Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
January-2020 Volume 19 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2020 Volume 19 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

miR‑629 targets FOXO3 to promote cell apoptosis in gastric cancer

  • Authors:
    • Ming Li
    • Yingxin Wang
    • Xia Liu
    • Zhenduo Zhang
    • Liwei Wang
    • Yong Li
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, Hebei Medical University, Shijiazhuang, Hebei 050017, P.R. China, Department of General Surgery, The First Hospital of Shijiazhuang City, Shijiazhuang, Hebei 050011, P.R. China, Department of Forensic Pathology, Hebei Medical University, Shijiazhuang, Hebei 050017, P.R. China, Department of General Surgery, Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050011, P.R. China
    Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 294-300
    |
    Published online on: November 6, 2019
       https://doi.org/10.3892/etm.2019.8168
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Gastric cancer (GC) is one of the most aggressive types of human tumor worldwide, and the 5‑year survival rate is less than 25%. The transcriptional factor, forkhead box O3 (FOXO3), is regulated by various micro (mi)RNAs and has been reported to be associated with multiple regulatory signaling pathways involved in tumor development. The current study therefore assessed the impact of miR‑629 and FOXO3 on gastric cancer. Reverse transcription‑quantitative polymerase chain reaction and western blotting were performed to assess the expression of mRNA and protein, respectively. Additionally, the cell proliferation and apoptosis rate were determined via an MTT assay and flow cytometry, respectively. The online database TargetScan predicted that FOXO3 was a target of miR‑629. A luciferase reporter assay was also performed to verify that FOXO3 was the direct target of miR‑629. The results demonstrated that miR‑629 and FOXO3 was upregulated and downregulated in GC tissue, respectively. Furthermore, following transfection with a miR‑629 inhibitor, SGC‑7901, cell proliferation and apoptosis rate were inhibited and promoted when compared with the control group, respectively. Moreover, after the treatment with SGC‑7901, the expression of FOXO3, Bax, Caspase 3 was upregulated, and Bcl‑2 was downregulated. Furthermore, the luciferase reporter assay revealed that FOXO3 was the target of miR‑629. The results demonstrated that miR‑629 and FOXO3 serve vital roles in the development of gastric cancer and may be a future therapeutic target.

Introduction

Gastric cancer (GC) is one of the leading causes of mortality worldwide, particularly in Asian countries such as China (1). Over the past three decades, the incidence of gastric cancer has gradually declined due to improved treatment (2). However, the mortality rate of gastric cancer remains high and its burden on the patients remains substantial (3,4). It was reported that the 5 year survival rate of patients with GC treated at an early stage was 90–95% in Japan from 1970 to 2000; however, the overall survival rate of late stage GC is less than 20% (5,6). Despite advances in GC treatment, a substantial number of patients exhibit local recurrence or distant metastasis, the underlying molecular mechanism of which remains unclear (7). Cisplatin and fluoropyrimidine-based chemotherapy, in combination with trastuzumab, is widely used to treat patients with stage IV GC that are human epidermal growth factor receptor 2-positive and who are eligible to receive chemotherapy (8). Recently, it has been demonstrated that biological therapies may be novel treatments of GC (9). For instance, overexpressed miR-200b inhibited the proliferation and migration of GC cells (10). The current study therefore aimed to assess the impact of micro (mi)RNAs (miRs) on the development of GC.

miRNAs are a group of small non-coding RNAs that are comprised of approximately 22–24 nucleotides (11). miRNAs specifically bind to the 3′ untranslated region (3′-UTR) of target mRNAs and as a result, promote mRNA degradation and alter protein expression (12). In addition, miRNA expression profiles in certain types of cancer serve primary roles in various human biological processes, including migration, cellular metabolism, cell proliferation, apoptosis and epithelial-mesenchymal transition (13). Previous studies have revealed that the dysregulation of certain miRNAs in Helicobacter pylori-infected gastric mucosa and GC, including miR-17-5p/20a, miR-106b and miR-93, induce the development and progression of cancer, involving cell proliferation, migration, invasion and apoptosis (14–17). Furthermore, other findings have indicated that miR-627, miR-629 and miR-652 are highly expressed in patients with GC (7). In addition, human pancreatic cancer progression was induced by miR-629 via FOXO3 targeting (18).

Forkhead box O3 (FOXO3) is a transcription factor belonging to the FOXO family, the effects of which have been assessed in a wide variety of cellular processes, including proliferation, cell cycle arrest, cell death and metabolism (19,20). A previous study has indicated that FOXO3A promoted GC cell migration and invasion via the induction of cathepsin L (21). Additionally, FOXO3 exhibits tumor suppressive effects on GC, which might be a promising therapy in clinic (22). However, the impact of miR-629 on FOXO3 in GC has not yet been fully elucidated. Based on previous studies (18,21), the current study hypothesized that miR-629 may target FOXO3 to affect GC cell activity.

The expression of miR-629 and FOXO3 in GC, and the impact of miR-629 on FOXO3 expression and associated cell activity, including cell proliferation and cell apoptosis, were assessed in the current study. The results demonstrated that miR-629 may serve as a therapeutic target for GC and that the effects of miR-629 indicate that it may serve as a novel molecular target for GC diagnosis and treatment.

Materials and methods

Patients and tissues

A total of 44 patients with GC recruited into the present study were hospitalized in The First Hospital of Shijiazhuang City (Shijiazhuang City, China) from June 2016 to August 2017. The patients (15 females and 29 males) aged between 36 and 67 years old. None of the patients had undergone surgical treatment, radiotherapy or chemotherapy prior to enrollment. Tumor and paracarcinoma tissues (obtained from each patient 5 cm away from the edge of tumor) were stored in 10% formalin at room temperature. The paracarcinoma tissues were used as the control group. The current study was approved by the Ethics Committee of The First Hospital of Shijiazhuang City and all patients provided their written informed consent.

Cell line and plasmids

The SGC-7901 cell line was purchased from the American Type Culture Collection (Manassas, VA, USA) and maintained in RPMI-1640 medium containing 10% fetal bovine serum (both Thermo Fisher Scientific, Inc., Waltham, MA, USA). All cells were cultured in a humidified incubator at 37°C in 5% CO2 for 24 h. The miR-629 inhibitor (5′-GCUGGGCUUACGUUGGAGAAC-3′), negative control (5′-TAACACGTCTATACGCCCA-3′), FOXO3 3′UTR wild-type (WT) and FOXO3 3′UTR-mutant (MUT) were constructed by OriGene Technologies, Inc. (Rockville, MD, USA).

miRNA transfection

SGC-7901 cells were seeded in 12-well plates (2×105 cells/well) with RPMI-1640 medium and incubated at 37°C with 5% CO2. Once cells reached a confluence of 60–70%, transfection was performed. miR-629 inhibitor or miR-NC inhibitor (50 nmol/l) was transfected into cells using Lipofectamine® 2000 (Thermo Fisher Scientific, Inc.) for 6 h according to the manufacturer's protocol. Subsequently, transfected cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum in a humidified incubator at 37°C with 5% CO2 for 48 h. At 48-h post transfection, cells were used for the subsequent experiments.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

RNA was extracted from GC and paracarcinoma tissues, and SGC-7901 cells using the TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Subsequently, RNA concentration was determined using Nanodrop 2000 (Thermo Fisher Scientific, Inc.). Takara Taq polymerase (Takara Bio, Inc., Otsu, Japan) was used for DNA amplification. cDNA was synthesized using the PrimeScript RT reagent kit (Takara Biotechnology, Co., Ltd., Dalian, China) at 37°C for 15 min. qPCR was performed using the SYBR Premix EX Taq™ kit (Takara Bio, Inc.). The thermocycling conditions were as follows: Initial denaturation at 95°C for 30 sec, followed by 40 cycles at 95°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec, and then a final extension at 72°C for another 10 min. The expression of miR-629 was normalized to the endogenous expression of U6 and the relative expression of protein mRNA was normalized to GAPDH. The 2−ΔΔCq method was used to analyze mRNA expression (23). The sequences of the primers were listed in Table I.

Table I.

Oligonucleotide primers used reverse transcription- quantitative polymerase chain reaction analysis.

Table I.

Oligonucleotide primers used reverse transcription- quantitative polymerase chain reaction analysis.

GeneDirectionSequence (5′-3′)
miR-629F TGGGTTTACGTTGGGAGA
R GTGCAGGGTCCGAGGTATTC
U6F CTCGCTTCGGCAGCACA
R AACGCTTCACGAATTTGCGT
BaxF CACCAGCTCTGAACAGATCATGA
R TCAGCCCATCTTCTTCCAGATGT
Bcl-2F CACCCCTGGCATCTTCTCCTT
R AGCGTCTTCAGAGACAGCCAG
Caspase-3F GATGTGGACGCAGCCAACCTCA
R TCCGGCAGTAGTCGCCTCTGAA
FOXO3F TCACGCACCAATTCTAACGC
R CACGGCTTGCTTACTGAAGG
GAPDHF AGAAGGCTGGGGCTCATTTG
R GCAGGAGGCATTGCTGATGAT

[i] miR, microRNA; Bax, Bcl-2 associated x; Bcl-2, B-cell lymphoma 2; FOXO3, forkhead box O3; F, forward; R, reverse.

Western blotting

Western blot analysis was performed to assess protein expression. Transfected SGC-7901 cells were lysed using radioimmunoprecipitation assay buffer (cat. no. P0013B; Beyotime Institute of Biotechnology, Haimen, China) and centrifuged at 10,000 × g for 15 min at 4°C. Protein concentration was then determined using a BCA kit (Thermo Fisher Scientific, Inc.). Subsequently, SDS-PAGE containing 50 mg protein/lane was performed with 25% resolving gel. Proteins were transferred onto polyvinylidene difluoride membranes, which were blocked with 15% skimmed milk for 1 h at 37°C prior to experimentation. GAPDH was utilized as an internal control. Then the membranes were incubated with primary anti-FOXO3 (cat no. ab109629; 1:1,000), anti-Bcl-2 associated × (Bax; cat no. ab32503; 1:1,000), anti-B-cell lymphoma 2 (Bcl-2; cat no. ab32124; 1:1,000), anti-caspase-3 (cat no. ab32351; 1:5,000) and anti-GAPDH (cat no. EPR16891; 1:10,000; all Abcam, Cambridge, MA, USA) and horseradish peroxidase-conjugated secondary antibodies (cat no. ab6721; 1:5,000; Abcam) overnight at 4°C and incubated at room temperature for 1 h. An ECL kit (cat. no. K820500; Biovision Inc., Milpitas, CA, USA) was used to visualize samples. The gray value was obtained using ImageJ analysis software (National Institutes of Health, Bethesda, MD, USA).

MTT assay

At 48 h following plasmid transfection, an MTT assay was performed to assess the viability of SGC-7901. Cells were seeded into 96-well plate (5×103 cells/well). Purple formazan was dissolved using DMSO and optical density was then measured at 595 nm using a microplate reader at 0, 12, 24 and 48 h.

Flow cytometry assay

Following 48 h incubation, SGC-7901 cells were digested with trypsin for 2 min at 37°C. The apoptosis rate of GC cells was determined with an Annexin V-FITC Apoptosis Detection kit (Abcam) according to the manufacturer's protocol. Cells were stained with 5 µl Annexin V and propidium iodide (BD Bioscience, Franklin Lakes, NJ, USA) in shade at 37°C for 15 min prior to counting. The apoptosis rate of transfected SGC-7901 cells was then counted using a flow cytometer (EPICS XL; Beckman Coulter, Inc., Fullerton, CA, USA) with FCS Express 3.0 software (DeNovo Software, Glendale, CA, USA).

Bioinformatics analysis and the dual-luciferase-reporter assay

miR-629 target gene prediction was determined using TargetScan (http://www.targetscan.org/vert_71/). For the luciferase reporter assay. The pMIR-REPORT™ Luciferase plasmid was purchased from Thermo Fisher Scientific, Inc. SGC-7901 cells (5×103) were seeded into 96-well plates and incubated with RPMI-1640 medium at 37°C with 5% CO2 until a confluence of 70% was reached. Subsequently, the miR-629 inhibitor and negative control plasmid with 3′UTR-FOXO3-WT and 3′UTR-FOXO3-MUT were transfected into SGC-7901 cells using Lipofectamine® 3000 (Thermo Fisher Scientific, Inc.) and incubated at 37°C. After 48 h, the dual-luciferase reporter assay kit (Promega Corporation, Madison, WI, USA) was utilized for luciferase determination and luciferase activity was normalized to that of Renilla.

Statistical analysis

All data were presented as the mean ± standard deviation and were performed in triplicate. A Student's t-test was performed for comparisons between two groups and one-way analysis of variance followed by a Newman-Keuls post-hoc test was utilized for the comparison of multiple groups. Analysis was performed using GraphPad Prism version 5.01 software (GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

FOXO3 is downregulated but miR-629 is upregulated in GC tissues

The expression of miR-629 and FOXO3 mRNA was determined using RT-qPCR and FOXO3 protein expression was assessed via western blot analysis. As shown in Fig. 1A, the results demonstrated that FOXO3 is significantly downregulated in GC tumor tissues at the mRNA and protein level when compared with the control group. By contrast, significant upregulation in miR-629 was observed in tumor tissues compared with control tissues (Fig. 1B).

Figure 1.

Downregulated FOXO3 and upregulated miR-629 expression in tissues with gastric cancer. (A) FOXO3 mRNA and protein expression were determined using RT-qPCR and western blotting, respectively. A sample from one patient is presented. (B) miR-629 expression was determined using RT-qPCR. **P<0.01. FOXO3, forkhead box O3; miR, miRNA; control, paracarcinoma tissues; tumor, tumor tissues.

miR-629 is downregulated in SGC-7901 cells following inhibitor transfection

Cells were divided into three groups: The blank control group, the miR-NC inhibitor group and the miR-629 inhibitor group. As shown in Fig. 2, miR-629 expression was significantly decreased in the inhibitor group compared with the control. These results indicate that the miR-629 inhibitor was successfully constructed and thus could be utilized for further experimentation.

Figure 2.

miR-629 is downregulated in SGC-7901 cells following inhibitor transfection. The expression of miR-629 was determined via reverse transcription-quantitative polymerase chain reaction. **P<0.01 vs. the control group. miR, microRNA; control, non-transfected group; NC, transfected with negative control plasmids; inhibitor, transfected with miR-629 inhibitor plasmids.

SGC-7901 cell proliferation rate is inhibited by the miR-629 inhibitor

The proliferation rate of SGC-7901 cells was assessed via an MTT assay. As presented in Fig. 3, compared with the control group, the proliferation rate significantly decreased in the inhibitor group following 24 and 48 h. Thus, the results demonstrated that the miR-629 inhibitor induces a decrease in SGC-7901 cell proliferation.

Figure 3.

SGC-7901 cell proliferation rate is inhibited following transfection with a miR-629 inhibitor. The proliferation of SGC-7901 cells was determined via an MTT assay. **P<0.01 vs. the control group. miR, microRNA; control, non-transfected group; NC, transfected with negative control plasmids; inhibitor, transfected with miR-629 inhibitor plasmids; OD, optical density.

SGC-7901 cell apoptosis is promoted by the miR-629 inhibitor

SGC-7901 cell apoptosis was assessed using flow cytometry. The results indicated that the cell apoptosis rate was significantly increased in the inhibitor group compared with the control group (Fig. 4A and B). It was therefore concluded that miR-629 inhibits SGC-7901 cell apoptosis.

Figure 4.

SGC-7901 cell apoptosis is promoted following transfection with the miR-629 inhibitor. Flow cytometry was utilized to assess SGC-7901 cell apoptosis. (A) Flow cytometric scatter plots and (B) quantification of apoptosis rate. **P<0.01 vs. the control group. miR, microRNA; control, non-transfected group; NC, transfected with negative control plasmids; inhibitor, transfected with miR-629 inhibitor plasmids; PI, propidium iodide; FITC, fluorescein isothiocyanate.

FOXO3, Bax and caspase-3 are upregulated but Bcl-2 is downregulated in SGC-7901 cells following inhibitor transfection

The expression of FOXO3, Bax, caspase-3 and Bcl-2 in SGC-7901 cells was assessed following miR-629 inhibitor transfection. The results demonstrated that the expression of FOXO3, Bax and caspase-3 mRNA was significantly increased in the inhibitor group compared with the control group. Additionally, Bcl-2 expression was significantly decreased in the inhibitor group compared with the control group (Fig. 5A-D). Furthermore, western blot analysis revealed that protein expression was consistent with that of mRNA (Fig. 5E and F). These results indicate that the miR-629 inhibitor downregulates Bcl-2 and upregulates the expression of FOXO3, Bax and caspase-3.

Figure 5.

miR-629 inhibitor transfection upregulates FOXO3, Bax and caspase-3, and downregulates Bcl-2 in SGC-7901 cells. The expression of (A) FOXO3, (B) Bax, (C) Bcl-2 and (D) caspase-3 mRNA was determined using a reverse transcription-quantitative polymerase chain reaction assay. (E) The protein level of FOXO3, Bax, Bcl-2 and caspase-3 was determined using western blotting. (F) Quantification of western blotting results. **P<0.01 vs. the control group miR, microRNA; FOXO3, forkhead box O3; Bax, Bcl-2 associated x; Bcl-2, B-cell lymphoma 2; control, non-transfected group; NC, transfected with negative control plasmids; inhibitor, transfected with miR-629 inhibitor plasmids.

Luciferase reporter assay for target verification

TargetScan was utilized to predict the target of miR-629. The results revealed that FOXO3 was a target of miR-629 due to binding at the 3′UTR of FOXO3 (Fig. 6A). The luciferase activity significantly reduced in the FOXO3 3′UTR-WT group compared with the negative control group. Furthermore, there was no significant difference between the negative control group and the FOXO3 3′UTR-MUT group (Fig. 6B). These results indicate that FOXO3 is the direct target of miR-629.

Figure 6.

miR-629 target verification via a luciferase reporter assay. (A) TargetScan predicted the binding site (underlined) of miR-629 and the 3′-UTR of FOXO3 mRNA. (B) Luciferase activity following plasmid transfection. **P<0.01 vs. the negative control group. miR, microRNA; FOXO3, forkhead box O3; UTR, untranslated region; NC, negative control; miR-629 group, miR-629 overexpression plasmid; WT (wild-type), transfected with wild-type FOXO3 3′UTR; MUT (mutant), transfected with mutated FOXO3 3′UTR.

Discussion

In congruence with a study by Shin et al (7) the present study demonstrated that miR-629 is overexpressed and FOXO3 is significantly downregualted in GC. Furthermore, a study by Xiong et al (24) revealed that sphingosine kinase 1 induces the phosphorylation of FOXO3 and subsequent downregulation of translational activity, resulting in phosphoinositide 3-kinase/protein kinase B signaling. Further studies should therefore assess the factors that affect the expression of FOXO3 in GC. The results of the current study revealed that miR-629 binds to FOXO3 and that the decreased expression of the latter may be induced by GC. It has been demonstrated that miR-629 promotes the progression of human pancreatic cancer by targeting FOXO3, resulting in enhanced pancreatic carcinoma cell proliferation and invasion (18). The present study also demonstrated that downregulated miR-629 suppressed SGC-7901 cell proliferation.

FOXO3 transcription factors are an evolutionarily conserved subfamily of the forkhead transcription factors, which are characterized by a forkhead DNA-binding domain (25). The FOXO subfamily comprises FOXO1, FOXO3, FOXO4 and FOXO6 (26). Furthermore, the mediation of these transcription factors is determined by the availability of certain growth factors, such as insulin and tumor necrosis factor α (26,27). In addition, it has been revealed that FOXO transcription factors exert regulatory effects on cell growth, the cell cycle, apoptosis and defense against oxidative stress (28). The current study demonstrated that the expression of FOXO3, Bax and caspase-3 was upregulated and that Bcl-2 expression was suppressed, which was consistent with the apoptosis results. These results indicate that suppressed miR-629 upregulated the expression of FOXO3, and promoted cell apoptosis by reducing the expression of Bcl-2, and increasing BAX and Caspase 3 expression. A recent study has revealed that cyclin-dependent kinase 6 protects against epithelial ovarian cancer by regulating FOXO3 and promoting cell death (29).

The present study also revealed that miR-629 targets FOXO3, resulting in the reduced expression of FOXO3 and the progression of GC. The results further demonstrated that the miR-629 inhibitor reduced cell proliferation and promoted cell apoptosis. The expression of apoptosis-associated proteins was also assessed and the results of western blotting indicated that cell apoptosis activity had increased. Furthermore, the current study revealed that miR-629 binds to the 3′UTR Of FOXO3, indicating that it is a target of miR-629. Studies have demonstrated that various miRNAs, including miR-223, miR-122 and miR-451 are associated with the progression, migration and invasion of GC cell (30,31). However, miR-223 also enhanced chemosensitivity and promoted the apoptosis of GC cells by targeting FOXO3 (32). Additionally, TargetScan has revealed that FOXO3 is the target of miR-629. Pancreatic β cells and non-small cell lung cancer cells were also revealed to be influenced by the sirtuin 1/FOXO3 and AMP-activated protein kinase/FOXO3 signaling pathway (33,34). Therefore, the impact of various additional factors, such as transcription factors and epithelial-mesenchymal transition factors, on the expression of FOXO3 and thus the progression of GC should be assessed in the future.

In summary, the current study revealed that miR-629 was upregulated in GC and that the inhibition of miR-629 resulted in an increase in FOXO3 expression. Furthermore, upregulated FOXO3 in SGC-7901 cells transfected with the miR-629 inhibitor may have promoted the expression of Bax and caspase-3, and suppressed the expression of Bcl-2, resulting in the repression of cell proliferation and the promotion of cell apoptosis. In addition, the luciferase reporter assay determined that FOXO3 is a direct target of miR-629. Thus, miR-629 may serve essential roles in cell proliferation and apoptosis in GC. Furthermore the inhibition of miR-629 may be an effective therapy for patients with GC in the future.

Acknowledgements

Not applicable.

Funding

No funding received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

ML drafted the manuscript. ML, YW and XL analyzed the results and data, and collected materials. ZZ and LW conducted the experiments. YL conceived of and designed the study, and revised the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The current study was approved by the Ethics Committee of The First Hospital of Shijiazhuang City (Shijiazhuang City, China). All patients provided their written informed consent.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Bertuccio P, Chatenoud L, Levi F, Praud D, Ferlay J, Negri E, Malvezzi M and La Vecchia C: Recent patterns in gastric cancer: A global overview. Int J Cancer. 125:666–673. 2009. View Article : Google Scholar : PubMed/NCBI

2 

Cha Y, He Y, Ouyang K, Xiong H, Li J and Yuan X: MicroRNA-140-5p suppresses cell proliferation and invasion in gastric cancer by targeting WNT1 in the WNT/β-catenin signaling pathway. Oncol Lett. 16:6369–6376. 2018.PubMed/NCBI

3 

Hamashima C: Current issues and future perspectives of gastric cancer screening. World J Gastroenterol. 20:13767–13774. 2014. View Article : Google Scholar : PubMed/NCBI

4 

He Z, Wang X, Huang C, Gao Y, Yang C, Zeng P and Chen Z: The FENDRR/miR-214-3P/TET2 axis affects cell malignant activity via RASSF1A methylation in gastric cancer. Am J Transl Res. 10:3211–3223. 2018.PubMed/NCBI

5 

Yang Y, Shen J, Yan D, Yuan B, Zhang S, Wei J and Du T: Euchromatic histone lysine methyltransferase 1 regulates cancer development in human gastric cancer by regulating E-cadherin. Oncol Lett. 15:9480–9486. 2018.PubMed/NCBI

6 

Correa P: Gastric cancer: Overview. Gastroenterol Clin North Am. 42:211–217. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Shin VY, Ng EK, Chan VW, Kwong A and Chu KM: A three-miRNA signature as promising non-invasive diagnostic marker for gastric cancer. Mol Cancer. 14:2022015. View Article : Google Scholar : PubMed/NCBI

8 

Orditura M, Galizia G, Sforza V, Gambardella V, Fabozzi A, Laterza MM, Andreozzi F, Ventriglia J, Savastano B, Mabilia A, et al: Treatment of gastric cancer. World J Gastroenterol. 20:1635–1649. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Wu HH, Lin WC and Tsai KW: Advances in molecular biomarkers for gastric cancer: miRNAs as emerging novel cancer markers. Expert Rev Mol Med. 16:e12014. View Article : Google Scholar : PubMed/NCBI

10 

Wang LK, Xie XN, Song XH, Su T, Chang XL, Xu M, Liang B and Huang DY: Upregulation of miR-200b inhibits hepatocellular carcinoma cell proliferation and migration by targeting HMGB3 protein. Technol Cancer Res Treat. 17:15330338188064752018. View Article : Google Scholar : PubMed/NCBI

11 

Lan H, Lu H, Wang X and Jin H: MicroRNAs as potential biomarkers in cancer: Opportunities and challenges. Biomed Res Int. 2015:1250942015. View Article : Google Scholar : PubMed/NCBI

12 

Van Schooneveld E, Wildiers H, Vergote I, Vermeulen PB, Dirix LY and Van Laere SJ: Dysregulation of microRNAs in breast cancer and their potential role as prognostic and predictive biomarkers in patient management. Breast Cancer Res. 17:212015. View Article : Google Scholar : PubMed/NCBI

13 

Wang Y, Zhang S, Bao H, Mu S, Zhang B, Ma H and Ma S: MicroRNA-365 promotes lung carcinogenesis by downregulating the USP33/SLIT2/ROBO1 signaling pathway. Cancer Cell Int. 18:642018. View Article : Google Scholar : PubMed/NCBI

14 

Liu HS and Xiao HS: MicroRNAs as potential biomarkers for gastric cancer. World J Gastroenterol. 20:12007–12017. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Wang M, Gu H, Qian H, Zhu W, Zhao C, Zhang X, Tao Y, Zhang L and Xu W: miR-17-5p/20a are important markers for gastric cancer and murine double minute 2 participates in their functional regulation. Eur J Cancer. 49:2010–2021. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Sun C, Yao X, Jiang Q and Sun X: miR-106b targets DAB2 to promote hepatocellular carcinoma cell proliferation and metastasis. Oncol Lett. 16:3063–3069. 2018.PubMed/NCBI

17 

Liu LJ, Yu JJ and Xu XL: MicroRNA-93 inhibits apoptosis and promotes proliferation, invasion and migration of renal cell carcinoma ACHN cells via the TGF-β/Smad signaling pathway by targeting RUNX3. Am J Transl Res. 9:3499–3513. 2017.PubMed/NCBI

18 

Yan H, Li Q, Wu J, Hu W, Jiang J, Shi L, Yang X, Zhu D, Ji M and Wu C: MiR-629 promotes human pancreatic cancer progression by targeting FOXO3. Cell Death Dis. 8:e31542017. View Article : Google Scholar : PubMed/NCBI

19 

Di Vincenzo S, Heijink IH, Noordhoek JA, Cipollina C, Siena L, Bruno A, Ferraro M, Postma DS, Gjomarkaj M and Pace E: SIRT1/FoxO3 axis alteration leads to aberrant immune responses in bronchial epithelial cells. J Cell Mol Med. 22:2272–2282. 2018. View Article : Google Scholar : PubMed/NCBI

20 

Kim SY, Kim HJ, Byeon HK, Kim DH and Kim CH: FOXO3 induces ubiquitylation of AKT through MUL1 regulation. Oncotarget. 8:110474–110489. 2017. View Article : Google Scholar : PubMed/NCBI

21 

Yu S, Yu Y, Zhang W, Yuan W, Zhao N, Li Q, Cui Y, Wang Y, Li W, Sun Y and Liu T: FOXO3a promotes gastric cancer cell migration and invasion through the induction of cathepsin L. Oncotarget. 7:34773–34784. 2016.PubMed/NCBI

22 

Park SH, Jang KY, Kim MJ, Yoon S, Jo Y, Kwon SM, Kim KM, Kwon KS, Kim CY and Woo HG: Tumor suppressive effect of PARP1 and FOXO3A in gastric cancers and its clinical implications. Oncotarget. 6:44819–44831. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Xiong H, Wang J, Guan H, Wu J, Xu R, Wang M, Rong X, Huang K, Huang J, Liao Q, et al: SphK1 confers resistance to apoptosis in gastric cancer cells by downregulating Bim via stimulating Akt/FoxO3a signaling. Oncol Rep. 32:1369–1373. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Ho KK, Myatt SS and Lam EW: Many forks in the path: Cycling with FoxO. Oncogene. 27:2300–2311. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Hagenbuchner J, Kuznetsov A, Hermann M, Hausott B, Obexer P and Ausserlechner MJ: FOXO3-induced reactive oxygen species are regulated by BCL2L11 (Bim) and SESN3. J Cell Sci. 125:1191–1203. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Essers MA, Weijzen S, de Vries-Smits AM, Saarloos I, de Ruiter ND, Bos JL and Burgering BM: FOXO transcription factor activation by oxidative stress mediated by the small GTPase Ral and JNK. EMBO J. 23:4802–4812. 2004. View Article : Google Scholar : PubMed/NCBI

28 

Zhang X, Tang N, Hadden TJ and Rishi AK: Akt, FoxO and regulation of apoptosis. Biochim Biophys Acta. 1813:1978–1986. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Dall' Acqua A, Sonego M, Pellizzari I, Pellarin I, Canzonieri V, D'Andrea S, Benevol S, Sorio R, Giorda G, Califano D, et al: CDK6 protects epithelial ovarian cancer from platinum-induced death via FOXO3 regulation. EMBO Mol Med. 9:1415–1433. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Yang F, Xu Y, Liu C, Ma C, Zou S, Xu X, Jia J and Liu Z: NF-κB/miR-223-3p/ARID1A axis is involved in Helicobacter pylori CagA-induced gastric carcinogenesis and progression. Cell Death Dis. 9:122018. View Article : Google Scholar : PubMed/NCBI

31 

Xu X, Gao F, Wang J, Tao L, Ye J, Ding L, Ji W and Chen X: MiR-122-5p inhibits cell migration and invasion in gastric cancer by down-regulating DUSP4. Cancer Biol Ther. 19:427–435. 2018. View Article : Google Scholar : PubMed/NCBI

32 

Feng Q, He P and Wang Y: MicroRNA-223-3p regulates cell chemo-sensitivity by targeting FOXO3 in prostatic cancer. Gene. 658:152–158. 2018. View Article : Google Scholar : PubMed/NCBI

33 

Wang N, Zhang J, Qin M, Yi W, Yu S, Chen Y, Guan J and Zhang R: Amelioration of streptozotocin-induced pancreatic β cell damage by morin: Involvement of the AMPK-FOXO3-catalase signaling pathway. Int J Mol Med. 41:1409–1418. 2018.PubMed/NCBI

34 

Li J, Li P, Chen T, Gao G, Chen X, Du Y, Zhang R, Yang R, Zhao W, Dun S, et al: Expression of microRNA-96 and its potential functions by targeting FOXO3 in non-small cell lung cancer. Tumour Biol. 36:685–692. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li M, Wang Y, Liu X, Zhang Z, Wang L and Li Y: miR‑629 targets FOXO3 to promote cell apoptosis in gastric cancer. Exp Ther Med 19: 294-300, 2020.
APA
Li, M., Wang, Y., Liu, X., Zhang, Z., Wang, L., & Li, Y. (2020). miR‑629 targets FOXO3 to promote cell apoptosis in gastric cancer. Experimental and Therapeutic Medicine, 19, 294-300. https://doi.org/10.3892/etm.2019.8168
MLA
Li, M., Wang, Y., Liu, X., Zhang, Z., Wang, L., Li, Y."miR‑629 targets FOXO3 to promote cell apoptosis in gastric cancer". Experimental and Therapeutic Medicine 19.1 (2020): 294-300.
Chicago
Li, M., Wang, Y., Liu, X., Zhang, Z., Wang, L., Li, Y."miR‑629 targets FOXO3 to promote cell apoptosis in gastric cancer". Experimental and Therapeutic Medicine 19, no. 1 (2020): 294-300. https://doi.org/10.3892/etm.2019.8168
Copy and paste a formatted citation
x
Spandidos Publications style
Li M, Wang Y, Liu X, Zhang Z, Wang L and Li Y: miR‑629 targets FOXO3 to promote cell apoptosis in gastric cancer. Exp Ther Med 19: 294-300, 2020.
APA
Li, M., Wang, Y., Liu, X., Zhang, Z., Wang, L., & Li, Y. (2020). miR‑629 targets FOXO3 to promote cell apoptosis in gastric cancer. Experimental and Therapeutic Medicine, 19, 294-300. https://doi.org/10.3892/etm.2019.8168
MLA
Li, M., Wang, Y., Liu, X., Zhang, Z., Wang, L., Li, Y."miR‑629 targets FOXO3 to promote cell apoptosis in gastric cancer". Experimental and Therapeutic Medicine 19.1 (2020): 294-300.
Chicago
Li, M., Wang, Y., Liu, X., Zhang, Z., Wang, L., Li, Y."miR‑629 targets FOXO3 to promote cell apoptosis in gastric cancer". Experimental and Therapeutic Medicine 19, no. 1 (2020): 294-300. https://doi.org/10.3892/etm.2019.8168
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team