Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
October-2020 Volume 20 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2020 Volume 20 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Treatment with catalpol protects against cisplatin‑induced renal injury through Nrf2 and NF‑κB signaling pathways

  • Authors:
    • Jun Zhang
    • Li Liu
    • Furong Li
    • Zongqian Wang
    • Jinghong Zhao
  • View Affiliations / Copyright

    Affiliations: Department of Nephrology, The key Laboratory for the Prevention and Treatment of Chronic Kidney Disease of Chongqing, Kidney Center of PLA, Xinqiao Hospital, Army Medical University (Third Military Medical University), Chongqing 400037, P.R. China
    Copyright: © Zhang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 3025-3032
    |
    Published online on: July 29, 2020
       https://doi.org/10.3892/etm.2020.9077
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Cisplatin (CP) is one of the most widely used chemotherapy drugs for cancer treatment, but it often leads to nephrotoxicity. It is well known that catalpol exhibits antioxidant and anti‑inflammatory functions, thus the present study aimed to investigate the potential protective effects of catalpol on CP‑induced kidney injury in rats, in addition to determining the underlying mechanisms. Sprague‑Dawley rats were treated with 25, 50 or 100 mg/kg catalpol for two days, injected with 20 mg/kg cisplatin and catalpol on day 3 and sacrificed on day 4. The histological analysis of isolated kidney tissues was performed using hematoxylin and eosin staining, cleaved caspase‑3 expression levels were analyzed using western blotting and the expression levels of inflammatory cytokines in the tissues, including tumor necrosis factor α (TNF‑α), interleukin (IL)‑1β, IL‑6, IL‑8, IL‑10 and inducible nitric oxide synthase (iNOS) were evaluated using ELISAs. Furthermore, the mRNA and protein expression levels of nuclear factor erythroid 2‑related factor 2 (Nrf2), heme oxygenase 1 (HO‑1), kelch‑like ECH‑associated protein 1 (Keap1), NF‑κB and inhibitory κB (IκB) were determined using reverse transcription‑quantitative PCR and western blotting, respectively. The results revealed that the treatment with catalpol prevented the histopathological injury and renal dysfunction caused by CP. In addition, catalpol significantly suppressed the CP‑induced apoptosis of tubular cells, inhibited the CP‑induced upregulation of TNF‑α, IL‑1β, IL‑6, IL‑8 and iNOS and promoted the production of the anti‑inflammatory cytokine IL‑10. Additionally, the mRNA and protein expression levels of Nrf2, HO‑1 and IκB in the kidney tissues were increased, whereas the expression levels of Keap1 and NF‑κB were significantly decreased following the treatment with catalpol. In conclusion, these results suggested that catalpol may inhibit CP‑induced renal injury and suppress the associated inflammatory response through activating the Nrf2 and inhibiting the NF‑κB signaling pathways, respectively.

Introduction

Cisplatin (CP) is a chemotherapeutic drug that has been used clinically for decades in patients with malignant tumors; however, nephrotoxicity, which is the major side effect of CP treatment, has greatly limited its application as a treatment (1,2). Thus, there is an urgent requirement to develop a novel therapeutic agent that protects against CP-induced renal injury and obtain novel insights into the treatment of patients with cancer undergoing CP-based chemotherapy regimens (3,4).

The molecular mechanisms underlying CP-induced nephrotoxicity are complex (5). It has been reported that inflammation and apoptosis are associated with the development of nephrotoxicity (6,7); proinflammatory factors stimulated by CP, including tumor necrosis factor α (TNF-α), interleukin (IL)-1β, IL-6 and IL-8 have been observed to serve essential roles in the pathogenesis of CP-induced renal injury (8,9). Thus, the inhibition of the inflammatory response and apoptosis could be a promising therapeutic strategy for attenuating CP-induced nephrotoxicity. NF-κB, an important regulator of cytokine induction, promotes the expression of multiple proinflammatory genes (10). NF-κB has been demonstrated to have a vital role in the progression of CP-induced renal injury (11). Previous studies have found that the severity of CP-induced nephrotoxicity is related to the activation of NF-κB, and conversely, the inflammatory response and severity of nephrotoxicity can be attenuated through the inhibition of NF-κB activity (12,13). In addition, numerous studies have suggested a role for nuclear factor E2-related factor 2 (Nrf2) in the regulation of physiological processes that serve to inhibit the development and progression of CP-induced renal damage (14,15). It has been reported that the absence of Nrf2 exacerbates CP-induced nephrotoxicity, whilst the pharmacological activation of Nrf2 has been observed to inhibit CP-mediated nephrotoxicity (8). Thus, the pharmacological activation of Nrf2 is considered to be an important molecular target to prevent CP-induced renal damage.

Rehmannia glutinosa is a traditional herbal medicine that has been used to enhance the functions of the liver, kidney and heart (16). In certain cases, Rehmannia glutinosa has also been used to treat diabetes, anemia and urinary tract infections (17). A previous study extracted the effective component in Rehmannia glutinosa and identified it as catalpol, whose molecular formula is C15H22O10 (18). Studies have since revealed that catalpol exhibits anti-inflammatory and anti-apoptotic effects (19,20). In addition, catalpol was found to have important functions in protecting against lipopolysaccharide-induced acute lung injury through suppressing the inflammatory response (21). In other studies, catalpol inhibited apoptosis in hydrogen peroxide-induced cardiac myocytes through the caspase pathway and ameliorated hepatic insulin resistance in type 2 diabetes by acting through the 5'-AMP-activated protein kinase/NADPH oxidase 4/PI3K/AKT signaling pathway (22,23). However, to the best of our knowledge, no previous study has been conducted to examine the inhibitory roles of catalpol in CP-induced renal injury. In the present study, the potential protective effects of catalpol in CP-induced kidney injury were investigated in an in vivo rat model and the underlying molecular mechanisms were subsequently investigated. The results suggested that catalpol may protect against CP-induced apoptosis and inflammation in tubular cells by inhibiting and activating the NF-κB and Nrf-2 signaling pathway, respectively.

Materials and methods

Reagents

Catalpol was purchased from Sigma-Aldrich; Merck KGaA; the Urea Nitrogen Diacetylmonoxime Test kit and the Creatinine LiquiColor Test (Kinetic) kit were obtained from Tiangen Biotech Co., Ltd. TNF-α (cat. no. ZB-10764C-R9648), IL-1β (cat. no. ZB-10119C-R9648), IL-6 (cat. no. ZB-10135C-R9648), IL-8 (cat. no. ZB-11167C-R9648), IL-10 (cat. no. ZB-10108C-R9648) and iNOS (cat. no. ZB-10740C-R9648) ELISA kits were purchased from ZellBio GmbH. TRIzol® reagent was obtained from Invitrogen; Thermo Fisher Scientific, Inc. Primary antibodies against cleaved caspase-3 (cat. no. 9661; 1:1,000), Nrf2 (cat. no. 12721; 1:1,000), heme oxygenase-1 (HO-1; cat. no. 86806; 1:1,000), inhibitory κB (IκB; cat. no. 76041; 1:100), ECH-associated protein 1 (Keap1; cat. no. 8047; 1:2,000) and NF-κB p65 (cat. no. 8242; 1:2,000) were purchased from Cell Signaling Technology, Inc.

Animal studies

A total of 40 male Sprague-Dawley rats (age, 8 weeks; mean body weight, 392±15 g) were purchased from the Animal Center of the Military Medical University (Chongqing, China) and were housed at 2 rats/cage in a light-controlled environment at 24±1˚C, 40-80% humidity, with 12-h light/dark cycles and with access to food and water ad libitum throughout the experimental period. The experiments were approved by the Animal Care and Use Ethics Committee of the Military Medical University.

Experimental design

Rats were randomly divided into five groups (n=8/group): i) CP group, which was subjected to a single injection of 20 mg/kg CP intraperitoneally on day 3; ii) control group, which was administered intraperitoneally with an equal volume of the saline solution (20 ml/kg) instead of CP or catalpol; and iii) CP and catalpol (CP + cat) groups treated with 25, 50 or 100 mg/kg catalpol for 2 days and 20 mg/kg CP and catalpol on day 3. A 2-ml blood sample was collected on day 4 from the retroorbital venous sinus following anesthetization by the intraperitoneal injection of 300 mg/kg 10% chloral hydrate aqueous solution. The blood samples were centrifuged at 1,509 x g for 15 min at 4˚C and stored at -80˚C until further use. The rats were sacrificed by decapitation following the drawing of blood. The dose of catalpol was chosen based on a previous study (24).

Renal function analysis

To examine the renal injury, the expression levels of blood urea nitrogen (BUN) and creatinine in the serum were analyzed using a biochemical AutoAnalyzer (Cobas® 8000; Roche Diagnostics GmbH), according to the manufacturer's protocol.

Histological analysis using hematoxylin & eosin (H&E) staining

For histopathological evaluation of the renal injury, kidney tissues were obtained from the rats and were subsequently fixed in 10% formaldehyde at room temperature for 24 h and embedded in paraffin. The 5-µm sections were heated at 60˚C for 1 h, before being dewaxed in xylene and rehydrated using a descending ethanol series. Hematoxylin and eosin (H&E) staining was then performed on sections, with hematoxylin for 10 min room temperature and eosin for 5 min at room temperature. Stained sections were visualized using a light microscope (magnification, x200) by a pathologist in a blinded manner. Renal histopathological changes including cellular necrosis, loss of brush border, interstitial edema and tubule dilatation were evaluated using the following criteria: i) 0=none; ii) 1=≤25%; iii) 2=25-49%; iv) 3=50-74%; and v) 4=≥75% (6).

TUNEL assay

To evaluate the apoptotic ability of the cells in the cortex following CP-induced renal injury, a TUNEL assay was performed using the TUNEL apoptosis detection kit (cat. no. C1098; Beyotime Institute of Biotechnology), according to the manufacturer's protocol. Apoptotic cells were observed and counted in five randomly selected fields using a light optical microscope (magnification, x200). Cells with a brown nucleus were positive cells. The number of apoptotic cells in proportion to the total number of cells was used to calculate the apoptotic index.

Evaluation of inflammatory cytokines

To determine the expression levels of TNF-α, IL-1β, IL-6, IL-8, IL-10 and iNOS in renal tissues, The renal tissues (100 mg) were homogenized with 1 ml PBS (pH 7.4, 100 mM) and PathScan® Sandwich ELISA lysis buffer (cat. no. 7018; Cell Signaling Technology, Inc.) was used to lyse the tissues before centrifugation at 3,660 x g for 10 min at 4˚C. TNF-α (cat. no. ZB-10764C-R9648), IL-1β (cat. no. ZB-10119C-R9648), IL-6 (cat. no. ZB-10135C-R9648), IL-8 (cat. no. ZB-11167C-R9648), IL-10 (cat. no. ZB-10108C-R9648) and iNOS (cat. no. ZB-10740C-R9648) ELISA kits were used according to the manufacturer's protocol.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from tissues using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Total RNA was reverse transcribed into cDNA using the Revert Aid First Strand cDNA Synthesis kit (Fermentas; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The temperature protocol for reverse transcription was as follows: 42˚C for 45 min, 99˚C for 5 min and 5˚C for 5 min. qPCR was performed using the SYBR® Green PCR Master Mix (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The sequences of primers (Shanghai Institute of Biological Sciences) are listed in Table I. The following thermocycling conditions were used for qPCR: Initial denaturation at 95˚C for 5 min, followed by 45 cycles at 95˚C for 15 sec, 60˚C for 20 sec and 72˚C for 10 sec. Relative mRNA expression levels were calculated using the 2-∆∆Cq method (25) and normalized to the internal reference gene GAPDH.

Table I

Primer sequences for reverse transcription-quantitative PCR.

Table I

Primer sequences for reverse transcription-quantitative PCR.

 Primer sequence (5'-3')
Target geneForwardReverse
NF-κB ACCTGCAGTTCGATGCTGAT CCTGTCACCAGGCGAGTTAT
Keap1 TGCAAATGGATTCTGCTTCACCTACTTTGCAGGAA TGAGCCCAGAACCTCCTTTTTCTCCAGTTTC
Nrf2 GCAACTCCAGAAGGAACAGG GGAATGTCTCTGCCAAAAGC
HO-1 CTTTCAGAAGGGTCAGGTGTC TGCTTGTTTCGCTCTATCTCC
IκB TGGCCAGTGTAGCAGTCTTG GACATCAGCACCCAAAGTCA
β-actin CCACTGCCGCATCCTCTT GCATCGGAACCGCTCATT

[i] Keap1, kelch-like ECH-associated protein 1; Nrf2, nuclear factor erythroid 2-related factor 2; HO-1, heme oxygenase 1; IκB, inhibitory κB.

Western blotting

Renal tissue samples were ground in liquid nitrogen and lysed using RIPA lysis buffer (Beyotime Institute of Biotechnology) for 30 min. Total protein was quantified using a bicinchoninic acid assay and 50 µg protein was separated using 12% SDS-PAGE for 90 min. The separated proteins were subsequently transferred onto polyvinylidene difluoride membranes and blocked in TBS with 5% skimmed milk for 2 h at room temperature. The membranes were incubated with primary antibodies (all from Cell Signaling Technology, Inc.) against GAPDH (cat. no. 5174; 1:1,000), cleaved caspase-3 (cat. no. 9661; 1:1,000), Keap1 (cat. no. 8047; 1:2,000), Nrf2 (cat. no. 12721; 1:1,000), HO-1 (cat. no. 86806; 1:1,000), NF-κB p65 (cat. no. 8242; 1:2,000) and IκB (cat. no. 76041; 1:100) overnight at 4˚C. Following the primary antibody incubation, the membranes were subsequently incubated with a horseradish peroxidase-conjugated secondary antibody (cat. no. sc-2370; 1:5,000; Santa Cruz Biotechnology Inc.) for 1 h at 37˚C. The protein-antibody complexes were visualized using Pierce™ Fast Western Blot Kit, ECL Substrate (cat. no. 35050; Thermo Fisher Scientific, Inc.) with a chemiluminescence instrument (Tanon Science and Technology Co., Ltd.). Protein expression was quantified using Image-Pro Plus software (version 6.0; Media Cybernetics, Inc.). Experiments were performed in triplicate.

Statistical analysis

Statistical analysis was performed using SPSS 17.0 software (SPSS, Inc.) and data are presented as the mean ± SD. Statistical differences between groups were determined using one-way ANOVA with a Tukey's post hoc test for multiple comparisons. Histological scores were compared using Kruskal-Wallis statistical test followed by Dunn's post hoc analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

Catalpol prevents CP-induced renal injury

To analyze the protective roles of catalpol on CP-induced renal injury, the expression levels of BUN and creatinine in the serum were determined. The expression levels of serum BUN and creatinine in the CP group were significantly increased compared with the control group; however, serum BUN and creatinine expression levels were significantly reduced following the treatment with catalpol in a dose-dependent manner compared with CP treatment alone (Fig. 1). These results suggested that CP may stimulate renal injury, which may be prevented by catalpol treatment.

Figure 1

Effects of catalpol on the expression levels of serum BUN and creatinine. The rats were treated with catalpol intraperitoneally (25, 50 or 100 mg/kg/day) for two days, followed by an intraperitoneal injection with catalpol and CP (20 mg/kg) before being sacrificed at day 4. Expression levels of serum (A) BUN and (B) creatinine were analyzed. Results are presented as the mean ± SD (n=8). #P<0.01 vs. control group; *P<0.05 vs. CP group. BUN, blood urea nitrogen; CP, cisplatin; Cat, catalpol.

Effects of catalpol on CP-induced renal histopathological changes

To investigate the functions of catalpol on CP-induced renal injury, the histological appearance of kidney tissues was analyzed. Normal morphology was observed in the control group (Fig. 2A); however, tubular epithelial damage, intratubular cast formation and tubular dilatation were detected in CP-treated tissues (Fig. 2B). Catalpol was observed to prevent the CP-induced histological disturbances in renal tissues in a dose-dependent manner (Fig. 2C-F). These results indicated that CP treatment may lead to the aberrant morphological appearance of kidney tissues, and these impairments may be rescued by catalpol treatment.

Figure 2

Effects of catalpol on the histopathological changes of kidney tissues following CP-induced renal injury. Representative morphological appearances of the kidney tissues obtained from rats in the (A) control group, (B) CP group, (C) CP + 25 mg/kg cat group, (D) CP + 50 mg/kg cat group and (E) CP + 100 mg/kg cat group. The red arrows indicate the CP-induced renal injury. Magnification, x200. (F) Histological score analysis. Results are presented as the mean ± SD (n=8). #P<0.01 vs. control group; *P<0.05 vs. CP group. CP, cisplatin; Cat, catalpol.

Catalpol inhibits the apoptosis of tubular cells in the kidney tissues with CP-induced renal injury in vivo

The apoptosis of tubular cells serves essential pathogenic roles in CP-induced renal injury (6). In the present study, the apoptotic ability of the cells was determined using TUNEL staining and analyzing caspase-3 activity. Low numbers of apoptotic cells were detected in the kidney tissues of the control group (Fig. 3A-F); however, following the treatment with CP, the number of apoptotic cells in the kidney tissues was significantly increased compared with the control group (Fig. 3B-F). Furthermore, catalpol treatment significantly inhibited the number of apoptotic cells in the kidney tissues compared with that in the CP group (Fig. 3C-F). In addition, cleaved caspase-3 expression levels were increased in the CP group compared with the control group, whereas catalpol treatment significantly decreased these levels (Fig. 3G and H). The results demonstrated that the apoptotic rate of cells isolated from the CP group was significantly increased compared with the control group; however, this effect was significantly reversed following the treatment with catalpol, suggesting that the increased cell apoptotic ability and subsequent CP-induced renal injury may be inhibited by catalpol treatment.

Figure 3

Catalpol inhibits the apoptosis of tubular cells in the kidney tissues with CP-induced renal injury. Apoptotic abilities of cells isolated from the (A) control group, (B) CP group, (C) CP + 25 mg/kg cat group, (D) CP + 50 mg/kg cat group and (E) CP + 100 mg/kg cat group. Magnification, x200. (F) Number of TUNEL-positive cells in each group. (G) Protein expression levels of cleaved caspase-3 were determined using western blotting in the different treatment groups. (H) Semi-quantitative analysis of the western blotting results. Results are presented as the mean ± SD (n=8). #P<0.01 vs. control group. *P<0.05 vs. CP group. CP, cisplatin; Cat, catalpol.

Catalpol inhibits the secretion of cisplatin-induced inflammatory cytokines

Previous studies have demonstrated that the production of inflammatory cytokines, including TNF-α, IL-1β, IL-6, IL-8, IL-10 and iNOS, served important roles in CP-induced kidney injury (8,9). To investigate the anti-inflammatory functions of catalpol, the effects of catalpol on the expression levels of CP-induced inflammatory cytokines were determined. ELISAs revealed that the production of pro-inflammatory cytokines, TNF-α, IL-1β, IL-6, IL-8 and iNOS in kidney tissues were significantly increased in the CP group compared with the control group, whereas the secretion of the anti-inflammatory cytokine IL-10 was significantly decreased compared with the control group (Fig. 4). The treatment with catalpol significantly inhibited the production of CP-induced TNF-α, IL-1β, IL-6, IL-8 and iNOS, whilst significantly increasing the expression of IL-10 in a dose-dependent manner compared with the CP group (Fig. 4). These results indicated that the CP-induced inflammatory response may be suppressed by the treatment with catalpol, which may represent a novel therapeutic candidate for the treatment of CP-induced inflammation and renal injury.

Figure 4

Effects of catalpol on the CP-stimulated production of inflammatory cytokines in the kidney tissues. Expression levels of (A) TNF-α, (B) IL-1β, (C) IL-6, (D) IL-8, (E) IL-10 and (F) iNOS in the kidney tissues of different treatment groups were determined using ELISAs. Results are presented as the mean ± SD (n=8). #P<0.01 vs. control group; *P<0.05 vs. CP group. CP, cisplatin; TNF-α, tumor necrosis factor α; IL, interleukin; iNOS, inducible nitric oxide synthase; Cat, catalpol.

Effects of catalpol on the expression levels of Nrf2, HO-1, IκB, Keap1 and NF-κB

The mRNA and protein expression levels of Nrf2, HO-1 and Keap1 were analyzed using RT-qPCR and western blotting, respectively. The mRNA and protein expression levels of Nrf2 and HO-1 were significantly reduced, whilst the expression levels of Keap1 were significantly increased following the treatment with CP compared with the control group (Fig. 5). Meanwhile, catalpol treatment significantly increased the expression levels of Nrf2 and HO-1, whilst significantly decreasing the expression levels of Keap1 compared with the CP group (Fig. 5). The activation of NF-κB serves an important role in the induction of proinflammatory mediators and nuclear translocation of the NF-κB transcription factor is preceded by the degradation IκB-α (8). To determine whether catalpol affected NF-κB activity, NF-κB p65 and IκB-α expression levels were analyzed using RT-qPCR and western blotting. Catalpol significantly increased IκB-α expression levels and inhibited nuclear NF-κB p65 expression levels following CP-induced renal injury (Fig. 5).

Figure 5

Effects of catalpol on the mRNA and protein expression levels of Nrf2, HO-1, IκB, Keap1 and NF-κB in rats treated with CP. (A) mRNA expression levels of Nrf2, HO-1, IκB, Keap1 and NF-κB in the different treatment groups were analyzed using reverse transcription-quantitative PCR. (B) Densitometry analysis of western blotting results. (C) Protein expression levels of Nrf2, HO-1, IκB, Keap1 and NF-κB in the different treatment groups were analyzed using western blotting. Results are presented as the mean ± SD (n=8). #P<0.01 vs. control group; *P<0.05 vs. CP group. CP, cisplatin; Nrf2, nuclear factor erythroid 2-related factor 2; HO-1, heme oxygenase 1; Keap1, Kelch-like ECH-associated protein 1; IκB, inhibitory κB; Cat, catalpol.

Discussion

CP is one of the most effective chemotherapy drugs; however, its therapeutic application is restricted by nephrotoxicity, the major CP-induced side effect that consequently leads to renal injury (26,27). It has been reported that CP-stimulated injury in the kidney is closely associated with inflammation and apoptosis (28). For example, Mitazaki et al (29) demonstrated that IL-6 was involved in the regulation of oxidative stress during the development of CP-induced nephrotoxicity; Lee et al (30) reported that mice with an IL-1α deficiency were more resistant to CP-induced acute renal failure compared with the control group; and Kim et al (31) reported that the expression levels of IL-10, an anti-inflammatory cytokine, were significantly decreased following treatment with CP. Additionally, in another study, IL-10 was found to protect the kidney against renal ischemia and CP-induced injury (32). In the present study, the serum levels of BUN and creatinine in the CP group were significantly increased, whereas the treatment with catalpol reduced their expression levels in a dose-dependent manner. These results suggested that CP may promote renal injury, which may be subsequently prevented by catalpol treatment; this conclusion could be further validated by analyzing the expression levels of urinary microalbumin and β2-microglobulin in future studies. Moreover, catalpol inhibited the production of pro-inflammatory cytokines, including TNF-α, IL-1β, IL-6, IL-8 and iNOS and subsequently reduced the damage of CP-induced renal dysfunction. Furthermore, the treatment with catalpol resulted in the increased secretion of the anti-inflammatory cytokine, IL-10, which may protect the normal function of kidney. Thus, catalpol may be a promising therapeutic candidate for the treatment of CP-induced kidney injury.

However, to the best of our knowledge, the underlying molecular mechanisms of catalpol-mediated protection on kidney function were unknown, so they were further investigated in the present study. NF-κB is a pleiotropic transcription factor with important functions in the intestinal immune system. NF-κB family members control the transcriptional activities of various promoters of proinflammatory cytokines, cell surface receptors, transcription factors and adhesion molecules involved in intestinal inflammation (10). NF-κB is located in the cytoplasm of most cells as an inactive complex with unprocessed precursor proteins or IκB. The degradation of these precursor proteins enables NF-κB dimers to translocate to the nucleus and induce the expression of specific target genes (13). Notably, the transcription factor has an essential role in the transcriptional regulation of cytokines, such as IL-1β, IL-6 and TNF-α, and the activation of the NF-κB pathway promotes the expression of inflammatory parameters associated with severe renal injury (6). The results of the present study revealed that the activation of NF-κB was significantly inhibited by catalpol, indicating that catalpol may attenuate the CP-induced inflammation of renal injury through suppressing the NF-κB signaling pathway.

In addition, the apoptosis of tubular cells is considered as one of the pathogenic mechanisms that contributes to diseases associated with renal injury (33). Nrf2 exerts cytoprotective and antiapoptotic effects, and is found present as an inactive complex in the cytoplasm with Keap1. In the nucleus, Nrf2 activates the expression of the HO-1 gene, which subsequently alleviates oxidative stress-induced cellular damage (8,14). In addition, HO-1 is a phase II detoxifying enzyme and an anti-inflammatory reactive protein (34). In the present study, catalpol treatment significantly reduced the apoptotic ability of tubular cells in vivo. Furthermore, as an important protein involved in the regulation of antioxidant proteins and the inhibition of cell apoptosis, the expression levels of Nrf2 and associated genes, including Keap1 and HO-1, were evaluated following the treatment with CP and catalpol. The results revealed that CP suppressed the levels of genes involved in the Nrf2 axis, whereas catalpol promoted the expression of the aforementioned genes, which suggested that catalpol may inhibit the apoptosis of tubular cells and subsequently protect the kidney against CP-induced renal injury.

In conclusion, the results of the present study demonstrated that catalpol was able to attenuate CP-induced inflammation and apoptosis during renal injury through the activation and inhibition of the Nrf2 and NF-κB signaling pathway, respectively. These findings provided novel insights into the potential protective roles of catalpol against kidney injury, suggesting that catalpol may be a potential therapeutic candidate in the treatment of CP-induced renal damage. However, as a widely used chemotherapy drug, the anti-tumor functions of CP are mainly attributed to its regulatory roles on cell apoptosis, thus, the therapeutic outcome of combined CP and catalpol treatment for patients with solid tumors remains unknown and requires further investigation.

Acknowledgements

Not applicable.

Funding

The present study was supported by the National Science Foundation of China (grant no. 81130011) and National Institutes of Health (grant nos. DK064005 and DK091239).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JHZ and JZ conceived and designed the present study. JZ performed the experiments; LL analyzed the data. FL and ZW contributed to interpretation of data. JZ wrote the manuscript and JHZ edited the paper. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The experiments were approved by the Animal Care and Use Ethics Committee of the Military Medical University.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Jiang Y, Jiang J, Jia H, Qiao Z and Zhang J: Recovery of miR-139-5p in ovarian cancer reverses cisplatin resistance by targeting c-Jun. Cell Physiol Biochem. 51:129–141. 2018.PubMed/NCBI View Article : Google Scholar

2 

Du A, Jiang Y and Fan C: NDRG1 downregulates ATF3 and inhibits cisplatin-induced cytotoxicity in lung cancer A549 cells. Int J Med Sci. 15:1502–1507. 2018.PubMed/NCBI View Article : Google Scholar

3 

Xu B, Zeng M, Zeng J, Feng J and Yu L: Meta-analysis of clinical trials comparing the efficacy and safety of liposomal cisplatin versus conventional nonliposomal cisplatin in nonsmall cell lung cancer (NSCLC) and squamous cell carcinoma of the head and neck (SCCHN). Medicine (Baltimore). 97(e13169)2018.PubMed/NCBI View Article : Google Scholar

4 

Anari F, O'Neill J, Choi W, Chen DYT, Haseebuddin M, Kutikov A, Dulaimi E, Alpaugh RK, Devarajan K, Greenberg RE, et al: Neoadjuvant dose-dense gemcitabine and cisplatin in muscle-invasive bladder cancer: results of a phase 2 trial. Eur Urol Oncol. 1:54–60. 2018.PubMed/NCBI View Article : Google Scholar

5 

Santiago MJ, Fernández SN, Lázaro A, González R, Urbano J, López J, Solana MJ, Toledo B, Del Castillo J, Tejedor A, et al: Correction: Cisplatin-induced non-oliguric acute kidney injury in a pediatric experimental animal model in piglets. PLoS One. 13(e0207547)2018.PubMed/NCBI View Article : Google Scholar

6 

Zhang W, Hou J, Yan X, Leng J, Li R, Zhang J, Xing J, Chen C, Wang Z and Li W: Platycodon grandiflorum saponins ameliorate cisplatin-induced acute nephrotoxicity through the NF-κB-mediated inflammation and PI3K/Akt/apoptosis signaling pathways. Nutrients. 10(10)2018.PubMed/NCBI View Article : Google Scholar

7 

Ye J, Ren Y, Wei Z, Peng J, Chen C, Song W, Tan M, He Y and Yuan Y: Nephrotoxicity and long-term survival investigations for patients with peritoneal carcinomatosis using hyperthermic intraperitoneal chemotherapy with cisplatin: A retrospective cohort study. Surg Oncol. 27:456–461. 2018.PubMed/NCBI View Article : Google Scholar

8 

Li F, Yao Y, Huang H, Hao H and Ying M: Xanthohumol attenuates cisplatin-induced nephrotoxicity through inhibiting NF-κB and activating Nrf2 signaling pathways. Int Immunopharmacol. 61:277–282. 2018.PubMed/NCBI View Article : Google Scholar

9 

Alibakhshi T, Khodayar MJ, Khorsandi L, Rashno M and Zeidooni L: Protective effects of zingerone on oxidative stress and inflammation in cisplatin-induced rat nephrotoxicity. Biomed Pharmacother. 105:225–232. 2018.PubMed/NCBI View Article : Google Scholar

10 

Yenuganti VR, Ravinder R and Singh D: Conjugated linoleic acids attenuate LPS-induced pro-inflammatory gene expression by inhibiting the NF-κB translocation through PPARγ in buffalo granulosa cells. Am J Reprod Immunol. 72:296–304. 2014.PubMed/NCBI View Article : Google Scholar

11 

Potočnjak I, Broznić D, Kindl M, Kropek M, Vladimir-Knežević S and Domitrović R: Stevia and stevioside protect against cisplatin nephrotoxicity through inhibition of ERK1/2, STAT3, and NF-κB activation. Food Chem Toxicol. 107 (Pt A):215–225. 2017.PubMed/NCBI View Article : Google Scholar

12 

Kim IH, Kwon MJ, Jung JH and Nam TJ: Protein extracted from Porphyra yezoensis prevents cisplatin-induced nephrotoxicity by downregulating the MAPK and NF-κB pathways. Int J Mol Med. 41:511–520. 2018.PubMed/NCBI View Article : Google Scholar

13 

Yu X, Meng X, Xu M, Zhang X, Zhang Y, Ding G, Huang S, Zhang A and Jia Z: Celastrol ameliorates cisplatin nephrotoxicity by inhibiting NF-κB and improving mitochondrial function. EBioMedicine. 36:266–280. 2018.PubMed/NCBI View Article : Google Scholar

14 

Polat EC, Besiroglu H, Ozcan L, Otunctemur A, Eruyar AT, Somay A, Ozbay N, Cekmen M, Eraldemir C and Ozbek E: Beneficial effects of Oltipraz, nuclear factor - erythroid - 2 - related factor 2 (Nrf2), on renal damage in unilateral ureteral obstruction rat model. Int Braz J Urol. 44:1243–1251. 2018.PubMed/NCBI View Article : Google Scholar

15 

Zúñiga-Toalá A, Zatarain-Barrón ZL, Hernández-Pando R, Negrette-Guzmán M, Huerta-Yepez S, Torres I, Pinzón E, Tapia E and Pedraza-Chaverri J: Nordihydroguaiaretic acid induces Nrf2 nuclear translocation in vivo and attenuates renal damage and apoptosis in the ischemia and reperfusion model. Phytomedicine. 20:775–779. 2013.PubMed/NCBI View Article : Google Scholar

16 

Kwak M, Yu K, Lee PC and Jin JO: Rehmannia glutinosa polysaccharide functions as a mucosal adjuvant to induce dendritic cell activation in mediastinal lymph node. Int J Biol Macromol. 120 (Pt B):1618–1623. 2018.PubMed/NCBI View Article : Google Scholar

17 

Dai X, Su S, Cai H, Wei D, Yan H, Zheng T, Zhu Z, Shang EX, Guo S, Qian D, et al: Protective effects of total glycoside from Rehmannia glutinosa leaves on diabetic nephropathy rats via regulating the metabolic profiling and modulating the TGF-β1 and Wnt/β-catenin signaling pathway. Front Pharmacol. 9(1012)2018.PubMed/NCBI View Article : Google Scholar

18 

Zhou Y, Yang K, Zhang D, Duan H, Liu Y and Guo M: Metabolite accumulation and metabolic network in developing roots of Rehmannia glutinosa reveals its root developmental mechanism and quality. Sci Rep. 8(14127)2018.PubMed/NCBI View Article : Google Scholar

19 

Zhang H, Jia R, Wang F, Qiu G, Qiao P, Xu X and Wu D: Catalpol protects mice against Lipopolysaccharide/D-galactosamine-induced acute liver injury through inhibiting inflammatory and oxidative response. Oncotarget. 9:3887–3894. 2017.PubMed/NCBI View Article : Google Scholar

20 

Liu Z, Zhu P, Zhang L, Xiong B, Tao J, Guan W, Li C, Chen C, Gu J, Duanmu J, et al: Autophagy inhibition attenuates the induction of anti-inflammatory effect of catalpol in liver fibrosis. Biomed Pharmacother. 103:1262–1271. 2018.PubMed/NCBI View Article : Google Scholar

21 

Han Y, Shen M, Tang LY, Tan G, Yang QC, Ye L, Ye LH, Jiang N, Gao GP and Shao Y: Antiangiogenic effects of catalpol on rat corneal neovascularization. Mol Med Rep. 17:2187–2194. 2018.PubMed/NCBI View Article : Google Scholar

22 

Hu LA, Sun YK, Zhang HS, Zhang JG and Hu J: Catalpol inhibits apoptosis in hydrogen peroxide-induced cardiac myocytes through a mitochondrial-dependent caspase pathway. Biosci Rep. 36(36)2016.PubMed/NCBI View Article : Google Scholar

23 

Yan J, Wang C, Jin Y, Meng Q, Liu Q, Liu Z, Liu K and Sun H: Catalpol ameliorates hepatic insulin resistance in type 2 diabetes through acting on AMPK/NOX4/PI3K/AKT pathway. Pharmacol Res. 130:466–480. 2018.PubMed/NCBI View Article : Google Scholar

24 

Xiao WQ, Yin GJ, Fan YT, Qiu L, Cang XF, Yu G, Hu YL, Xing M, Wu DQ, Wang XP, et al: Catalpol ameliorates sodium taurocholate-induced acute pancreatitis in rats via inhibiting activation of nuclear factor kappa B. Int J Mol Sci. 15:11957–11972. 2014.PubMed/NCBI View Article : Google Scholar

25 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

26 

Mohri J, Katada C, Ueda M, Sugawara M, Yamashita K, Moriya H, Komori S, Hayakawa K, Koizumi W and Atsuda K: Predisposing factors for chemotherapy-induced nephrotoxicity in patients with advanced esophageal cancer who received combination chemotherapy with docetaxel, cisplatin, and 5-fluorouracil. J Transl Int Med. 6:32–37. 2018.PubMed/NCBI View Article : Google Scholar

27 

Lee D, Yu JS, Lee SR, Hwang GS, Kang KS, Park JG, Kim HY, Kim KH and Yamabe N: Beneficial Effects of Bioactive Compounds in Mulberry Fruits against Cisplatin-Induced Nephrotoxicity. Int J Mol Sci. 19(19)2018.PubMed/NCBI View Article : Google Scholar

28 

Wang SW, Xu Y, Weng YY, Fan XY, Bai YF, Zheng XY, Lou LJ and Zhang F: Astilbin ameliorates cisplatin-induced nephrotoxicity through reducing oxidative stress and inflammation. Food Chem Toxicol. 114:227–236. 2018.PubMed/NCBI View Article : Google Scholar

29 

Mitazaki S, Hashimoto M, Matsuhashi Y, Honma S, Suto M, Kato N, Nakagawasai O, Tan-No K, Hiraiwa K, Yoshida M, et al: Interleukin-6 modulates oxidative stress produced during the development of cisplatin nephrotoxicity. Life Sci. 92:694–700. 2013.PubMed/NCBI View Article : Google Scholar

30 

Lee JW, Nam WJ, Han MJ, Shin JH, Kim JG, Kim SH, Kim HR and Oh DJ: Role of IL-1α in cisplatin-induced acute renal failure in mice. Korean J Intern Med. 26:187–194. 2011.PubMed/NCBI View Article : Google Scholar

31 

Kim WS, Kim H, Kwon KW, Im SH, Lee BR, Ha SJ and Shin SJ: Cisplatin induces tolerogenic dendritic cells in response to TLR agonists via the abundant production of IL-10, thereby promoting Th2- and Tr1-biased T-cell immunity. Oncotarget. 7:33765–33782. 2016.PubMed/NCBI View Article : Google Scholar

32 

Tadagavadi RK and Reeves WB: Endogenous IL-10 attenuates cisplatin nephrotoxicity: Role of dendritic cells. J Immunol. 185:4904–4911. 2010.PubMed/NCBI View Article : Google Scholar

33 

Lee D, Lee DS, Jung K, Hwang GS, Lee HL, Yamabe N, Lee HJ, Eom DW, Kim KH and Kang KS: Protective effect of ginsenoside Rb1 against tacrolimus-induced apoptosis in renal proximal tubular LLC-PK1 cells. J Ginseng Res. 42:75–80. 2018.PubMed/NCBI View Article : Google Scholar

34 

Mahran YF: New insights into the protection of growth hormone in cisplatin-induced nephrotoxicity: The impact of IGF-1 on the Keap1-Nrf2/HO-1 signaling. Life Sci. 253(117581)2020.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang J, Liu L, Li F, Wang Z and Zhao J: Treatment with catalpol protects against cisplatin‑induced renal injury through Nrf2 and NF‑κB signaling pathways. Exp Ther Med 20: 3025-3032, 2020.
APA
Zhang, J., Liu, L., Li, F., Wang, Z., & Zhao, J. (2020). Treatment with catalpol protects against cisplatin‑induced renal injury through Nrf2 and NF‑κB signaling pathways. Experimental and Therapeutic Medicine, 20, 3025-3032. https://doi.org/10.3892/etm.2020.9077
MLA
Zhang, J., Liu, L., Li, F., Wang, Z., Zhao, J."Treatment with catalpol protects against cisplatin‑induced renal injury through Nrf2 and NF‑κB signaling pathways". Experimental and Therapeutic Medicine 20.4 (2020): 3025-3032.
Chicago
Zhang, J., Liu, L., Li, F., Wang, Z., Zhao, J."Treatment with catalpol protects against cisplatin‑induced renal injury through Nrf2 and NF‑κB signaling pathways". Experimental and Therapeutic Medicine 20, no. 4 (2020): 3025-3032. https://doi.org/10.3892/etm.2020.9077
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang J, Liu L, Li F, Wang Z and Zhao J: Treatment with catalpol protects against cisplatin‑induced renal injury through Nrf2 and NF‑κB signaling pathways. Exp Ther Med 20: 3025-3032, 2020.
APA
Zhang, J., Liu, L., Li, F., Wang, Z., & Zhao, J. (2020). Treatment with catalpol protects against cisplatin‑induced renal injury through Nrf2 and NF‑κB signaling pathways. Experimental and Therapeutic Medicine, 20, 3025-3032. https://doi.org/10.3892/etm.2020.9077
MLA
Zhang, J., Liu, L., Li, F., Wang, Z., Zhao, J."Treatment with catalpol protects against cisplatin‑induced renal injury through Nrf2 and NF‑κB signaling pathways". Experimental and Therapeutic Medicine 20.4 (2020): 3025-3032.
Chicago
Zhang, J., Liu, L., Li, F., Wang, Z., Zhao, J."Treatment with catalpol protects against cisplatin‑induced renal injury through Nrf2 and NF‑κB signaling pathways". Experimental and Therapeutic Medicine 20, no. 4 (2020): 3025-3032. https://doi.org/10.3892/etm.2020.9077
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team