Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
April-2020 Volume 19 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2020 Volume 19 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Transcriptome sequencing reveals dynamic changes in matrix metalloproteinases in facet joint osteoarthritis

  • Authors:
    • Chu Chen
    • Guanhua Xu
    • Yuyu Sun
    • Zhiming Cui
  • View Affiliations / Copyright

    Affiliations: Department of Spine Surgery, The Second Affiliated Hospital of Nantong University, Nantong, Jiangsu 226001, P.R. China
    Copyright: © Chen et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2475-2482
    |
    Published online on: February 4, 2020
       https://doi.org/10.3892/etm.2020.8488
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Osteoarthritis is a general joint disease characterized by articular cartilage degeneration. The extracellular matrix is a principal component in articular cartilage. The dynamic remodeling of the extracellular matrix is involved in the pathological degradation of the articular cartilage. Facet joint osteoarthritis (FJOA) is a common form of osteoarthritis that occurs in the posterior aspect of the vertebral column. However, to the best of our knowledge, the current understanding of the genetic changes in FJOA is limited. The most significantly differentially expressed genes and Gene Ontology categories in FJOA were identified by transcriptome sequencing analysis. The extracellular matrix, matrix metalloproteinases (MMPs) and proteinases of the extracellular matrix were highly involved in FJOA. The canonical signaling pathway ‘inhibition of matrix metalloproteinases’ was further studied in detail by identifying and validating differentially expressed genes in the signaling pathway. Taken together, the present study revealed changes in MMP‑related genes in FJOA and showed the importance of extracellular matrix remodeling in FJOA from a genetic aspect.

Introduction

Osteoarthritis is a common joint disease mainly characterized by the degeneration and breakdown of articular cartilage, the formation of osteophytes and subchondral cysts, and the thickening of subchondral bone (1). Articular cartilage is a resilient and smooth tissue that covers and protects the ends of bones in joints, and primarily consists of a dense extracellular matrix with no blood vessels, lymphatic vessels or nerves, with a sparse chondrocyte population (2,3).

The extracellular matrix is a multifaceted meshwork of proteoglycans, polysaccharides and proteins secreted by resident supporting cells. The extracellular matrix not only represents a critical structural component of articular cartilage, but is also involved in the pathological degradation of articular cartilage (4-6). Physical and biochemical alterations in the extracellular matrix may elicit numerous signaling events by communicating with the intracellular cytoskeleton, stimulating chondrocyte responses and thus inducing osteoarthritis (7-9). The dynamic remodeling and homeostasis of the extracellular matrix is regulated by a variety of proteinases, especially proteinases in the matrix metalloproteinase (MMP) family (10,11).

Facet joint osteoarthritis (FJOA) is a common form of osteoarthritis that occurs in the facet joints located in the posterior aspect of the vertebral column (12). However, to the best of our knowledge, FJOA is not as well studied as other forms of osteoarthritis, such as hip osteoarthritis and knee osteoarthritis. Efforts have been made to examine the anatomy, biomechanics, epidemiology and clinical manifestations of FJOA (13). The expression of key molecules in the degenerative process of facet joints such as MMP13, tumor necrosis factor-a and interleukin-6 have also been identified (14). A previous study determined the molecular changes in FJOA by collecting human facet joint tissues from healthy controls and patients with FJOA and conducting transcriptome sequencing (15).

The current study investigated the expression profiles of genes in healthy controls and patients with FJOA by filtering genes with the most significant fold-changes and screening the most enriched Gene Ontology (GO) categories. Analysis results showed that MMP12, a member of the MMP family, was the most downregulated gene in FJOA. In addition, many enriched GO categories were related to the extracellular matrix. Therefore, the canonical signaling pathway ‘inhibition of matrix metalloproteinases’ was investigated through the joint use of Ingenuity Pathway Analysis (IPA) software, heatmap and hierarchical cluster analysis, and reverse transcription-quantitative PCR (RT-qPCR) validation to study the involvement of MMPs in FJOA.

Materials and methods

Facet joint tissue collection and transcriptome sequencing

Human facet joint tissues were collected from 48 patients with FJOA (FJOA group) and 10 healthy patients with vertebral fractures (control group) as previously described (15). Magnetic resonance imaging was applied to determine the degree of cartilage degeneration. The facet joint tissues of patients in the FJOA group were of Grade 2 (moderate degeneration) and Grade 3 (severe degeneration), while the facet joint tissue of patients in the control group was of Grade 0 (normal) and Grade 1 (mild degeneration) (16). Patients with infection, inflammatory diseases or autoimmune diseases were excluded from the current study. The present study was ethically approved by the Human Ethics Committee of the Second Affiliated Hospital of Nantong University. All participants provided written informed consent.

Facet joint tissues from the FJOA and control groups were divided into three parts for technical repetitions for subsequent RNA isolation and sequencing experiments. Total RNA was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Extracted total RNA was used to fragment RNA and synthesize cDNA. A cDNA library was amplified and sequenced using a Hiseq X Ten sequencing platform (Illumina, Inc.) to produce raw reads. Dirty reads were filtered to obtain clean reads. Clean reads were then mapped to the reference genome using TopHat v2.1.1 (https://ccb.jhu.edu/software/tophat/index.shtml) (17,18).

Bioinformatics analysis

Transcriptome sequencing data were used to identify the fragments per kilobase of transcript per million mapped reads (FPKM) values of each gene. The FPKM values of genes in the FJOA group were compared with the FPKM values in the control group to screen differentially expressed genes with a fold-change >2 or <-2 (log2 ratio >1 or <-1) and a q-value (adjusted P-value) <0.05. The Database for Annotation, Visualization, and Integrated Discovery (DAVID) 6.7 (https://david.ncifcrf.gov/) was used to enrich differentially expressed genes to GO categories (19-21). IPA software (2018 release Qiagen, Inc.) was used to analyze the canonical signaling pathway ‘inhibition of matrix metalloproteinases’. Heatmap and hierarchical cluster analyses were performed using R v2.13.0 (https://www.r-project.org/) to display the expression patterns of differentially expressed genes.

RT-qPCR

RT-qPCR was conducted to validate transcriptome sequencing outcomes. RNA samples were first reverse transcribed to cDNA using the PrimeScript RT Reagent kit (Takara Biotechnology Co., Ltd.) according to the manufacturer's protocol. qPCR was performed using SYBR Premix Ex Taq (Takara Biotechnology Co., Ltd) on a StepOnePlus Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The following thermocycling conditions were used for the PCR: Initial denaturation at 95˚C for 5 min; 40 cycles of 95˚C at 30 sec, 45 sec at 56.5˚C and 72˚C for 30 sec; and a final extension at 72˚C for 5 min. The relative expression of target genes MMP7, disintegrin and metalloproteinase domain-containing protein 12 (ADAM12), tissue inhibitor of metalloproteinases 3 (TIMP3) and TIMP4 were calculated using the 2-ΔΔCq method with GAPDH as the internal reference gene (22). The sequences of primers pairs used in the qPCR are listed in Table I.

Table I

Primer pairs for reverse transcription-quantitative PCR.

Table I

Primer pairs for reverse transcription-quantitative PCR.

GenePrimerSequence (5'-3')
MMP7Forward AGCAGCTATGCAGCTGGCCGT
 Reverse GCCCTGAGCCTGTTCCCACTGC
ADAM12Forward TCTTGCTGCCGGATTTGTGGTT
 Reverse AAGGGCGCACACACCTTAGTTT
TIMP3Forward AGGACGCCTTCTGCAAC
 Reverse CTCCTTTACCAGCTTCTTCC
TIMP4Forward ACCTGTCCTTGGTGCAGA
 Reverse TGTAGCAGGTGGTGATTTGG
GAPDHForward CCAAGGTCATCCATGACAAC
 Reverse TGTCATACCAGGAAATGAGC

[i] MMP7, matrix metalloproteinase 7; ADAM12, disintegrin and metalloproteinase domain-containing protein 12; TIMP, tissue inhibitor of metalloproteinases.

Statistical analysis

Data are presented as the mean ± SEM and were analyzed using GraphPad Prism 5.0 (GraphPad Software, Inc.). Student's t-test was used to compare differences between the FJOA and control groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Identification of the most differentially expressed genes in FJOA

Previous transcriptome sequencing determined the expression levels of >19,000 genes in human facet joint tissues in both FJOA and control groups (15). To obtain a global view of the expression patterns of identified genes, the Heatmap function in the software platform R (v.2.13.0) was used to draw a heatmap of gene expression (Fig. 1). The Euclidean distance was calculated using the Hierarchical Clustering module from GenePattern (https://software.broadinstitute.org/cancer/software/genepattern/) to cluster the identified genes (Fig. 1) (23). Parallelizing hierarchical clustering methods were used to study the gene expression profiles in the three control group replicates (CTRL1, CTRL2 and CTRL3) and three FJOA group replicates (FJOA1, FJOA2 and FJOA3) (Fig. 1). Compared with genes in the control group, a smaller number of genes in the FJOA group were upregulated while a relatively large number of genes were downregulated.

Figure 1.

Expression patterns of genes in healthy and lesioned facet joint tissues. The expression levels of genes are shown in a heatmap and indicated by a color bar. Red indicates upregulated genes while blue indicates downregulated genes.

A detailed investigation of these differentially expressed genes showed that the expression level of the most upregulated gene in FJOA, corticotropin releasing hormone receptor 1 (CRHR1), was elevated >28.8 fold (log2 ratio=4.85) compared with the control group. The expression level of the most downregulated gene, MMP12, was reduced to ~1/14 of its expression level compared with the control group (log2 ratio=-3.86). The 10 most upregulated and downregulated genes in FJOA are listed in Table II.

Table II

Top 10 upregulated and downregulated genes in FJOA.

Table II

Top 10 upregulated and downregulated genes in FJOA.

A, Upregulated
GeneIDCTRL_FPKMFJOA_FPKMlog2 (FJOA/CTRL)q-valueDescription
CRHR10.0223030.6432324.850030.00463Corticotropin releasing hormone receptor 1
CSF30.2302993.218253.804690.000259Colony stimulating factor 3
CRLF16.2462481.34323.702960.000259Cytokine receptor like factor 1
DAW10.0902341.128193.64420.022496Dynein assembly factor with WD repeats 1
HAS12.9001135.06713.595940.000259Hyaluronan synthase 1
POSTN23.7872265.4813.480350.000259Periostin
TMEM59L0.1817241.784163.295420.005947Transmembrane protein 59 like
PVRL40.1701131.613623.245740.000259Poliovirus receptor-related protein 4
LINC007020.9240588.507543.202690.002128Long intergenic non-protein coding RNA 702
HMCN20.1583591.368913.111760.000259Hemicentin 2
B, Downregulated
GeneIDCTRL_FPKMFJOA_FPKMlog2 (FJOA/CTRL)q-valueDescription
MMP121.57770.10857-3.861120.013616Matrix metallopeptidase 12
HBG157.95514.16107-3.799910.000259Hemoglobin subunit γ1
SPIC2.637170.231806-3.5080.00394Spi-c transcription factor
TPSB28.409670.772965-3.443570.000259Tryptase β2 (gene/pseudogene)
SEC14L30.5969550.059692-3.322010.007555Sec14 like lipid binding 3
PYHIN12.779760.280398-3.309420.000259Pyrin and hin domain family member 1
CHI3L11078.35114.902-3.230360.000259Chitinase 3 like 1
CD191.22140.131175-3.218970.004793Cd19 molecule
GP53.144070.360364-3.125110.000259Glycoprotein v platelet
GPR151.431980.166889-3.101060.033956G protein-coupled receptor 15

[i] FPKM, fragments per kilobase of transcript per million mapped reads; FJOA, facet joint osteoarthritis; CTRL, control.

Identification of most enriched GO categories in FJOA

To have a better understanding of the molecular mechanisms underlying FJOA, the DAVID database was used to group differentially expressed genes into GO biological processes, molecular functions and cellular components (Fig. 2). The ten most enriched GO biological processes were associated with the response of the organism (‘response to stress’ and ‘response to stimulus’), immune response (‘regulation of immune system process’, ‘positive regulation of immune system process’, ‘immune system process’, ‘immune response’ and ‘defense response’) and cellular behaviors (‘cell adhesion’, ‘cell activation’ and ‘biological adhesion’). The significant involvement of the immune response was consistent with the high expression of CRHR1 observed in FJOA tissue, as CRHR1 is essential for the activation of various signaling pathways that regulate the immune response. The ten most enriched GO molecular functions were mainly related to molecular binding, while the ten most enriched GO cellular components included various components, especially those involving the extracellular matrix such as ‘proteinaceous extracellular matrix’, ‘extracellular space’, ‘extracellular region part’, ‘extracellular region’ and ‘extracellular matrix’.

Figure 2.

Top enriched GO categories in facet joint osteoarthritis. The ten most enriched GO biological processes, molecular functions and cellular components. Red represents GO biological processes, blue represents GO molecular functions and green represents GO cellular components. GO, gene ontology.

Analysis of the canonical signaling pathway ‘inhibition of matrix metalloproteinases’

GO cellular component analysis showed that the extracellular matrix was highly associated with FJOA. In addition, MMP12, a gene that encodes for an enzyme involved in the breakdown of the extracellular matrix, was most significantly downregulated in FJOA. The results of the bioinformatics analysis suggested that dysregulated MMPs and the resulting modulated extracellular matrix might be critical in the pathological process of FJOA. Therefore, IPA bioinformatics analysis was performed to identify the involvement of the canonical signaling pathway ‘inhibition of matrix metalloproteinases’ in FJOA.

The schematic diagram of the canonical signaling pathway ‘inhibition of matrix metalloproteinases’ is shown in Fig. 3. MMPs are calcium-dependent zinc-containing endopeptidases that are critical for the modulation of both cell-cell and cell-extracellular matrix interactions (24). These MMPs are tightly regulated at multiple levels, including gene transcription, enzyme activation and inhibitor inactivation (25). TIMPs are a family of protease inhibitors comprising TIMP1, TIMP2, TIMP3 and TIMP4. TIMPs form non-covalent bonds with the latent and active forms of MMPs with a 1:1 stoichiometry and thus inhibit the activity of MMPs (26). Members of the ADAM family, such as ADAM10, ADAM12 and ADAM13 also regulate cell adhesion and mediate the extracellular matrix (27) (Fig. 3).

Figure 3.

Schematic diagram of the canonical signaling pathway ‘inhibition of matrix metalloproteinases’. Differentially expressed genes in the canonical signaling pathway ‘inhibition of matrix metalloproteinases’ are represented in red and green. Red indicates upregulated genes while green indicates downregulated genes. TIMP, tissue inhibitor of metalloproteinases; MMP, matrix metalloproteinase; RECK, reversion-inducing cysteine-rich protein with Kazal motifs; HSPG, basement membrane-specific heparan sulfate proteoglycan core protein; ADAM, disintegrin and metalloproteinase domain-containing protein; TSP2, thrombospondin-2; A2M, α-2-macroglobulin; TFPI2, tissue factor pathway inhibitor 2; LRP1, prolow-density lipoprotein receptor-related protein 1; MT1-MMP, matrix metallopeptidase 14 (membrane-inserted).

Upregulated and downregulated genes in the canonical signaling pathway ‘inhibition of matrix metalloproteinases’ in FJOA are labeled in red and green, respectively (Fig. 3). The expression levels of genes in the pathway are shown in Table III. Heatmap and relevant hierarchical clustering analyses were performed to illustrate the expression levels of genes in the FJOA and control groups (Fig. 4). Most members of the MMP family (including MMP12, MMP9, MMP3, MMP16, MMP7, MMP8 and MMP25) were significantly downregulated in FJOA compared with controls. Meanwhile, MMP23B was upregulated and the expression levels of other members of the MMP family were not significantly altered compared with controls. ADAM12 and MMP inhibitors TIMP3 and TIMP4 were upregulated in FJOA compared with controls.

Figure 4.

Heatmap of differentially expressed genes in the canonical signaling pathway ‘inhibition of matrix metalloproteinases’. Red indicates upregulated genes while green indicates downregulated genes. CTRL, control group; FJOA, facet joint osteoarthritis; TIMP, tissue inhibitor of metalloproteinases; MMP, matrix metalloproteinase; RECK, reversion-inducing cysteine-rich protein with Kazal motifs; HSPG, basement membrane-specific heparan sulfate proteoglycan core protein; ADAM, disintegrin and metalloproteinase domain-containing protein; TSP2, thrombospondin-2; A2M, α-2-macroglobulin; TFPI2, tissue factor pathway inhibitor 2; LRP1, prolow-density lipoprotein receptor-related protein 1.

Table III

Expression levels of differentially expressed genes in the canonical signaling pathway ‘inhibition of matrix metalloproteinases’.

Table III

Expression levels of differentially expressed genes in the canonical signaling pathway ‘inhibition of matrix metalloproteinases’.

GeneIDCTRL_FPKMFJOA_FPKMlog2 (FJOA/CTRL)q-valueDescription
A2M152.6144.685-0.076840.580386 α-2-macroglobulin
ADAM1023.191118.2402-0.346450.00269Disintegrin and metalloproteinase domain-containing protein 10
ADAM125.9005219.13021.696940.000259Disintegrin and metalloproteinase domain-containing protein 12
ADAM1712.84512.1117-0.084810.581591Disintegrin and metalloproteinase domain-containing protein 17
HSPG279.3027132.2420.7377380.000259Basement membrane-specific heparan sulfate proteoglycan core protein
LRP1251.144326.9120.380390.012286Prolow-density lipoprotein receptor-related protein 1
MMP2108.741175.4850.6904520.000259Matrix metalloproteinase 2
MMP9314.45791.4777-1.781370.000259Matrix metalloproteinase 9
MMP171.170061.487010.3458230.353116Matrix metalloproteinase 17
MMP115.509448.168290.5681280.001552Matrix metalloproteinase 11
MMP3373.253167.156-1.158960.000259Matrix metalloproteinase 3
MMP196.3808910.8530.7662620.000497Matrix metalloproteinase 19
MMP13125.36175.5355-0.730860.000259Matrix metalloproteinase 13
MMP282.483864.401470.8253990.026506Matrix metalloproteinase 28
MMP23B0.044040.8287434.234050.247905Matrix metalloproteinase 23B
MMP1474.0875118.2020.6739530.000259Matrix metalloproteinase 14
MMP241.219041.343620.140380.778023Matrix metalloproteinase 24
MMP837.994514.832-1.357080.000259Matrix metalloproteinase 8
MMP16.788864.20773-0.690130.493474Matrix metalloproteinase 1
MMP121.57770.10857-3.861120.013616Matrix metalloproteinase 12
MMP151.656032.414860.544210.016667Matrix metalloproteinase 15
MMP169.423334.70063-1.003380.000259Matrix metalloproteinase 16
MMP72.133411.03658-1.041330.028971Matrix metalloproteinase 7
MMP256.067052.5246-1.264940.000259Matrix metalloproteinase 25
RECK9.3344814.48330.6337490.000259Reversion-inducing cysteine-rich protein with Kazal motifs
TFPI20.9734820.789919-0.301450.53558Tissue factor pathway inhibitor 2
TIMP1322.419227.107-0.505570.000259Tissue inhibitor of metalloproteinases 1
TIMP2216.411377.860.8040780.000259Tissue inhibitor of metalloproteinases 2
TIMP391.4082261.0771.514080.000259Tissue inhibitor of metalloproteinases 3
TIMP427.884857.95261.055390.000259Tissue inhibitor of metalloproteinases 4
TSP237.762973.79390.9665340.000259 Thrombospondin-2

[i] FPKM, fragments per kilobase of transcript per million mapped reads; FJOA, facet joint osteoarthritis; CTRL, control.

Validation using RT-qPCR

RT-qPCR experiments were further conducted to measure the expression of genes in FJOA and control groups in order to validate transcriptome sequencing results. Representative genes in the canonical signaling pathway ‘inhibition of matrix metalloproteinases’, MMP7, ADAM12, TIMP3 and TIMP4 were selected for RT-qPCR experiments (Fig. 5). Consistent with the transcriptome sequencing results, the expression levels of MMP7 were significantly downregulated in the FJOA group compared with the control group. By contrast, the expression levels of ADAM12, TIMP3 and TIMP4 were significantly higher in the FJOA group as compared with the control group (Fig. 5).

Figure 5.

Reverse transcription-quantitative PCR analysis of differentially expressed genes in the canonical signaling pathway ‘inhibition of matrix metalloproteinases’. The relative expression levels of MMP7, ADAM12, TIMP3 and TIMP4 were calculated. The red arrows indicate the expression trends of genes, as revealed by sequencing. Data were summarized from three independent experiments. *P<0.05 vs. control. FJOA, facet joint osteoarthritis; MMP7, matrix metalloproteinase 7; ADAM12, disintegrin and metalloproteinase domain-containing protein 12; TIMP, tissue inhibitor of metalloproteinases.

Discussion

In the current study, transcriptome sequencing outcomes from human facet joint tissues in FJOA patients and healthy controls were analyzed. The ten most significantly upregulated and downregulated genes were identified and the ten most enriched GO biological processes, molecular functions and cellular components were categorized. The analytical results showed that the extracellular matrix was robustly involved in the genetic changes involved in FJOA. MMP12, a calcium-dependent zinc-containing endopeptidase capable of degrading the extracellular matrix, was the most downregulated gene in FJOA. CRHR1, which encodes a G-protein coupled receptor that binds neuropeptides of the corticotropin releasing hormone family that are major regulators of the hypothalamic-pituitary-adrenal pathway, was the most differentially expressed gene in FJOA. From a gene expression aspect, the results suggested that modulation of the extracellular matrix is a critical biological process in FJOA, and the CRHR1-regulated immune response might be critical in the development of FJOA. Treatments targeting CRHR1 and MMP might be potential therapeutic methods. Therefore, gene changes in the canonical signaling pathway ‘inhibition of matrix metalloproteinases’ were examined. Heatmap analysis and RT-qPCR experiments illustrated that several genes in ‘inhibition of matrix metalloproteinases’, especially MMPs and TIMPs, were dysregulated in FJOA.

The extracellular matrix is a non-cellular meshwork of extracellular molecules that provides a three-dimensional physical and mechanical support for surrounding cells (28). The extracellular matrix is highly dynamic and is continuously remodeled by matrix-degrading enzymes under various physiological and pathological conditions, including cell migration, cell differentiation, cell growth, wound healing and fibrosis (28-31). The remodeling of the extracellular matrix is principally mediated by MMPs (32,33). Changes in the composition and structure of the extracellular matrix, such as loss of proteoglycans, mineralization of the extracellular matrix and accumulation of malformed extracellular matrix are hallmarks of osteoarthritis (8,34). The present study showed that genes coding for many MMPs were downregulated in FJOA. Consistent with sequencing data, MMP7 was significantly downregulated in FJOA compared with controls. Since MMP12 was the most downregulated gene in FJOA, the biological functions of MMP12 can be investigated in future studies. In addition, TIMP3 and TIMP4 were found to be upregulated in FJOA. Elevated TIMPs further inactivate MMPs and influence the dynamics of the extracellular matrix (35).

In contrast with the present observations, many members of the MMP family were upregulated and/or activated in many other forms of osteoarthritis (36-38). The contradictory results implied that the molecular changes in joint tissues in osteoarthritis might be tissue-specific. Kim et al (39) reported that MMP1, MMP3 and MMP13 were upregulated in human degenerative facet joint tissues, however, MMP3 expression was downregulated in the present study. Aside from the differences in the collection of human facet joint tissues and the classification of FJOA, another difference was that the current study focused on the Chinese population while the study performed by Kim et al performed studies on tissues collected from an American population (39). Meta analyses could be conducted to investigate the association between genetic changes in FJOA and different populations. Further studies will be conducted to examine the protein expression and localization of these MMPs in FJOA.

Meanwhile, the expression levels of another group of metalloproteinases, ADAM proteins, were upregulated in FJOA. Similar to MMPs, ADAM proteins are also key modulators of the extracellular matrix (40,41). Upregulated ADAM expression might execute opposite functions to downregulated MMPs in the breakdown and remodeling of the extracellular matrix by shedding transmembrane ligands of the epidermal growth factor (EGF) receptor and thus stimulate EGF receptor signaling. ADAM12 exhibits elevated expression levels in synovitis and post-inflammatory fibrosis of the synovial membrane in patients with early radiographic osteoarthritis (42). Polymorphisms of ADAM12, especially ADAM12 polymorphism rs3740199, are highly associated with knee osteoarthritis (43,44). These previous studies indicated the involvement of ADAM12 in osteoarthritis and proposed the potential roles of ADAM in FJOA. Therefore, changes in ADAM expression and corresponding alterations in the extracellular matrix in FJOA also need to be further examined.

Overall, transcriptome sequencing and bioinformatics analysis determined the genetic changes of MMP-related genes in FJOA and demonstrated the implications of the extracellular matrix and MMPs in FJOA from a molecular aspect. The present results revealed the roles of the extracellular matrix and MMPs in FJOA, contributing to the understanding of the underlying mechanisms behind FJOA. This might contribute to the investigation of novel therapeutic targets for FJOA treatment.

Acknowledgements

Not applicable.

Funding

This work was supported by supported by the Jiangsu Provincial Scientific Research Projects of ‘333 Project’ (grant no. BRA2017204) and the Jiangsu Provincial Youth Medical Talents Subsidy Project (grant no. QNRC2016413).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

ZC conceived and designed the experiments. CC and GX performed the experiments. CC, GX, ZC and YS analyzed the data. CC and ZC wrote the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was ethically approved by the Human Ethics Committee of the Second Affiliated Hospital of Nantong University. All participants provided written informed consent.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Schroeppel JP, Crist JD, Anderson HC and Wang J: Molecular regulation of articular chondrocyte function and its significance in osteoarthritis. Histol Histopathol. 26:377–394. 2011.PubMed/NCBI View Article : Google Scholar

2 

García-Carbajal ZY, Garciadiego-Cázares D, Parra-Cid C, Aguilar-Gaytan R, Velasquillo C, Ibarra C and Castro Carmona JS: Cartilage tissue engineering: The role of extracellular matrix (ECM) and novel strategies. 2013 DOI: 10.5772/55917.

3 

Sophia Fox AJ, Bedi A and Rodeo SA: The basic science of articular cartilage: Structure, composition, and function. Sports Health. 1:461–468. 2009.PubMed/NCBI View Article : Google Scholar

4 

Newman AP: Articular cartilage repair. Am J Sports Med. 26:309–324. 1998.PubMed/NCBI View Article : Google Scholar

5 

Goldring MB and Goldring SR: Osteoarthritis. J Cell Physiol. 213:626–634. 2007.PubMed/NCBI View Article : Google Scholar

6 

Martel-Pelletier J, Boileau C, Pelletier JP and Roughley PJ: Cartilage in normal and osteoarthritis conditions. Best Pract Res Clin Rheumatol. 22:351–384. 2008.PubMed/NCBI View Article : Google Scholar

7 

Kim SH, Turnbull J and Guimond S: Extracellular matrix and cell signalling: The dynamic cooperation of integrin, proteoglycan and growth factor receptor. J Endocrinol. 209:139–1351. 2011.PubMed/NCBI View Article : Google Scholar

8 

Maldonado M and Nam J: The role of changes in extracellular matrix of cartilage in the presence of inflammation on the pathology of osteoarthritis. Biomed Res Int. 2013(284873)2013.PubMed/NCBI View Article : Google Scholar

9 

Prasadam I, Farnaghi S, Feng JQ, Gu W, Perry S, Crawford R and Xiao Y: Impact of extracellular matrix derived from osteoarthritis subchondral bone osteoblasts on osteocytes: Role of integrinbeta1 and focal adhesion kinase signaling cues. Arthritis Res Ther. 15(R150)2013.PubMed/NCBI View Article : Google Scholar

10 

Kapoor C, Vaidya S, Wadhwan V; Hitesh, Kaur G and Pathak A: Seesaw of matrix metalloproteinases (MMPs). J Cancer Res Ther. 12:28–35. 2016.PubMed/NCBI View Article : Google Scholar

11 

Steffensen B, Häkkinen L and Larjava H: Proteolytic events of wound-healing-coordinated interactions among matrix metalloproteinases (MMPs), integrins, and extracellular matrix molecules. Crit Rev Oral Biol Med. 12:373–398. 2001.PubMed/NCBI View Article : Google Scholar

12 

Jiang J, Zhang J, Wu C, Guo X, Chen C, Bao G, Sun Y, Chen J, Xue P, Xu G and Cui Z: Up-regulation of TRAF2 inhibits chondrocytes apoptosis in lumbar facet joint osteoarthritis. Biochem Biophys Res Commun. 503:1659–1665. 2018.PubMed/NCBI View Article : Google Scholar

13 

Gellhorn AC, Katz JN and Suri P: Osteoarthritis of the spine: The facet joints. Nat Rev Rheumatol. 9:216–224. 2013.PubMed/NCBI View Article : Google Scholar

14 

Nakamura A, Rampersaud YR, Sharma A, Lewis SJ, Wu B, Datta P, Sundararajan K, Endisha H, Rossomacha E, Rockel JS, et al: Identification of microRNA-181a-5p and microRNA-4454 as mediators of facet cartilage degeneration. JCI Insight. 1(e86820)2016.PubMed/NCBI View Article : Google Scholar

15 

Chen C, Bao GF, Xu G, Sun Y and Cui ZM: Altered Wnt and NF-κB Signaling in Facet Joint Osteoarthritis: Insights from RNA deep sequencing. Tohoku J Exp Med. 245:69–77. 2018.PubMed/NCBI View Article : Google Scholar

16 

Kettler A and Wilke HJ: Review of existing grading systems for cervical or lumbar disc and facet joint degeneration. Eur Spine J. 15:705–718. 2006.PubMed/NCBI View Article : Google Scholar

17 

Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R and Salzberg SL: TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14(R36)2013.PubMed/NCBI View Article : Google Scholar

18 

Mortazavi A, Williams BA, McCue K, Schaeffer L and Wold B: Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods. 5:621–628. 2008.PubMed/NCBI View Article : Google Scholar

19 

Huang da W, Sherman BT and Lempicki RA: Bioinformatics enrichment tools: Paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 37:1–13. 2009.PubMed/NCBI View Article : Google Scholar

20 

Huang da W, Sherman BT and Lempicki RA: Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 4:44–57. 2009.PubMed/NCBI View Article : Google Scholar

21 

Huang DW, Sherman BT, Tan Q, Kir J, Liu D, Bryant D, Guo Y, Stephens R, Baseler MW, Lane HC and Lempicki RA: DAVID bioinformatics resources: Expanded annotation database and novel algorithms to better extract biology from large gene lists. Nucleic Acids Res. 35:W169–W175. 2007.PubMed/NCBI View Article : Google Scholar

22 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

23 

Reich M, Liefeld T, Gould J, Lerner J, Tamayo P and Mesirov JP: GenePattern 2.0. Nat Genet. 38:500–501. 2006.PubMed/NCBI View Article : Google Scholar

24 

Verma RP and Hansch C: Matrix metalloproteinases (MMPs): Chemical-biological functions and (Q)SARs. Bioorg Med Chem. 15:2223–2268. 2007.PubMed/NCBI View Article : Google Scholar

25 

Sternlicht MD and Werb Z: How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol. 17:463–516. 2001.PubMed/NCBI View Article : Google Scholar

26 

Wasilewska A, Taranta-Janusz K, Zoch-Zwierz W, Rybi-Szumińska A and Kolodziejczyk Z: Role of matrix metalloproteinases (MMP) and their tissue inhibitors (TIMP) in nephrology. Przegl Lek. 66:485–490. 2009.(In Polish). PubMed/NCBI

27 

White JM: ADAMs: Modulators of Cell-cell and cell-matrix interactions. Curr Opin Cell Biol. 15:598–606. 2003.PubMed/NCBI View Article : Google Scholar

28 

Theocharis AD, Skandalis SS, Gialeli C and Karamanos NK: Extracellular matrix structure. Adv Drug Deliv Rev. 97:4–27. 2016.PubMed/NCBI View Article : Google Scholar

29 

Bonnans C, Chou J and Werb Z: Remodelling the extracellular matrix in development and disease. Nat Rev Mol Cell Biol. 15:786–801. 2014.PubMed/NCBI View Article : Google Scholar

30 

Rozario T and DeSimone DW: The extracellular matrix in development and morphogenesis: A dynamic view. Dev Biol. 341:126–140. 2010.

31 

Engler AJ, Sen S, Sweeney HL and Discher DE: Matrix elasticity directs stem cell lineage specification. Cell. 126:677–689. 2006.PubMed/NCBI View Article : Google Scholar

32 

Rohani MG and Parks WC: Matrix remodeling by MMPs during wound repair. Matrix Biol. 44-46:113–121. 2015.PubMed/NCBI View Article : Google Scholar

33 

Apte SS and Parks WC: Metalloproteinases: A parade of functions in matrix biology and an outlook for the future. Matrix Biol. 44-46:1–6. 2015.PubMed/NCBI View Article : Google Scholar

34 

Bertrand J, Cromme C, Umlauf D, Frank S and Pap T: Molecular mechanisms of cartilage remodelling in osteoarthritis. Int J Biochem Cell Biol. 42:1594–1601. 2010.PubMed/NCBI View Article : Google Scholar

35 

Arpino V, Brock M and Gill SE: The role of TIMPs in regulation of extracellular matrix proteolysis. Matrix Biol. 44-46:247–254. 2015.PubMed/NCBI View Article : Google Scholar

36 

Zeng GQ, Chen AB, Li W, Song JH and Gao CY: High MMP-1, MMP-2, and MMP-9 protein levels in osteoarthritis. Genet Mol Res. 14:14811–14822. 2015.PubMed/NCBI View Article : Google Scholar

37 

Lipari L and Gerbino A: Expression of gelatinases (MMP-2, MMP-9) in human articular cartilage. Int J Immunopathol Pharmacol. 26:817–823. 2013.PubMed/NCBI View Article : Google Scholar

38 

Lim NH, Meinjohanns E, Meldal M, Bou-Gharios G and Nagase H: In vivo imaging of MMP-13 activity in the murine destabilised medial meniscus surgical model of osteoarthritis. Osteoarthritis Cartilage. 22:862–868. 2014.PubMed/NCBI View Article : Google Scholar

39 

Kim JS, Ali MH, Wydra F, Li X, Hamilton JL, An HS, Cs-Szabo G, Andrews S, Moric M, Xiao G, et al: Characterization of degenerative human facet joints and facet joint capsular tissues. Osteoarthritis Cartilage. 23:2242–2251. 2015.PubMed/NCBI View Article : Google Scholar

40 

Lu P, Takai K, Weaver VM and Werb Z: Extracellular matrix degradation and remodeling in development and disease. Cold Spring Harb Perspect Biol. 3(pii: a005058)2011.PubMed/NCBI View Article : Google Scholar

41 

Wolfsberg TG, Straight PD, Gerena RL, Huovila AP, Primakoff P, Myles DG and White JM: ADAM, a widely distributed and developmentally regulated gene family encoding membrane proteins with a disintegrin and metalloprotease domain. Dev Biol. 169:378–383. 1995.PubMed/NCBI View Article : Google Scholar

42 

Kerna I, Kisand K, Suutre S, Murde M and Tamm A, Kumm J and Tamm A: The ADAM12 is upregulated in synovitis and postinflammatory fibrosis of the synovial membrane in patients with early radiographic osteoarthritis. Joint Bone Spine. 81:51–16. 2014.PubMed/NCBI View Article : Google Scholar

43 

Lv ZT, Liang S, Huang XJ, Cheng P, Zhu WT and Chen AM: Association between ADAM12 Single-nucleotide polymorphisms and knee osteoarthritis: A Meta-analysis. Biomed Res Int. 2017(5398181)2017.PubMed/NCBI View Article : Google Scholar

44 

Poonpet T, Tammachote R, Tammachote N, Kanitnate S and Honsawek S: Association between ADAM12 polymorphism and knee osteoarthritis in Thai population. Knee. 23:357–361. 2016.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen C, Xu G, Sun Y and Cui Z: Transcriptome sequencing reveals dynamic changes in matrix metalloproteinases in facet joint osteoarthritis. Exp Ther Med 19: 2475-2482, 2020.
APA
Chen, C., Xu, G., Sun, Y., & Cui, Z. (2020). Transcriptome sequencing reveals dynamic changes in matrix metalloproteinases in facet joint osteoarthritis. Experimental and Therapeutic Medicine, 19, 2475-2482. https://doi.org/10.3892/etm.2020.8488
MLA
Chen, C., Xu, G., Sun, Y., Cui, Z."Transcriptome sequencing reveals dynamic changes in matrix metalloproteinases in facet joint osteoarthritis". Experimental and Therapeutic Medicine 19.4 (2020): 2475-2482.
Chicago
Chen, C., Xu, G., Sun, Y., Cui, Z."Transcriptome sequencing reveals dynamic changes in matrix metalloproteinases in facet joint osteoarthritis". Experimental and Therapeutic Medicine 19, no. 4 (2020): 2475-2482. https://doi.org/10.3892/etm.2020.8488
Copy and paste a formatted citation
x
Spandidos Publications style
Chen C, Xu G, Sun Y and Cui Z: Transcriptome sequencing reveals dynamic changes in matrix metalloproteinases in facet joint osteoarthritis. Exp Ther Med 19: 2475-2482, 2020.
APA
Chen, C., Xu, G., Sun, Y., & Cui, Z. (2020). Transcriptome sequencing reveals dynamic changes in matrix metalloproteinases in facet joint osteoarthritis. Experimental and Therapeutic Medicine, 19, 2475-2482. https://doi.org/10.3892/etm.2020.8488
MLA
Chen, C., Xu, G., Sun, Y., Cui, Z."Transcriptome sequencing reveals dynamic changes in matrix metalloproteinases in facet joint osteoarthritis". Experimental and Therapeutic Medicine 19.4 (2020): 2475-2482.
Chicago
Chen, C., Xu, G., Sun, Y., Cui, Z."Transcriptome sequencing reveals dynamic changes in matrix metalloproteinases in facet joint osteoarthritis". Experimental and Therapeutic Medicine 19, no. 4 (2020): 2475-2482. https://doi.org/10.3892/etm.2020.8488
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team