Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
April-2019 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2019 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Peptide P7 inhibits the bFGF‑stimulated proliferation and invasion of SKOV3 cells

  • Authors:
    • Qiong Chen
    • Ziying Yang
    • Xiangnan Chen
    • Li Shu
    • Wanglei Qu
  • View Affiliations / Copyright

    Affiliations: Department of Obstetrics and Gynecology, The Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University, Wenzhou, Zhejiang 325000, P.R. China, Department of Obstetrics and Gynecology, Shangrao People's Hospital, Shangrao, Jiangxi 334000, P.R. China, Department of Laboratory Medicine, The Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University, Wenzhou, Zhejiang 325000, P.R. China
    Copyright: © Chen et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 3003-3008
    |
    Published online on: February 25, 2019
       https://doi.org/10.3892/etm.2019.7309
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Peptide P7 specifically binds with basic fibroblast growth factor (bFGF) to inhibit the proliferation and invasion of numerous types of cancer cell. However, this effect has remained to be demonstrated in ovarian cancer‑derived cell lines. In the present study, the protein P7 was used treat bFGF‑stimulated SKOV3 epithelial ovarian cancer cells to explore the therapeutic potential of P7. An MTT and a scratch wound assay were used to respectively evaluate the proliferation and migration of bFGF‑stimulated SKOV3 cells treated with P7. Reverse transcription‑quantitative polymerase chain reaction analysis was used to detect the gene expression of urokinase‑type plasminogen activator (uPA), as well as matrix metallopeptidase (MMP)‑2 and ‑9, which have a role in cell migration/invasion. The morphology and proliferation of SKOV3 cells were not significantly affected by different concentrations of P7. However, P7 had an obvious inhibitory effect on the proliferation and migration of bFGF‑stimulated SKOV3 cells. Treatment with P7 significantly lowered the gene expression of uPA, MMP‑2 and MMP‑9 compared with that in the control group. In conclusion, the present results suggested that P7, which, at least in part, acts through inhibition of bFGF, may have a potential therapeutic application in epithelial ovarian cancer.

Introduction

Ovarian cancer is one of the three most common malignant tumor types of the female reproductive system; it poses a serious threat to women's health and is associated with high mortality (1). The symptoms of the disease are frequently non-specific, which hampers early detection, so that the majority of patients present with advanced-stage disease at the time-point of diagnosis (2). Therefore, the treatment of advanced ovarian cancer is particularly important in the clinic.

Studies have confirmed that tumor growth is highly dependent on blood vessels, and tumor metastasis and prognosis are also closely linked to angiogenesis (3–6). Although anti-angiogenic agents, e.g. bevacizumab, are used for almost all patients with ovarian cancer, the cure rate is not increased (7,8). Furthermore, predictive biomarkers are currently insufficient and are urgently required. Basic fibroblast growth factor (bFGF), belonging to the family of FGFs, is one of the strongest vascular growth factors involved in the processes of proliferation and differentiation of a wide variety of cell types. Previous studies have indicated that the P7 high-affinity bFGF-binding peptide is able to inhibit the proliferation and invasion of various cell types induced by bFGF (9–12). Angiogenesis has a fundamental role in normal ovarian physiology as well as in the pathogenesis of ovarian cancer, promoting tumor growth and progression through ascites formation and metastatic spread (7). However, whether P7 also inhibits bFGF-induced proliferation and angiogenesis of human epithelial ovarian cancer cells has not been previously reported, to the best of our knowledge. In the present study, the effect of P7 on bFGF-induced proliferation and invasion of SKOV3 ovarian cancer cells was assessed in vitro, providing an experimental basis for the targeted treatment of epithelial ovarian cancer.

Materials and methods

Materials

The SKOV3 human ovarian cancer cell line was purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). P7 peptides (PLLQATLGGGS) with a purity of >98% was synthesized by Beijing SBS Genetech Corp. (Beijing, China) and recombinant human bFGF was obtained from Peprotech Inc. (Rocky Hill, NJ, USA). RPMI-1640 medium and fetal bovine serum (FBS) were from Gibco (Thermo Fisher Scientific, Inc., Waltham, MA, USA).

Morphological examination

SKOV3 cells in the exponential growth phase were seeded into 96-well culture plates in 100 µl RPMI-1640 medium containing 0.4% FBS at a density of 1×104 cells/well at 37°C in a humidified atmosphere containing 5% CO2. After addition of 100 µl medium containing P7 at different final concentrations (0.25, 1, 4 and 16 µM) and culture for 48 h, the cell morphology was observed with an inverted microscope (Olympus IX70; Olympus, Tokyo, Japan). SKOV3 cells with addition of 100 µl complete medium were used as a control group.

MTT cell proliferation assay

Cell viability was determined using an MTT assay. SKOV3 cells in the exponential growth phase were seeded into 96-well culture plates in 100 µl medium at a density of 1×104 cells/well. The cells were serum-starved for 24 h. In the P7-treated group, 100 µl medium containing different concentrations of P7 was added to each well, followed by incubation for 48 h. In the bFGF-treated group, 100 µl medium containing different concentrations of bFGF (0.1, 1, 10 and 100 ng/ml) was added. Furthermore, in the P7+bFGF group, 100 µl medium containing different concentrations of P7 mixed with 10 ng/ml bFGF (IC50) was added to the wells in quadruplicate. SKOV3 cells with addition of RPMI-1640 medium containing 0.4% FBS were used as the control group, while 100 µl bFGF (10 ng/ml) was added for the positive control group. After 48 h of incubation, the MTT assay was performed by adding 20 µl MTT solution (5 mg/ml in PBS; Beyotime Institute of Biotechnology, Haimen, China) to each well, followed by further incubation for 4 h. Subsequently, 150 µl dimethyl sulfoxide (Beijing Chemical Industry Co. Ltd., Beijing, China) was added. After shaking for 10 min, the optical density (OD) value was measured at a wavelength of 570 nm using a microplate reader (BIO-TEK800; Biotech Instruments, Winooski, VT, USA). Each treatment was performed in triplicate and the results were expressed as a percentage of the control: Cell proliferation rate (%)=(ODbFGF-ODControl)/ODControl ×100%. The inhibition rate of P7 on bFGF-induced SKOV3 cell proliferation was calculated as follows: Inhibition rate (%)=[(ODbFGF-ODControl)-(ODP7-ODControl)]/(ODbFGF-ODControl) ×100%.

Scratch wound cell migration assay

Exponentially growing SKOV3 cells were seeded into 6-well culture plates at a density of 1×104 cells/well, followed by starved incubation for 24 h. In the middle of each well, a 0.5 cm-wide linear scratch was generated with a 20-µl filter tip. The detached cells were rinsed with PBS 3 times so as to prevent their re-attachment in the scratched area. Subsequently, 100 µl DMEM containing 4 µM P7 for the P7 group, 10 ng/ml bFGF for the bFGF group or 50 µl 8 µM P7 + 50 µl 20 ng/ml bFGF for the P7+bFGF group was added to each well separately, while 100 µl DMEM was added to the blank control. Following incubation for 0, 6, 12 and 24 h, an inverted microscope was used to observe wound closure and capture images of the cells. The distance the cells had migrated into the scratched area was measured with ImagePro Express software 6.0 (Media Cybernetics, Rockville, MD, USA). Cell migration was quantified using the following formula: Cell migration (%)=(scratch edge distance at 0 h-migration distance at 6, 12 or 24 h)/scratch edge distance at 0 h ×100%.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

The mRNA levels of urokinase-type plasminogen activator (uPA), matrix metallopeptidase (MMP)2 and MMP9 were assessed as factors associated with cell invasion. SKOV3 cells were incubated in 100 µl RPMI-1640 medium containing 0.4% FBS with 4 µM P7 for the P7 group or 10 ng/ml bFGF for the bFGF group, or 50 µl 8 µM P7+50 µl 20 ng/ml bFGF for the P7+bFGF group for 24 h. Cells incubated with 100 µl RPMI-1640 medium containing 0.4% FBS were used as the blank control. Total RNA was isolated with a Qiagen RNeasy Micro kit (cat. no. 74004; Qiagen, Hilden, Germany). RT was performed by using a Takara PrimeScript™ RT reagent kit (cat. no. RR037A, Takara Bio Inc., Otsu, Japan). The first-strand complementary DNA synthesis was performed using 500 ng isolated RNA. PCR primers of the genes are displayed in Table I. qPCR was performed using SYBR® Premix Ex Taq™ (cat. no. DRR041A; Takara Bio Inc.) with the following thermocycling conditions: Initial denaturation, 95°C for 5 min; amplification, 95°C for 10 sec, 60°C for 10 sec, 72°C for 10 sec, gathering fluorescence signal at 72°C for 40 cycles; dissolve, 95°C for 5 sec, 65°C for 1 min, 97°C termination for 1 cycle; cooled at 40°C for 30 sec. Each sample was anlysed 3 times and the average value was recorded. The relative expression levels of uPA, MMP2 and MMP9 were normalized to β-actin levels. The 2−ΔΔCq value was used to represent the relative gene expression (13).

Table I.

Sequences and amplicon sizes of the oligonucleotide primers used for quantitative polymerase chain reaction.

Table I.

Sequences and amplicon sizes of the oligonucleotide primers used for quantitative polymerase chain reaction.

GeneForward primer (5′-3′)Reverse primer (5′-3′)Amplicon size (bp)
UPA TGTGAGATCACTCTGGCTTTGGAA CCTTGGAGGGAACAGACGAG223
MMP2 AATGCCATCCCCGATAACC GCTCAGCAGCCTAGCCAGTC155
MMP9 GGGGGAAGATGCTGCTGTT GCCGGTCCTGGCAGAAATAG172
β-actin CATTGCCGACAGGATGCAG CTCGTCATACTCCTGCTTGCTG169

[i] MMP, matrix metallopeptidase; uPA, urokinase-type plasminogen activator.

Statistical analysis

Each experiment was performed at least three times and values are expressed as the mean ± standard deviation. The statistical data analysis was performed using one-way analysis of variance between groups, and Tukey's multiple-comparisons test was used to compare between pairs of groups by using SPSS 19.0 (IBM Corp., Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

P7 does not affect the morphology of SKOV3 cells

In the presence of P7, the cells grew well and their morphology observed under the inverted microscope was normal compared with that in the control group. P7 had no significant effect on SKOV3 cell morphology within the range of concentrations tested (0.25-16 µM; Fig. 1). These results suggested that, at the concentrations assessed, P7 had no cytotoxic effect on SKOV3 cells.

Figure 1.

Representative inverted microscopy images indicating that the cell morphology was not significantly affected by P7 at different concentrations (magnification, ×400). (A) Control; (B) P7 (0.25 µM); (C) P7 (1 µM); (D) P7 (4 µM); (E) P7 (16 µM).

Effects of P7, bFGF and P7+bFGF on the proliferation of SKOV3 cells

The cell proliferation was expressed as a percentage of the control. Among the P7-treated groups, the inhibition rate of 0.25 µM P7 on SKOV3 cells was 6.47±2.12% and this rate was enhanced with increasing concentrations of P7 (Fig. 2). However, the inhibitory rate between the different groups exhibited no statistically significant difference (P>0.05). Overall, the results of the MTT assay indicated that P7 slightly inhibited SKOV3 cell proliferation, but this was not significant (Fig. 2).

Figure 2.

Effect of different concentrations of P7 on cell proliferation. The mean cell inhibitory rate of different concentrations of P7 (0.25, 1, 4 and 16 µM) was 6.47, 7.56, 8.33 and 9.66%, respectively.

In the bFGF-treated groups, the viability of the SKOV3 cells was significantly enhanced in a dose-dependent manner (P<0.001; Fig. 3). When SKOV3 cells were treated with 10 ng/ml bFGF, the proliferation rate reached >60%.

Figure 3.

Effect of different concentrations of bFGF on the proliferation of ovarian cancer cells. The mean proliferative rate of SKOV3 cells treated with different concentrations of bFGF (0.1, 1, 10 and 100 ng/ml) was 11.57, 29.40, 63.32 and 109.2%, respectively. ***P<0.001 vs. 0.1 ng/ml. bFGF, basic fibroblast growth factor.

In the P7+bFGF group, P7 significantly reduced the bFGF-stimulated proliferation of SKOV3 cells at concentrations from 0.25 to 4 µM (P<0.001; Fig. 3). In the group treated with 4 µM P7, the mean inhibitory rate of SKOV3 cells was nearly 90% (Fig. 4).

Figure 4.

Effect of different concentrations of P7 on bFGF-stimulated cell proliferation. Treatment of 10 ng/ml bFGF-stimulated SKOV3 cells with P7 at concentrations of 0.25, 1, 4 and 16 µM significantly inhibited cell proliferation with mean inhibition rates of 21.83, 49.47, 89.67 and 94.43%, respectively. ***P<0.001 vs. 0.25 µM. bFGF, basic fibroblast growth factor.

Effects of P7, bFGF and P7+bFGF on the migration of SKOV3 cells

The results of the cell scratch assay indicated that after 24 h, the SKOV3 cells in the bFGF group had almost migrated into the total scratched area, while an obvious gap was still present in the P7+bFGF group (Fig. 5A). Quantitative analysis of cell migration indicated a statistically significant difference between the P7+bFGF group and the bFGF group (P<0.01; Fig. 5B).

Figure 5.

Scratch wound assay. (A) Inverted microscopy images of different groups of SKOV3 cells for comparative analysis of the cell migration (magnification, ×100). (B) Quantitative evaluation indicated an obvious difference between the bFGF group, the P7+bFGF group and the control group. However, no significant difference between the P7 group and the control group was identified. **P<0.01 vs. control group. bFGF, basic fibroblast growth factor.

Effects of P7, bFGF and P7+bFGF on the expression of uPA, MMP2 and MMP9

RT-qPCR analysis confirmed that uPA, MMP2 and MMP9 were all expressed in SKOV3 cells. After treatment with P7, the expression of these genes was significantly inhibited. In the bFGF group, the expression of the genes was significantly increased. The expression levels in the P7+bFGF group were low (Fig. 6). In the P7 group, it was demonstrated that P7 had the strongest inhibitory effect on uPA, followed by MMP2, and the weakest inhibitory effect on MMP9. The bFGF group demonstrated that bFGF had the strongest effect to enhance uPA expression, followed by MMP2, and the weakest effect on MMP9 expression.

Figure 6.

Reverse transcription-quantitative polymerase chain reaction analysis of the expression of uPA, MMP2 and MMP9 in SKOV3 cells treated with P7 and bFGF. The results indicated that the expression rate of the gene was obviously increased by bFGF stimulation and downregulated by P7 and P7+bFGF treatment. *P<0.05 **P<0.01, ***P<0.001 vs. control group. bFGF, basic fibroblast growth factor; MMP, matrix metallopeptidase; uPA, urokinase-type plasminogen activator; Cq, quantification cycle.

Discussion

Epithelial ovarian cancer has been reported to be the leading cause of mortality among gynecologic malignancies worldwide during the last twenty years. Ovarian cancer is characterized by a high degree of malignancy, insidious onset, high invasive capacity and fast growth. Screening based on the detection of cancer antigen (CA)125 and transvaginal sonography did not markedly reduce the mortality rate associated with ovarian cancer (14). Due to the insufficient diagnostic methods for early-onset ovarian cancer, most patients are diagnosed at a late stage. Therefore, chemotherapy is important in the treatment of ovarian cancer, but the adverse effects of drugs and multi-drug resistance affect the therapeutic efficacy of ovarian carcinoma (15,16).

Angiogenesis is required for invasive tumor growth and metastasis. Inhibition of angiogenesis is considered to be a promising approach for antitumor therapy. Bevacizumab is a monoclonal antibody against vascular endothelial growth factor and was approved by the US Food and Drug Administration in February 2004 for the first-line treatment of advanced colorectal cancer; it has been used to successfully treat colorectal cancer and advanced non-small cell lung cancer (7,17). Bevacizumab also has efficacy against recurrent or treatment-resistant ovarian cancer. Combined with paclitaxel, it rapidly reduces serum CA125 levels of patients with advanced chemoresistant ovarian cancer and significantly reduces cancer-associated symptoms (18). bFGF is one of the most potent vascular growth factors, which regulates the expression of various invasion-associated factors, including uPA and MMPs, to promote the degradation of the extracellular matrix and the destruction of the basal layer to inhibit tumor invasion, metastasis and spread (6). Overexpression of bFGF was reported in the A90 and A121 ovarian cancer cell lines, and cell proliferation was significantly enhanced under exogenous bFGF stimulation (19). The present study also confirmed that bFGF promotes the proliferation of SKOV3 cells, and it significantly increased the amount of viable SKOV3 cells in a dose-dependent manner. This supports the hypothesis that inhibiting tumor cell growth and tumor angiogenesis via a targeting inhibition of bFGF to impair its biological activity may provide a novel approach for the development of drugs (20).

Peptides have become a focus of drug research due to their high activity and specificity, while having relatively few side effects. Phage display technology was used to screen the novel lead peptide P7 from a random peptide library, based on its ability to specifically bind to bFGF (21). The present study indicated that P7 had almost no effect on the morphology, proliferation and migration of SKOV3 cells, but had a significant inhibitory effect on cell proliferation and migration induced by bFGF. It is therefore indicated that P7 has a slight cytotoxic effect on SKOV3 cells, but inhibits SKOV3 cell proliferation and migration by specifically binding to bFGF. This supports the hypothesis that P7 may be utilized as a specific treatment for ovarian cancer.

uPA is a type of serine proteolytic enzyme, and it may activate MMPs and proteolytic enzymes from a variety of precursors in tumor tissue, and degrade extracellular matrix and basement membrane components of the tumor and vessel wall, resulting in an increase of the tumor vessel wall permeability. Fibrinolytic enzymes may stimulate angiogenesis by increasing the activity of vascular endothelial growth factor to promote the growth and spread of tumors (22). Studies have confirmed that the content of uPA is higher in the center of the tumor than that in the normal adjacent tissue, and is correlated with the depth of invasion and metastasis. MMPs are zinc-dependent endopeptidases, and have a high expression and activity in most types of tumor tissue, which promotes cell invasion and migration, and induces angiogenesis via numerous ways, to enhance metastasis of tumor cells. The expression levels of MMP-2 and MMP-9 are associated with the degree of malignancy and angiogenesis of tumors (23). Studies have indicated that MMPs are expressed in ovarian cancer tissues, and their expression level is associated with the clinical stage and prognosis of ovarian cancer (24). The present study indicated that bFGF significantly increases the expression of uPA, MMP-2 and MMP-9 in SKOV3 cells, confirming that bFGF is associated with the invasive ability of ovarian cancer cells. bFGF may promote the degradation of extracellular matrix by upregulating the expression of uPA, MMP-2 and MMP-9, and increase vascular permeability to promote tumor cell proliferation. P7 significantly reduced the expression of these three genes in bFGF-induced SKOV3 cells, which indicates that P7 may specifically inhibit bFGF-induced tumor cell invasion and proliferation by sequestering the increasing expression effect of bFGF on invasion-associated factors. In the present study, it was revealed that P7 had the greatest inhibitory effect on uPA, followed by MMP2 and MMP9. However, the exact mechanisms remain elusive and further studies are required to investigate them.

In conclusion, the present study indicated that P7 inhibits the proliferation and migration of ovarian cancer cells induced by bFGF, and downregulates the expression of invasion-associated factors, including uPA, MMP-2 and MMP-9. It was revealed that treatment with P7 inhibits the proliferation, migration and invasion of bFGF-induced human ovarian cancer SKOV3 cells in vitro. Due to its prominent effects, it is recommended that the use of P7 as an anticancer agent for ovarian tumors should be pursued.

Acknowledgements

Not applicable.

Funding

This work was supported by the Wenzhou science and technology bureau foreign cooperation project (grant no. H20110015).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

WQ initiated and guided the study, and revised the manuscript. QC and ZY performed experiments, and wrote the manuscript. XC and LS contributed to data collection and processing. All authors have read and approved the final version of the manuscript.

Ethical approval and informed consent

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Matulonis UA, Sood AK, Fallowfield L, Howitt BE, Sehouli J and Karlan BY: Ovarian cancer. Nat Rev Dis Primers. 2:160612016. View Article : Google Scholar : PubMed/NCBI

2 

Koshiyama M, Matsumura N and Konishi I: Subtypes of ovarian cancer and ovarian cancer screening. Diagnostics. 7:E122017. View Article : Google Scholar : PubMed/NCBI

3 

Gaya AM and Rustin GJ: Vascular disrupting agents: A new class of drug in cancer therapy. Clin Oncol. 17:277–290. 2005. View Article : Google Scholar

4 

Al-Abd AM, Alamoudi AJ, Abdel-Naim AB, Neamatallah TA and Ashour OM: Anti-angiogenic agents for the treatment of solid tumors: Potential pathways, therapy and current strategies-A review. J Adv Res. 8:591–605. 2017. View Article : Google Scholar : PubMed/NCBI

5 

Bielenberg DR and Zetter BR: The contribution of angiogenesis to the process of metastasis. Cancer J. 21:267–273. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Burger RA: Overview of anti-angiogenic agents in development for ovarian cancer. Gynecol Oncol. 121:230–238. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Monk BJ, Minion LE and Coleman RL: Anti-angiogenic agents in ovarian cancer: Past, present, and future. Ann Oncol. 27 (Suppl):i33–i39. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Chase DM, Chaplin DJ and Monk BJ: The development and use of vascular targeted therapy in ovarian cancer. Gynecol Oncol. 145:393–406. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Fan L, Li W, Ying S, Shi L, Wang Z, Chen G, Ye H, Wu X, Wu J, Liang G and Li X: A peptide derivative serves as a fibroblast growth factor 2 antagonist in human gastric cancer. Tumour Biol. 36:7233–7241. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Luo W, Yu Y, Wang R, He D, Wang C, Zeng X, Chen X, Tan X, Huang T and Wu X: P7 peptides targeting bFGF sensitize colorectal cancer cells to CPT-11. Int J Mol Med. 33:194–200. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Yu Y, Gao S, Li Q, Wang C, Lai X, Chen X, Wang R, Di J, Li T, Wang W and Wu X: The FGF2-binding peptide P7 inhibits melanoma growth in vitro and in vivo. J Cancer Res Clin Oncol. 138:1321–1328. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Li Q, Gao S, Yu Y, Wang W, Chen X, Wang R, Li T, Wang C, Li X and Wu X: A novel bFGF antagonist peptide inhibits breast cancer cell growth. Mol Med Rep. 6:210–214. 2012.PubMed/NCBI

13 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Buys SS, Partridge E, Black A, Johnson CC, Lamerato L, Isaacs C, Reding DJ, Greenlee RT, Yokochi LA, Kessel B, et al: Effect of screening on ovarian cancer mortality: The prostate, lung, colorectal and ovarian (PLCO) cancer screening randomized controlled trial. Jama. 305:2295–2303. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Collins T, Gray K, Bista M, Skinner M, Hardy C, Wang H, Mettetal JT and Harmer AR: Quantifying the relationship between inhibition of VEGF receptor 2, drug-induced blood pressure elevation and hypertension. Br J Pharmacol. 175:618–630. 2018. View Article : Google Scholar : PubMed/NCBI

16 

Hayman SR, Leung N, Grande JP and Garovic VD: VEGF inhibition, hypertension, and renal toxicity. Curr Oncol Rep. 14:285–294. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Arkenau HT, Brunetto AT, Barriuso J, Olmos D, Eaton D, de Bono J, Judson I and Kaye S: Clinical benefit of new targeted agents in phase I trials in patients with advanced colorectal cancer. Oncology. 76:151–156. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Cohn DE, Valmadre S, Resnick KE, Eaton LA, Copeland LJ and Fowler JM: Bevacizumab and weekly taxane chemotherapy demonstrates activity in refractory ovarian cancer. Gynecol Oncol. 102:134–139. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Crickard K, Gross JL, Crickard U, Yoonessi M, Lele S, Herblin WF and Eidsvoog K: Basic fibroblast growth factor and receptor expression in human ovarian cancer. Gynecol Oncol. 55:277–284. 1994. View Article : Google Scholar : PubMed/NCBI

20 

Hill DS, Martin S, Armstrong JL, Flockhart R, Tonison JJ, Simpson DG, Birch-Machin MA, Redfern CP and Lovat PE: Combining the endoplasmic reticulum stress-inducing agents bortezomib and fenretinide as a novel therapeutic strategy for metastatic melanoma. Clin Cancer Res. 15:1192–1198. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Wu X, Yan Q, Huang Y, Huang H, Su Z, Xiao J, Zeng Y, Wang Y, Nie C, Yang Y and Li X: Isolation of a novel basic FGF-binding peptide with potent antiangiogenetic activity. J Cell Mol Med. 14:351–356. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Binder BR, Mihaly J and Prager GW: uPAR-uPA-PAI-1 interactions and signaling: A vascular biologist's view. Thromb Haemost. 97:336–342. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Torng PL, Mao TL, Chan WY, Huang SC and Lin CT: Prognostic significance of stromal metalloproteinase-2 in ovarian adenocarcinoma and its relation to carcinoma progression. Gynecol Oncol. 92:559–567. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Schmalfeldt B, Prechtel D, Harting K, Spathe K, Rutke S, Konik E, Fridman R, Berger U, Schmitt M, Kuhn W and Lengyel E: Increased expression of matrix metalloproteinases (MMP)-2, MMP-9, and the urokinase-type plasminogen activator is associated with progression from benign to advanced ovarian cancer. Clin Cancer Res. 7:2396–2404. 2001.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen Q, Yang Z, Chen X, Shu L and Qu W: Peptide P7 inhibits the bFGF‑stimulated proliferation and invasion of SKOV3 cells . Exp Ther Med 17: 3003-3008, 2019.
APA
Chen, Q., Yang, Z., Chen, X., Shu, L., & Qu, W. (2019). Peptide P7 inhibits the bFGF‑stimulated proliferation and invasion of SKOV3 cells . Experimental and Therapeutic Medicine, 17, 3003-3008. https://doi.org/10.3892/etm.2019.7309
MLA
Chen, Q., Yang, Z., Chen, X., Shu, L., Qu, W."Peptide P7 inhibits the bFGF‑stimulated proliferation and invasion of SKOV3 cells ". Experimental and Therapeutic Medicine 17.4 (2019): 3003-3008.
Chicago
Chen, Q., Yang, Z., Chen, X., Shu, L., Qu, W."Peptide P7 inhibits the bFGF‑stimulated proliferation and invasion of SKOV3 cells ". Experimental and Therapeutic Medicine 17, no. 4 (2019): 3003-3008. https://doi.org/10.3892/etm.2019.7309
Copy and paste a formatted citation
x
Spandidos Publications style
Chen Q, Yang Z, Chen X, Shu L and Qu W: Peptide P7 inhibits the bFGF‑stimulated proliferation and invasion of SKOV3 cells . Exp Ther Med 17: 3003-3008, 2019.
APA
Chen, Q., Yang, Z., Chen, X., Shu, L., & Qu, W. (2019). Peptide P7 inhibits the bFGF‑stimulated proliferation and invasion of SKOV3 cells . Experimental and Therapeutic Medicine, 17, 3003-3008. https://doi.org/10.3892/etm.2019.7309
MLA
Chen, Q., Yang, Z., Chen, X., Shu, L., Qu, W."Peptide P7 inhibits the bFGF‑stimulated proliferation and invasion of SKOV3 cells ". Experimental and Therapeutic Medicine 17.4 (2019): 3003-3008.
Chicago
Chen, Q., Yang, Z., Chen, X., Shu, L., Qu, W."Peptide P7 inhibits the bFGF‑stimulated proliferation and invasion of SKOV3 cells ". Experimental and Therapeutic Medicine 17, no. 4 (2019): 3003-3008. https://doi.org/10.3892/etm.2019.7309
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team