CI: 0.792–0.925, P<0.001), 79.3% sensitivity, and 75.9% specificity for NONHSAT145880 (Fig. 7).

Discussion

PE is a serious disease that cannot be cured except removal of the placenta. Early identification of women at high risk of developing PE would enable surveillance and intervention, with the potential for drastically improving pregnancy outcomes. To date, although numerous protein biomarkers of placental origin have been strongly associated with PE, these lack adequate accuracy to be used clinically (14,15). The circulating placental RNAs biomarkers have obvious advantage over protein biomarkers, changes of which in gene expression might be detectable before changes in protein levels occur and reflect alterations in placental function (16). However, little is known about the value of circulating placenta-related lncRNAs as potential biomarkers for PE.

In this study, we first selected LOPE placental tissues and healthy controls for lncRNA microarray analysis and a total of 163 differentially expressed lncRNAs (FC ≥2.0) were identified. The results are consistent with a previous study that described the expression patterns of 738 differentially expressed lncRNAs (FC ≥1.5) in placentas from patients with LOPE (11). However, a recent study evaluated the differential expression of lncRNAs in placental samples from EOPE patients and preterm controls and identified 28,824 dysregulated lncRNAs (FC ≥2.0) (12). The distinct expression profiles of lncRNAs may be because EOPE is more serious than LOPE and placental defects are more prevalent (17,18). However, these studies have shown that aberrantly expressed lncRNAs in placenta may function in the pathogenesis and development of PE.

Further, 9 highest expressed lncRNAs in placental tissues were evaluated by qPCR to measure their expression levels in plasma. We found that the expression levels of NONHSAT116812 and NONHSAT145880 were significantly lower or higher in plasma from LOPE patients compared to healthy controls with a 100% detection rate, and the trends were consistent with the results in placental samples. Interestingly, the expression levels of the two lncRNAs in plasma from EOPE patients have the same trends with those of LOPE patients. However, our results are inconsistent with a previous study that revealed higher expression levels of circulating placental RNAs in EOPE compared with LOPE (19). This inconsistencies may be due to the existence of a wide range of heterogeneity between the studied populations, with samples collected across various gestations and processing procedures (20).

In addition, the expression levels of these two lncRNAs in placenta and plasma from the same individual correlated strongly. While other lncRNAs were also detectable in plasma, the detection rates were less than 30% in plasma samples from PE patients and corresponding controls. Moreover, to explore whether the nine lncRNAs were specific to pregnancy, we measured their expression levels in plasma samples from non-pregnant women and the results showed thatNONHSAT116812 and NONHSAT145880 were detectable with a detection rate of 100%, but their expression levels were significantly lower than those in pregnant women, and the other lncRNAs were not detectable in non-pregnant women. Therefore, We hypothesized that these two lncRNAs are expressed not only in the placenta but also in other tissues of the body and, for the first time, NONHSAT116812 was detected in the placenta (http://noncode.org/show_rna.php?id=NONHSAT145880; http://noncode.org/show_rna.php?id=NONHSAT116812). To futher verify that these two lncRNAs were present in plasma, the qPCR products were validated by a traditional Sanger-based method. As expected, their sequences were identical to those derived from NONHSAT145880 and NONHSAT116812. Taken together, these data provided strong evidence that placenta-related lncRNAs could be released into the circulation and their different expression patterns in plasma could be utilized as biomarkers for detecting and monitoring PE. Recently, several studies have suggested that cell-free lncRNAs are detectable in human plasma and serum and may be utilized as minimally invasive biomarkers for disease prediction, diagnosis, and prognosis (2123). Although the precise mechanism of lncRNA release into the extracellular environment is not completely understood, recent studies have shown that circulating lncRNAs are packaged into microparticles or other secondary structures that are protected from endogenous RNases (24,25).

Finally, the diagnostic power of the two circulating placenta-related lncRNAs was evaluated for PE. ROC curves illustrated a strong separation between PE patients and corresponding controls indicating that NONHSAT116812 and NONHSAT145880 have high diagnostic power for the detection of LOPE and EOPE. Thus, these two lncRNAs could be worthy of further research when seeking novel biomarkers for predicting and monitoring onset of PE. However, our study has some limitations, such as a modest sample size, use of a qPCR method with relatively low-sensitivity, and lack of an in-depth functional investigation of placenta-related lncRNAs. Therefore, prospective cohort studies are required to determine whether these findings are the consequence or cause of PE, and to determine the clinical applicability of using these molecules as the early markers of PE.

In conclusion, aberrantly expressed placenta-related lncRNAs might play a key or partial role in the pathogenesis of PE. More importantly, differentially expressed lncRNAs can be released into the maternal circulation, particularly NONHSAT116812 and NONHSAT145880 had high diagnostic power for PE. Further research is required to measure circulating placenta-related lncRNAs as potential tools for PE prediction and management.

Acknowledgements

We gratefully thank Professor Bolan Yu and Dr Hao Yan for providing statistical support and conducting the experiments. We appreciate all of the nurses who collected blood samples. We thank the staff in the medical records room for supplying case information and the biobank of the Third Affiliated Hospital of Guangzhou Medical University for sample support. This study was supported by the National Natural Science Foundation (no. 81671533) and National Key R&D Program of China (no. 2017YFC1001402).

References

1 

American College of Obstetricians and Gynecologists; Task Force on Hypertension in Pregnancy: Hypertension in pregnancy. Report of the American college of obstetricians and Gynecologists' task force on hypertension in pregnancy. Obstet Gynecol. 122:1122–1131. 2013.PubMed/NCBI

2 

Baumann MU, Bersinger NA, Mohaupt MG, Raio L, Gerber S and Surbek DV: First-trimester serum levels of soluble endoglin and soluble fms-like tyrosine kinase-1 as first-trimester markers for late-onset preeclampsia. Am J Obstet Gynecol. 199:266.e1–6. 2008. View Article : Google Scholar

3 

Fu G, Ye G, Nadeem L, Ji L, Manchanda T, Wang Y, Zhao Y, Qiao J, Wang YL, Lye S, et al: MicroRNA-376c impairs transforming growth factor-β and nodal signaling to promote trophoblast cell proliferation and invasion. Hypertension. 61:864–872. 2013. View Article : Google Scholar : PubMed/NCBI

4 

He G, Xu W, Chen Y, Liu X and Xi M: Abhealthy apoptosis of trophoblastic cells is related to the up-regulation of CYP11A gene in placenta of preeclampsia patients. PLoS One. 8:e596092013. View Article : Google Scholar : PubMed/NCBI

5 

Zhang Y, Zou Y, Wang W, Zuo Q, Jiang Z, Sun M, De W and Sun L: Down-regulated long non-coding RNA MEG3 and its effect on promoting apoptosis and suppressing migration of trophoblast cells. J Cell Biochem. 116:542–550. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Chen H, Meng T, Liu X, Sun M, Tong C, Liu J, Wang H and Du J: Long non-coding RNA MALAT-1 is downregulated in preeclampsia and regulates proliferation, apoptosis, migration and invasion of JEG-3 trophoblast cells. Int J Clin Exp Pathol. 8:12718–12727. 2015.PubMed/NCBI

7 

Nagano T and Fraser P: No-nonsense functions for long noncoding RNAs. Cell. 145:178–181. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Schmitz SU, Grote P and Herrmann BG: Mechanisms of long noncoding RNA function in development and disease. Cell Mol Life Sci. 73:2491–2509. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Arita T, Ichikawa D, Konishi H, Komatsu S, Shiozaki A, Shoda K, Kawaguchi T, Hirajima S, Nagata H, Kubota T, et al: Circulating long non-coding RNAs in plasma of patients with gastric cancer. Anticancer Res. 33:3185–3193. 2013.PubMed/NCBI

10 

Tong YS, Wang XW, Zhou XL, Liu ZH, Yang TX, Shi WH, Xie HW, Lv J, Wu QQ and Cao XF: Identification of the long non-coding RNA POU3F3 in plasma as a novel biomarker for diagnosis of esophageal squamous cell carcinoma. Mol Cancer. 14:32015. View Article : Google Scholar : PubMed/NCBI

11 

He X, He Y, Xi B, Zheng J, Zeng X, Cai Q, Ouyang Y, Wang C, Zhou X, Huang H, et al: LncRNAs expression in preeclampsia placenta reveals the potential role of LncRNAs contributing to preeclampsia pathogenesis. PLoS One. 8:e814372013. View Article : Google Scholar : PubMed/NCBI

12 

Long W, Rui C, Song X, Dai X, Xue X, Lu Y, Shen R, Li J, Li J and Ding H: Distinct expression profiles of lncRNAs between early-onset preeclampsia and preterm controls. Clin Chim Acta. 463:193–199. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Yang Z, Guo X, Li G, Shi Y and Li L: Long noncoding RNAs as potential biomarkers in gastric cancer: Opportunities and challenges. Cancer Lett. 371:62–70. 2016. View Article : Google Scholar : PubMed/NCBI

14 

Wu P, van den Berg C, Alfirevic Z, O'Brien S, Röthlisberger M, Baker PN, Kenny LC, Kublickiene K and Duvekot JJ: Early pregnancy biomarkers in Pre-eclampsia: A systematic review and meta-analysis. Int J Mol Sci. 16:23035–23056. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Kleinrouweler CE, Cheong-See FM, Collins GS, Kwee A, Thangaratinam S, Khan KS, Mol BW, Pajkrt E, Moons KG and Schuit E: Prognostic models in obstetrics: Available, but far from applicable. Am J Obstet Gynecol. 214(79–90): e362016.

16 

Tsui NB, Jiang P, Wong YF, Leung TY, Chan KC, Chiu RW, Sun H and Lo YM: Maternal plasma RNA sequencing for genome-wide transcriptomic profiling and identification of pregnancy-associated transcripts. Clin Chem. 60:954–962. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Ogge G, Chaiworapongsa T, Romero R, Hussein Y, Kusanovic JP, Yeo L, Kim CJ and Hassan SS: Placental lesions associated with maternal underperfusion are more frequent in early-onset than in late-onset preeclampsia. J Perinat Med. 39:641–652. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Raymond D and Peterson E: A critical review of early-onset and late-onset preeclampsia. Obstet Gynecol Surv. 66:497–506. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Kodama M, Miyoshi H, Fujito N, Samura O and Kudo Y: Plasma mRNA concentrations of placenta-specific 1 (PLAC1) and pregnancy associated plasma protein A (PAPP-A) are higher in early-onset than late-onset pre-eclampsia. J Obstet Gynaecol Res. 37:313–318. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Farina A: The Role of RNAs and microRNAs in non-invasive prenatal diagnosis. J Clin Med. 3:440–452. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Amorim M, Salta S, Henrique R and Jerónimo C: Decoding the usefulness of non-coding RNAs as breast cancer markers. J Transl Med. 14:2652016. View Article : Google Scholar : PubMed/NCBI

22 

Wang J, Sun J, Wang J, Song Y, Gao P, Shi J, Chen P and Wang Z: Long nonconding RNAs in gastric cancer: Functions and clinical applications. Onco Targets Ther. 9:681–697. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Chauhan R and Lahiri N: Tissue- and serum-associated biomarkers of hepatocellular carcinoma. Biomark Cancer. 8 Suppl 1:S37–S55. 2016.

24 

Redman CW, Tannetta DS, Dragovic RA, Gardiner C, Southcombe JH, Collett GP and Sargent IL: Review: Does size matter? Placental debris and the pathophysiology of pre-eclampsia. Placenta. 33 Suppl:S48–S54. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Li Q, Shao Y, Zhang X, Zheng T, Miao M, Qin L, Wang B, Ye G, Xiao B and Guo J: Plasma long noncoding RNA protected by exosomes as a potential stable biomarker for gastric cancer. Tumour Biol. 36:2007–2012. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

May-2018
Volume 15 Issue 5

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Wang X, Chen Y, Du L, Li X, Li X and Chen D: Evaluation of circulating placenta‑related long noncoding RNAs as potential biomarkers for preeclampsia. Exp Ther Med 15: 4309-4317, 2018
APA
Wang, X., Chen, Y., Du, L., Li, X., Li, X., & Chen, D. (2018). Evaluation of circulating placenta‑related long noncoding RNAs as potential biomarkers for preeclampsia. Experimental and Therapeutic Medicine, 15, 4309-4317. https://doi.org/10.3892/etm.2018.5968
MLA
Wang, X., Chen, Y., Du, L., Li, X., Li, X., Chen, D."Evaluation of circulating placenta‑related long noncoding RNAs as potential biomarkers for preeclampsia". Experimental and Therapeutic Medicine 15.5 (2018): 4309-4317.
Chicago
Wang, X., Chen, Y., Du, L., Li, X., Li, X., Chen, D."Evaluation of circulating placenta‑related long noncoding RNAs as potential biomarkers for preeclampsia". Experimental and Therapeutic Medicine 15, no. 5 (2018): 4309-4317. https://doi.org/10.3892/etm.2018.5968