International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Humeral fractures are common and account for 5% of total body fractures (1). Of the total cases of humeral fractures, ~80% are non-displaced or slightly displaced stable fractures that do not require surgical treatment (2). Displaced unstable proximal humeral fractures are usually treated surgically (3). Heterotopic ossification refers to the occurrence of ossification outside the bone tissue, and surgery-complicated or secondary heterotopic ossification is clinically known as traumatic ossifying myositis (4).
Currently, more than a dozen bone morphogenetic proteins (BMPs) have been identified (5,6). BMP-2 was originally recognized as an inducer of bone formation belonging to the transforming growth factor-β family (7), and it serves an important role in bone formation (8,9) and fracture healing (10). BMP-2 also has an important role in the ossification process, as it stimulates the differentiation of pluripotent stem cells into osteoblasts and enhances the function of osteoblasts (6,11,12). There are various ways to regulate the expression of BMP-2, in which microRNA (miRNA) have been extensively studied. For example, miR-98 (13), miR-203 and miR-320 (14) have been reported to regulate the expression of BMP-2.
MiRNAs are a class of small RNA molecules 18–22 nt in length. They regulate mRNA translation through specific binding to the 3′-untranslated region (UTR) of the target mRNA and are important post-transcriptional regulators (15). Previous studies have confirmed that miRNA serve important roles in various diseases, including cancer, cardiovascular and endocrine disease (16,17). MiR-421 is cell-growth associated and was discovered in recent years (18). It serves an important role in proliferation, invasion and metastasis of multiple tumors (18,19).
In the present study, the expression levels of BMP-2 in bone tissues and blood of patients with humeral fractures at different periods and patients with/without heterotopic ossification following humeral fractures were detected. Bioinformatics analysis was performed to identify miRNA sequences that may regulate BMP-2. To the best of our knowledge, this is the first report to discuss the regulatory effect of miR-421 on BMP-2.
In order to investigate the role of BMP-2 and miR-421 in bone fracture, 38 patients who received humeral fracture surgery at the Weifang People's Hospital (Weifang, China) between June 2013 and January 2017 were enrolled in the present study. Among them, 16 patients (5 male and 11 female patients) received surgery within 1–7 days of fracture. Their age range was 60–72 years. There were 22 patients who received the surgery within 8–14 days of fracture, including 9 males and 13 females. Their ages ranged from 61–73 years. Reconstructive and fixation surgery was performed according to the fracture site, and complications, including swelling, dislocation and congestion, were treated with respective drugs (Table I). To investigate the role of BMP-2 and miR-421 in the heterotopic ossification process, 18 patients who were diagnosed with heterotopic ossification in the post-surgical follow-up (14–16 months) and required surgery were also enrolled. Among them, there were 5 males and 13 females. Their age ranged from 60–71 years. Presurgical treatment for these patients was the same as in previous treatments of patients with humeral fractures. Another 26 patients with humeral fractures without heterotopic ossification who had received surgery to remove intramedullary nails due to good healing conditions during the same time period were also included. Among them, there were 10 males and 16 females. Their age range was 60–73 years old. These patients were treated as aforementioned (Table II). Patients with rheumatoid arthritis and long-term hormone treatment were excluded from the present study. Bone tissues and blood were collected from all patients. All of the above patients were clearly diagnosed with humeral fractures or heterotopic ossification by pathology analysis. Prior written informed consent was obtained from all patients and the present study was approved by the ethics review board of Weifang People's Hospital.
Fracture site bone tissues and heterotopic ossification bone tissues were obtained from surgery. The non-heterotopic ossification bone tissues were obtained from the fracture tissues of the fixed plate when it was removed. The bone tissues were immediately stored in liquid nitrogen (−196°C) and ground into powder for further use. Peripheral blood (30 ml) was collected from the patients following fasting on the day of surgery. Serum was isolated from peripheral blood by centrifugation (200 × g, 4°C, 10 min).
miRcute miRNA isolation kit, miRcute miRNA first-strand cDNA synthesis kit, miRNA miRcute fluorescent quantitative detection kit (FP401), SuperReal PreMix (SYBR Green) and miRNA first-strand cDNA synthesis kit were all purchased from Tiangen Biotech Co., Ltd., (Beijing, China). Rabbit anti-human BMP-2 primary antibody (ab14933), β-actin primary antibody (ab8227), horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (ab6721) and enhanced chemiluminescence (ECL) liquid (ab65623) were all purchased from Abcam (Cambridge, MA, USA). TRIzol agent (10606ES60) was purchased from Yisheng Biological Co., Ltd., (Shanghai, China). A bicinchoninic acid assay (BCA) kit (RTP7102) was purchased from Real-Times Beijing Biotechnology Co., Ltd., (Beijing, China). An miRNeasy Serum/Plasma kit (JL217184) was purchased from Guangzhou Jianlun Biological Technology Co., Ltd., (Guangzhou, China). A Human BMP-2 ELISA kit (ab119581) was purchased from Abcam. Image Lab software (v. 3.0) was free from Bio-Rad Laboratories, Inc., (Hercules, CA, US). All plasmids/agomiR were synthesized by Sangon Biotech Co., Ltd., (Shanghai, China). The pMIR-REPORT™ miRNA Expression Reporter Vector System (AM5795) was purchased from Ambion (Thermo Fisher Scientific, Inc., Waltham, MA, USA).
Total RNA was extracted from the tissues or blood samples using TRIzol reagent. The integrity of RNA bands was examined by 1% agarose gel electrophoresis, and the RNA purity was measured by a 260/280 ratio using a spectrophotometer. Following this, RNA was reverse transcribed into cDNA using a miRNA first-strand cDNA synthesis kit. The qPCR reaction solution consisted of 10 µl SuperReal PreMix Plus (SYBR-Green), 0.5 µl upstream primers, 0.5 µl downstream primers, 2 µl cDNA and 7 µl ddH2O. The following primer sequences were used: BMP-2 forward, 5′-CCTATATGCTCGACCTGTAC-3′ and reverse, 5′-CCCACTCATTTCTGAAAGTTC-3′; and GAPDH forward, 5′-GCACAGTCAAGGCTGAGAAT-3′ and reverse, 5′-TGAAGACGCCAGTAGACTCC-3′. The qPCR reaction conditions for BMP-2 were as follows: Pre-denaturation at 95°C for 30 sec, followed by 39 cycles of 5 sec at 95°C and 20 sec at 60°C. miRNAs were extracted using a miRcute miRNA isolation kit and reverse transcribed with miRcute miRNA first-strand cDNA synthesis kit. For the measurement of miR-421, qPCR was performed using a miRNA miRcute fluorescent quantitative detection kit and the primers listed in Table III. The reaction conditions were as follows: Pre-denaturation at 95°C for 5 min, followed by 40 cycles of 15 sec at 95°C, 15 sec at 60°C and 10 sec at 72°C. GAPDH and U6 were used as internal controls. The results were calculated using the 2−ΔΔCq method (20).
Total proteins were extracted from the bone tissues and heterotopic ossification tissues using an E.Z.N.A®Total DNA/RNA/Protein kit (Omega Bio-Tek, Inc., Norcross, GA, USA) and the protein concentrations were determined using a BCA protein assay kit. Following this, proteins (50 µg) were separated by 10% SDS-PAGE and transferred to a polyvinylidene difluoride membrane. The membrane was blocked with 5% skim milk at room temperature for 1 h. Subsequently, rabbit anti-human BMP-2 primary antibody (1:1,000) and anti-β-actin primary antibody (1:5,000) were added and incubated at 4°C overnight. Following washing with TBST, the secondary antibody (1:3,000) was added and incubated at room temperature for 1 h. The membrane was developed with ECL solution. Image Lab v. 3.0 software was used to analyze the protein bands. The ratio of the gray value of the target protein band to that of the β-actin band was determined as the relative content of the target protein.
ELISA was conducted with a Human BMP-2 ELISA kit, according to the manufacturer's protocol. Briefly, 10 µl serum and 40 µl diluent were added. Except for the blank wells, 100 µl horseradish peroxidase-labeled antibody was added to the wells. The plate was sealed with film and incubated at 37°C for 1 h. Following five washes with the provided washing reagent, 50 µl of substrate A and B were added to each well and incubated at 37°C for 15 min. Then, 50 µl termination solution was added to each well, and the optical density value at 450 nm was measured within 15 min.
The target gene prediction software of DIANAmT (Ensemble v84; diana.imis.athena-innovation.gr/DianaTools/index.php?r=mrmicrot/index) (21), miRanda (last modified, August 2010; http://34.236.212.39/microrna/home.do) (22), miRDB (last modified, May 2016; mirdb.org/) (23), miRWalk (v2.0; zmf.umm.uni-heidelberg.de/apps/zmf/mirwalk/index.html) (24), RNAhybrid (last modified, September 2017; bibiserv.techfak.uni-bielefeld.de/rnahybrid/) (25), PICTAR4 and PICTAR5 (v4.5; pictar.mdc-berlin.de/) (26), PITA (v6; genie.weizmann.ac.il/pubs/mir07/mir07_data.html) (27), RNA22 (v2.0; cm.jefferson.edu/rna22/) (28) and TargetScan (v6.2; targetscan.org) (29) were used to predict the upstream regulatory miRNA of BMP-2.
The mutant binding sequence was designed as described previously by Guo et al (30). The wild-type and mutant seed regions of the 3′-UTR of the BMP-2 gene containing the miR-421 binding site were chemically synthesized in vitro. Following the addition of the cleavage sites of SpeI and HindIII at both ends, they were cloned into the pMIR-REPORT luciferase reporter plasmid. The mutated 3′-UTR seed region was used as a control. The seed region sequence for the double luciferase reporter plasmid was constructed as follows: 5′-TAATCAAAAGAAGTATCGGGTTTGTACATAATTTTCCAAAAATTGTAGTTGTTTTCAGTTGTGTGTATTTAAGATGAAAAGTCTACATGGAAGGTTACTCTGGCAAAGTGCTTAGCACGTTTGCTTTTTTGCAGTGCTACTGTTGAGTTCACAAGTTCAAGTCCAGAAAAAAAAAGTGGATAATCCACTCTGCTGACTTTCAAGATTATTATATTATTCAATTCTCAGGAATGTTGCAGAGTGATTGTCC-3′. The bold letters represent the target region, and the mutant sequence was GACAACT in the experiments. The plasmid containing the wild-type or mutant 3′-UTR sequences were transfected into 293T cells (Type Culture Collection of the Chinese Academy of Sciences, Shanghai, China) using liposomes (Lipofectamine® 3000; Thermo Fisher Scientific Inc.) and then the agomiR-421-containing plasmid was transfected (100 nM) into the cells. After 24 h of incubation at 37°C, each group of cells was lysed according to the manufacturer's instruction of the Dual-Luciferase Reporter Assay system (Promega Corporation, Fitchburg, WI, USA). The luciferase reporter activity was recorded by a GloMax 20/20 luminometer (Promega Corporation), using Renilla luciferase activity as the internal standard.
All experiments were performed in triplicate independently. All reported data were processed by SPSS 18.0 (SPSS, Inc., Chicago, IL, USA), and the data was presented as the mean ± standard deviation. Normality tests were performed for the data. Student's t-tests were used for the comparison between two groups. Multiple groups of measurement data were analyzed by one-way analysis of variance. If the variance was homogeneous, the least significant differences and Student-Newman-Keuls post hoc methods were used; if the variance was heterogeneous, Tamhane's T2 or Dunnett's T3 post hoc methods were used. P<0.05 was considered to indicate a statistically significant difference.
To determine the changes of BMP-2 mRNA expression in each sample, RT-qPCR was performed. Compared with the patients who received surgery 1–7 days after fracture, the patients who accepted surgery 8–14 days after fracture demonstrated significantly increased BMP-2 mRNA expression levels in their bone tissues (P<0.05) and blood (P<0.01) (Fig. 1A). The different levels of BMP-2 mRNA expression suggests that BMP-2 is upregulated over time within the two weeks after humeral fracture, which may serve a particular regulatory role in humeral fractures.
To determine the expression of BMP-2 protein in the bone tissue of humeral fractures, western blotting was performed. The patients who accepted surgery 8–14 days after fracture had significantly upregulated BMP-2 protein levels in their bone tissues compared to those observed in patients who received surgery 1–7 days after fracture (P<0.01) (Fig. 1B).
To determine the expression of BMP-2 protein in the serum of patients with humeral fractures, ELISA was performed. Compared with the patients who received surgery 1–7 days after fracture, the patients who accepted surgery 8–14 days after fracture had significantly elevated BMP-2 protein levels in their serum (P<0.01) (Fig. 1C), which was consistent with the upregulation trend of mRNA expression. The upregulated BMP-2 protein expression level in the blood may indicate that BMP-2 is released from the injured bone tissues.
To determine the changes of miR-421 expression in each sample, RT-qPCR was performed. The patients who accepted surgery 8–14 days after fracture had significantly decreased miR-421 expression levels in their bone tissue samples (P<0.01) and blood samples (P<0.05) compared to those in the patients who received surgery 1–7 days after fracture (Fig. 2). This result suggests that miR-421 may serve a regulatory role in the recovery of the humeral fracture.
To determine the BMP-2 mRNA level in each sample, RT-qPCR was performed. Compared with the patients without heterotopic ossification, the patients with heterotopic ossification demonstrated significantly upregulated BMP-2 mRNA expression levels in their bone tissues and blood (P<0.01) (Fig. 3A). This suggests that BMP-2 is upregulated in heterotopic tissues following humeral fracture, and may serve a particular regulatory role in the disease.
To determine the expression of BMP-2 protein expression in heterotopic ossification bone tissue following humeral fracture, western blotting was performed. Patients with heterotopic ossification demonstrated significantly upregulated BMP-2 protein expression levels in their bone tissues, compared with those observed in patients without heterotopic ossification (P<0.05) (Fig. 3B), which was consistent with the upregulation trend of mRNA.
To determine the expression level of BMP-2 protein in the serum of patients with heterotopic ossification, ELISA was performed. As demonstrated in Fig. 3C, compared with patients that did not have heterotopic ossification, the BMP-2 protein levels were significantly higher in the serum of the patients with heterotopic ossification (P<0.05). These results suggest that BMP-2 may serve a regulatory role in the recovery of heterotopic ossification at the transcription and protein function levels.
To determine the expression of miR-421, RT-qPCR was utilized. As indicated in Fig. 4, the patients with heterotopic ossification demonstrated significantly downregulated miR-421 expression levels in their bone tissue samples (P<0.01) and blood (P<0.05) compared with those in the patients without heterotopic ossification. This result indicates that miR-421 may serve a regulatory role in the heterotopic ossification process.
To identify miRNA sequences that may target BMP-2, 10 databases were screened. There were 99 sequences predicted from DIANAmT, 303 sequences from miRanda, 11 sequences from miRDB, 117 sequences from miRWalk, 0 sequence from RNAhybrid, 0 sequences from PICTAR4, 241 sequences from PICTAR5, 0 sequences from PITA, 62 sequences from RNA22 and 128 sequences from TargetScan, with a total of 961 sequences predicted as the target genes of miR-421. Apart from the three databases that demonstrated no results, the remaining seven databases predicted BMP-2 as the target gene of miR-421. This high predicting proportion suggests that miR-421 may be the upstream gene of BMP-2. In addition, CUGUUGA was a common sequence of the seed region of miR-421 in the positive databases, indicating that this sequence is highly likely to be the seed region.
To determine whether the BMP-2 gene was the target gene of miR-421, a dual-luciferase reporter assay was conducted. The wild and mutanttypes ofthe binding sequences between BMP-2 and miR-421 are demonstrated in Fig. 5. The mutant type of binding sequence was designed as described previously by Guo et al (30). Compared with the negative control, the relative luciferase activity was significantly decreased following co-transfection with agomiR-421 and the wild-type 3′-UTR of BMP-2 (P<0.05), while there was no significant difference observed in the mutant group (P>0.05). These results indicate that miR-421 may directly bind to the 3′-UTR of BMP-2 and regulate its expression.
Humeral fractures can be complex, and the fracture may combine with fracture-peripheral nerves or blood vessels and cause soft tissue damage, which may lead to impeded blood circulation and neurotrophic disorders, increasing the difficulty of fracture healing (31). Excessive surgical treatment in the case of complex injuries not only destroys the local blood supply of the fracture, but also fails to achieve effective fracture fixation, eventually resulting in the failure of humeral fracture healing (31).
It is well accepted that BMPs are the strongest osteogenic factor, which promotes mesenchymal cells to differentiate into bone, cartilage, ligamentous, tendon and nerve tissues (32). BMP-2 is able to specifically convert mouse myoblast cell lines into osteoblast cell lines (33,34). It is believed that the level of BMP-2 in osteoblasts may reflect its osteogenesis ability (35,36). In the present study, BMP-2 mRNA and protein expression levels in the bone fracture tissue and blood of the patients who received surgery 1–7 days after fracture were significantly lower than those in the patients who received surgery after 8–14 days. This suggests that the body may respond to fracture damage within 2 weeks and then upregulate BMP-2 expression in blood and fracture tissues to induce osteogenesis and repair fracture damages.
Heterotopic ossification is a very important secondary disease following fracture, in which bone structure forms outside the skeletal system (37). It is characterized by rapid formation of calcified bone in the soft tissue, causing swelling and pain around the joints and disorders in joint movement (38). A study by Qu et al (39) suggested that heterotopic ossification required certain incentives, including osteoblasts and an appropriate microenvironment. A study by Mukai et al (40) demonstrated that a decrease of BMP-2 alkaline phosphatase activity served a role in the bone differentiation microenvironment and reduced the occurrence of heterotopic ossification (41). This suggests that heterotopic ossification following fracture may be caused by the fracture-induced overregulation of BMP-2. To verify the role of BMP-2 in heterotopic ossification following humeral fracture, the present study measured the expression of BMP-2 in the ossified tissues and blood of patients with heterotopic ossification. A significantly increased expression level of BMP-2 in the ossified tissues and blood of patients with heterotopic ossification following humeral fractures was observed compared with the levels in patients without heterotopic ossification. This suggests that heterotopic ossification may be related to the upregulation of BMP-2.
Many miRNA have become biomarkers of various diseases (41–43), thus the upstream regulatory miRNA of BMP-2 were also investigated in the present study. The upstream regulatory genes of BMP-2 were predicted by bioinformatics, and miR-421 was identified to be one of them. The expression level of miR-421 in gastric cancer has been previously studied (44). In addition, it has been demonstrated that miR-421 was upregulated in neuroblastoma, pancreatic cancer, prostate cancer and other malignant tumors (45–47). miR-421 is closely related to cell growth. A study by Jiang et al (18) determined that miR-421 expression in gastric cancer tissue was higher than that in normal tissues, indicating that miR-421 may serve an important role in the early growth of gastric cancer. A study by Zhou et al (19) detected the expression of miR-421 in peripheral blood mononuclear cell lines by RT-PCR and transfected miR-421 inhibitors into animals, and found that tumor growth was inhibited. Significant downregulation of miR-421 expression was observed in the humeral fracture and the heterotopic ossification tissue samples in the present study. As aforementioned, BMP-2 mRNA and protein were upregulated in these samples. This suggests that the upregulation of BMP-2 may be regulated by the downregulation of its upstream regulatory gene, miR-421. In the present study, the BMP-2 dual-luciferase gene reporter plasmid was constructed and transfected into 293T cells together with agomiR-421. It was revealed that overexpression of miR-421 could significantly reduce the luminance of the BMP-2 plasmid, demonstrating that BMP-2 is the direct target gene of miR-421.
In conclusion, BMP-2 levels were increased and miR-421 levels were decreased in bone tissue samples and blood of patients with humeral fractures and heterotopic ossification. BMP-2 was a direct target of miR-421. These results indicate that miR-421 may serve an important role in humeral fracture healing through regulating BMP-2. This study may provide a new therapeutic target for fracture and heterotopic ossification.
We would like to thank Dr Weizhi Wang and Dr Xuefang Zhao of the Department of Anesthesiology at the Weifang People's Hospital for guidance and assistance with the experiments.
No funding was received.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
CJ, ZL and YJ collaborated to design the study. CJ, ZL and CZ were responsible for performing experiments. CJ and ZL analyzed the data. All authors collaborated to interpret results and develop the manuscript. The final version of the manuscript has been read and approved by all authors, and each author believes that the manuscript represents honest work.
All procedures performed in the current study were approved by the Ethics Committee of Weifang People's Hospital. Written informed consent was obtained from all patients or their families.
Not applicable.
The authors declare that they have no competing interests.
|
Court-Brown CM and Caesar B: Epidemiology of adult fractures: A review. Injury. 37:691–697. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Court-Brown CM, Garg A and McQueen MM: The epidemiology of proximal humeral fractures. Acta Orthop Scand. 72:365–371. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Russo R, Cautiero F, Ciccarelli M and Vernaglia Lombardi L: Reconstruction of unstable, complex proximal humeral fractures with the da Vinci cage: Surgical technique and outcome at 2 to 6 years. J Shoulder Elbow Surg. 22:422–431. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Vanden Bossche L and Vanderstraeten G: Heterotopic ossification: A review. J Rehabil Med. 37:129–136. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Barcak EA and Beebe MJ: Bone morphogenetic protein: Is there still a role in orthopedic trauma in 2017? Orthop Clin North Am. 48:301–309. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Krishnakumar GS, Roffi A, Reale D, Kon E and Filardo G: Clinical application of bone morphogenetic proteins for bone healing: A systematic review. Int Orthop. 41:1073–1083. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Dahlin C, Linde A, Gottlow J and Nyman S: Healing of bone defects by guided tissue regeneration. Plast Reconstr Surg. 81:672–676. 1988. View Article : Google Scholar : PubMed/NCBI | |
|
Yilgor P, Hasirci N and Hasirci V: Sequential BMP-2/BMP-7 delivery from polyester nanocapsules. J Biomed Mater Res A. 93:528–536. 2010.PubMed/NCBI | |
|
Ishibe T, Goto T, Kodama T, Miyazaki T, Kobayashi S and Takahashi T: Bone formation on apatite-coated titanium with incorporated BMP-2/heparin in vivo. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 108:867–875. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Murata M, Maki F, Sato D, Shibata T and Arisue M: Bone augmentation by onlay implant using recombinant human BMP-2 and collagen on adult rat skull without periosteum. Clin Oral Implants Res. 11:289–295. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Bae SJ, Kim HJ, Won HY, Min YK and Hwang ES: Acceleration of osteoblast differentiation by a novel osteogenic compound, DMP-PYT, through activation of both the BMP and Wnt pathways. Sci Rep. 7:84552017. View Article : Google Scholar : PubMed/NCBI | |
|
Song R, Wang D, Zeng R and Wang J: Synergistic effects of fibroblast growth factor-2 and bone morphogenetic protein-2 on bone induction. Mol Med Rep. 16:4483–4492. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang GP, Zhang J, Zhu CH, Lin L, Wang J, Zhang HJ, Li J, Yu XG, Zhao ZS, Dong W and Liu GB: MicroRNA-98 regulates osteogenic differentiation of human bone mesenchymal stromal cells by targeting BMP2. J Cell Mol Med. 21:254–264. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Laxman N, Mallmin H, Nilsson O and Kindmark A: miR-203 and miR-320 regulate bone morphogenetic protein-2-induced osteoblast differentiation by targeting distal-less homeobox 5 (Dlx5). Genes (Basel). 8(pii): E42016. View Article : Google Scholar : PubMed/NCBI | |
|
Jia W, Wu Y, Zhang Q, Gao GE, Zhang C and Xiang Y: Expression profile of circulating microRNAs as a promising fingerprint for cervical cancer diagnosis and monitoring. Mol Clin Oncol. 3:851–858. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Jiang XI, Luo Y, Zhao S, Chen Q, Jiang C, Dai Y, Chen Y and Cao Z: Clinical significance and expression of microRNA in diabetic patients with erectile dysfunction. Exp Ther Med. 10:213–218. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Juzėnas S, Saltenienė V, Kupcinskas J, Link A, Kiudelis G, Jonaitis L, Jarmalaite S, Kupcinskas L, Malfertheiner P and Skieceviciene J: Analysis of deregulated microRNAs and their target genes in gastric cancer. PLoS One. 10:e01323272015. View Article : Google Scholar : PubMed/NCBI | |
|
Jiang Z, Guo J, Xiao B, Miao Y, Huang R, Li D and Zhang Y: Increased expression of miR-421 in human gastric carcinoma and its clinical association. J Gastroenterol. 45:17–23. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Zhou H, Xiao B, Zhou F, Deng H, Zhang X, Lou Y, Gong Z, Du C and Guo J: MiR-421 is a functional marker of circulating tumor cells in gastric cancer patients. Biomarkers. 17:104–110. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Paraskevopoulou MD, Georgakilas G, Kostoulas N, Vlachos IS, Vergoulis T, Reczko M, Filippidis C, Dalamagas T and Hatzigeorgiou AG: DIANA-microT web server v5.0: Service integration into miRNA functional analysis workflows. Nucleic Acids Res. 41:(Web Server Issue). W169–W173. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Betel D, Wilson M, Gabow A, Marks DS and Sander C: The microRNA.org resource: Targets and expression. Nucleic Acids Res. 36:(Database Issue). D149–D153. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Wong N and Wang X: miRDB: An online resource for microRNA target prediction and functional annotations. Nucleic Acids Res. 43:(Database Issue). D146–D152. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Dweep H, Sticht C, Pandey P and Gretz N: miRWalk-database: Prediction of possible miRNA binding sites by ‘walking’ the genes of three genomes. J Biomed Inform. 44:839–847. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Rehmsmeier M, Steffen P, Hochsmann M and Giegerich R: Fast and effective prediction of microRNA/target duplexes. RNA. 10:1507–1517. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Li J, Liang SH and Lu X: Potential role of ezrin and its related microRNA in ovarian cancer invasion and metastasis. Zhonghua Fu Chan Ke Za Zhi. 45:787–792. 2010.(In Chinese). PubMed/NCBI | |
|
Oliveira AC, Bovolenta LA, Nachtigall PG, Herkenhoff ME, Lemke N and Pinhal D: Combining results from distinct MicroRNA target prediction tools enhances the performance of analyses. Front Genet. 8:592017. View Article : Google Scholar : PubMed/NCBI | |
|
Miranda KC, Huynh T, Tay Y, Ang YS, Tam WL, Thomson AM, Lim B and Rigoutsos I: A pattern-based method for the identification of MicroRNA binding sites and their corresponding heteroduplexes. Cell. 126:1203–1217. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Agarwal V, Bell GW, Nam JW and Bartel DP: Predicting effective microRNA target sites in mammalian mRNAs. Elife. 4:2015. View Article : Google Scholar | |
|
Guo W, Qiu Z, Wang Z, Wang Q, Tan N, Chen T, Chen Z, Huang S, Gu J, Li J, et al: MiR-199a-5p is negatively associated with malignancies and regulates glycolysis and lactate production by targeting hexokinase 2 in liver cancer. Hepatology. 62:1132–1144. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang Z and Li W: Surgical treatment of upper humerus fracture nonunion. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi. 24:673–676. 2010.(In Chinese). PubMed/NCBI | |
|
Sykaras N and Opperman LA: Bone morphogenetic proteins (BMPs): How do they function and what can they offer the clinician? J Oral Sci. 45:57–73. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Gutierrez J, Osses N and Brandan E: Changes in secreted and cell associated proteoglycan synthesis during conversion of myoblasts to osteoblasts in response to bone morphogenetic protein-2: Role of decorin in cell response to BMP-2. J Cell Physiol. 206:58–67. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Mundy G, Garrett R, Harris S, Chan J, Chen D, Rossini G, Boyce B, Zhao M and Gutierrez G: Stimulation of bone formation in vitro and in rodents by statins. Science. 286:1946–1949. 1999. View Article : Google Scholar : PubMed/NCBI | |
|
Su JL, Chiou J, Tang CH, Zhao M, Tsai CH, Chen PS, Chang YW, Chien MH, Peng CY, Hsiao M, et al: CYR61 regulates BMP-2-dependent osteoblast differentiation through the {alpha}v{beta}3 integrin/integrin-linked kinase/ERK pathway. J Biol Chem. 285:31325–31336. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Dey D, Wheatley BM, Cholok D, Agarwal S, Yu PB, Levi B and Davis TA: The traumatic bone: Trauma-induced heterotopic ossification. Transl Res. 186:95–111. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Muthukumar N: Dural ossification in ossification of the ligamentum flavum: A preliminary report. Spine (Phila Pa 1976). 34:2654–2661. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Mania VM, Kallivokas AG, Malavaki C, Asimakopoulou AP, Kanakis J, Theocharis AD, Klironomos G, Gatzounis G, Mouzaki A, Panagiotopoulos E and Karamanos NK: A comparative biochemical analysis of glycosaminoglycans and proteoglycans in human orthotopic and heterotopic bone. IUBMB Life. 61:447–452. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Qu X, Chen Z, Fan D, Xiang S, Sun C, Zeng Y, Li W, Guo Z, Qi Q, Zhong W and Jiang Y: Two novel BMP-2 variants identified in patients with thoracic ossification of the ligamentum flavum. Eur J Hum Genet. 25:565–571. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Mukai T, Otsuka F, Otani H, Yamashita M, Takasugi K, Inagaki K, Yamamura M and Makino H: TNF-alpha inhibits BMP-induced osteoblast differentiation through activating SAPK/JNK signaling. Biochem Biophys Res Commun. 356:1004–1010. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Gerlach CV and Vaidya VS: MicroRNAs in injury and repair. Arch Toxicol. 91:2781–2797. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Garnero P: The utility of biomarkers in osteoporosis management. Mol Diagn Ther. 21:401–418. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Matsuzaki J and Ochiya T: Circulating microRNAs and extracellular vesicles as potential cancer biomarkers: A systematic review. Int J Clin Oncol. 22:413–420. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Chureau C, Chantalat S, Romito A, Galvani A, Duret L, Avner P and Rougeulle C: Ftx is a non-coding RNA which affects Xist expression and chromatin structure within the X-inactivation center region. Hum Mol Genet. 20:705–718. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Hao J, Zhang S, Zhou Y, Liu C, Hu X and Shao C: MicroRNA 421 suppresses DPC4/Smad4 in pancreatic cancer. Biochem Biophys Res Commun. 406:552–557. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Östling P, Leivonen SK, Aakula A, Kohonen P, Mäkelä R, Hagman Z, Edsjö A, Kangaspeska S, Edgren H, Nicorici D, et al: Systematic analysis of microRNAs targeting the androgen receptor in prostate cancer cells. Cancer Res. 71:1956–1967. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Hu H, Du L, Nagabayashi G, Seeger RC and Gatti RA: ATM is down-regulated by N-Myc-regulated microRNA-421. Proc Natl Acad Sci USA. 107:1506–1511. 2010. View Article : Google Scholar : PubMed/NCBI |