Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
May-2022 Volume 23 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2022 Volume 23 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Seminal plasma piRNA array analysis and identification of possible biomarker piRNAs for the diagnosis of asthenozoospermia

  • Authors:
    • Ling He
    • Xingwu Wu
    • Rongye Wu
    • Ping Guo
    • Wenfeng He
    • Wanlei Sun
    • He Chen
  • View Affiliations / Copyright

    Affiliations: Department of Geratology, The Second Affiliated Hospital of Nanchang University, Nanchang, Jiangxi 330006, P.R. China, Assisted Reproductive Center, Jiangxi Maternal and Child Health Hospital, Nanchang, Jiangxi 330006, P.R. China, Department of Clinical Medicine, Jiangxi Health Vocational College, Nanchang, Jiangxi 330052, P.R. China, Obstetrics and Gynecology, Yichun Maternal and Child Health Hospital, Jiangxi 336000, P.R. China, Jiangxi Key Laboratory of Molecular Medicine, The Second Affiliated Hospital of Nanchang University, Nanchang, Jiangxi 330006, P.R. China, Department of Clinical Laboratory, The Second Affiliated Hospital of Nanchang University, Nanchang, Jiangxi 330006, P.R. China
    Copyright: © He et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 347
    |
    Published online on: March 23, 2022
       https://doi.org/10.3892/etm.2022.11275
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Asthenozoospermia (AZS) is characterized by reduced sperm motility and its pathogenesis remains poorly understood. Piwi‑interacting RNAs (piRNAs) have been indicated to serve important roles in spermatogenesis. However, little is known about the correlation of piRNA expression with AZS. In the present study, small RNA sequencing (small RNA‑seq) was performed on sperm samples from AZS patients and fertile controls. Reverse transcription‑quantitative (RT‑q) PCR was used to validate the small RNA‑seq results. Bioinformatics analyses were performed to predict the functions of differentially expressed piRNAs (DEpiRNAs). Logistic regression models were constructed and receiver operating characteristic curve (ROC) analysis was used to evaluate their diagnostic performance. A total of 114 upregulated and 169 downregulated piRNAs were detected in AZS patients. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses showed that the DEpiRNAs were mainly associated with transcription, signal transduction, cell differentiation, metal ion binding and focal adhesion. These results were verified by RT‑qPCR analysis of eight selected piRNAs. The PCR results were consistent with the sequencing results in patients with AZS compared with controls in the first cohort. The expression of piR‑hsa‑32694, piR‑hsa‑26591, piR‑hsa‑18725 and piR‑hsa‑18586 was significantly upregulated in patients with AZS. The diagnostic power of the four piRNAs was further analyzed using ROC analysis; piR‑hsa‑26591 exhibited an area under the ROC curve (AUC) of 0.913 (95% CI: 0.795‑0.994). Logistic regression modelling and subsequent ROC analysis indicated that the combination of the 4 piRNAs achieved good diagnostic efficacy (AUC: 0.935).

Introduction

According to a report from the World Health Organization (WHO), 25% of couples in developing countries experience infertility. Infertility often causes great psychological strain, which can eventually lead to mental illness and ~50% of cases of infertility are caused by male factors (1). Asthenozoospermia (AZS) is one of the most common diseases that causes male infertility. AZS is characterized by impaired sperm motility, which prevents sperm from reaching the egg and leads to infertility (2). However, the pathogenesis of AZS has remains to be elucidated. A previous study demonstrated that small noncoding RNAs (ncRNAs), especially piwi-interacting RNAs (piRNAs), serve key regulatory roles in the pathogenesis of AZS (3).

piRNAs are a unique class of small non-coding (nc)RNAs that are 26-30 nucleotides in length and guide Piwi proteins (2). These short ncRNAs were originally discovered in mammalian testicular cells and have been proven to be regulatory molecules involved in germ cell maintenance in mammals (4). Spermatogenesis is a tightly regulated process that mainly includes spermatogonia proliferation and spermatogenesis. This process produces abundant amounts of sperm. Abnormal expression of piRNAs in testicular cells may lead to the failure of spermatogenesis (4). Heyn et al (5) found that the expression of five piRNAs (piR-DQ589977, piR-DQ591415, piR-DQ598918, piR-DQ601291 and piR-DQ601609) was dysregulated in patients with spermatogenesis failure and that this dysregulation was correlated with the level of methylation of the piwi2 and Tudor domain protein 1 (tdrd1) gene promoters. Bioinformatics analysis of these five piRNAs also revealed some other potential target genes, such as IL-16, kallikrein, G protein coupled receptor, histone family and Ras oncogene family members. Kamaliyan et al (6) observed that the rs508485 mutation in the hiwi2 gene affected the stability of mRNA or changed the binding affinity of micro (mi)RNA and resulted in idiopathic nonobstructive azoospermia. Hong et al (7) identified 5 piRNAs as biomarkers for the diagnosis of AZS. However, little is known about the expression patterns and functions of piRNAs in AZS.

Therefore, the present study aimed to determine the expression patterns and functions of piRNAs in AZS patients. Bioinformatics analysis was conducted to elucidate the potential biological functions of piRNAs. These results may provide new biomarkers for the development of novel diagnostic and therapeutic strategies for AZS.

Materials and methods

Medical ethics statement

The protocol of the present study was approved by the Medical Ethics Committee of Nanchang University, the Second Affiliated Hospital and Jiangxi Maternal and Child Health Hospital (China; approval no. 2018089). All donors provided written informed consent for the collection and use of their samples for this protocol.

Sample collection

The present study selected 194 patients who were diagnosed with male sterility due to AZS and 143 normal healthy males who visited the Maternal and Child Health Hospital in Jiangxi Province between January 2019 and December 2020. A total of four patient specimens and three normal specimens were randomly selected for RNA expression analysis and 250 samples (150 AZS patient and 100 normal individuals) and 80 samples (40 AZS patient and 40 normal individuals) were randomly selected for the clinical verification experiment by reverse transcription-quantitative (RT-q) PCR assays. Semen samples (6-8 ml) were collected in a dry and sealed aseptic container. Sperm morphology, concentration, motility and quantity was used to evaluate sperm quality. According to the fifth edition of the AZS diagnostic criteria in 2010(8), the proportions of sperm with fast progressive motility <25% and total progressive motility <50% in fresh ejaculates were determined. The characteristics of normal sperm samples were as follows: Semen concentration ≥15x106/ml, volume ≥2 ml, pH ≥7.2, progressive motility (PR) ≥32% and PR + nonprogressive motility (NP) ≥40%. The age range of the AZS patients and the normal controls was 28-40 years and the groups were well matched in terms of drinking and smoking habits. Controls affected by fertility diseases or abnormal sperm quality were excluded from this study. Patients with gonadal dysplasia due to congenital or inherited disease were excluded from the study (9). The semen samples were liquefied at 37˚C for 30 min and separated by a discontinuous 45/85% Percoll density gradient to eliminate contaminating round cells, including germ cells and white blood cells. The spermatozoa in the lower (85% Percoll) layer were preserved and washed 3 times with phosphate-buffered saline (PBS) (10). The quality of the purified sperm was examined by light microscopy (OLYMPUS, CX43,x200 magnification).

RNA isolation and RT-qPCR

Total RNA was extracted from semen samples by TRIzol® (Thermo Fisher Scientific, Inc.; cat. no. 15596-018) reagent according to the manufacturer's specifications, the yield was determined by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.) and the integrity was assessed by agarose gel electrophoresis with ethidium bromide staining.

Quantification was performed with a two-step reaction process: Reverse transcription (RT) and PCR. Each RT reaction consisted of 0.5 µg RNA, 5 µl 2XTS miRNA Reaction Mix and 0.5 µl of TransScrip miRNA RT Enzyme Mix (TransGen Biotech, AT351), in a total volume of 10 µl. Reactions were performed in a GeneAmp PCR System 9700 (Applied Biosystems; Thermo Fisher Scientific, Inc.) for 60 min at 37˚C, followed by heat inactivation of RT for 5 sec at 85˚C. The 10 µl RT reaction mix was then diluted x10 in nuclease-free water and held at -20˚C.

RT-PCR was performed with a LightCycler 480 II Real-time PCR Instrument (Roche Diagnostics GmbH) in a 10-µl reaction system that included 1 µl of cDNA, 5 µl of 2x PerfectStart Green qPCR SuperMix (TransGen Biotech, AQ601), 0.2 µl of 10 µM universal primers, 0.2 µl of 10 µM miRNA-specific primer and 3.6 µl of nuclease-free water. The reactions were incubated in a 96-well plate (Beijing Jiaxinheng Biotechnology Co., Ltd.) at 94˚C for 30 sec, followed by 40 cycles of 95˚C for 10 sec and 65˚C for 35 sec. Each sample was run in triplicate. At the end of the reaction cycle, melting curve analysis was performed to detect the product specificity. The tailing method is used in the reverse transcription of piRNA, so the quantitative primer only needs to design the F primer and the R primer is the general primer sequence of the kit (TransGen Biotech Co., Ltd.; cat. no. AT351-01), GATCGCCCTTCTACGTCGTAT (TM=58˚C). The piRNA-specific primer sequences were synthesized by Beijing Qingke Xinye Biotechnology Co., Ltd. based on the piRNA sequences obtained from the piRNABase database (regulatoryrna.org/database/piRNA; Release 20.0). 5S rRNA was used as the reference gene and the piRNA expression levels were calculated using the 2-ΔΔCq method (11).

Bioinformatics analysis

Briefly, small RNA sequencing and analysis were conducted by Shanghai Oe Biotech. Co., Ltd. Data from Illumina HiSeq sequencing are called raw reads. First, the splice sequence was removed from the raw reads and then small RNA sequences of different lengths were obtained. Cutadapt (version 1.14) (12), fastx Toolkit (version 0.0.13) (13) and NGSQCToolkit (version 2.3.2) (14) software were used to control the quality of these sequences, remove n-base sequences and sequences with a low Q20 ratio and remove data outside the range of 15-41 NT, which were not included in the subsequent analysis. The resulting sequences were called clean reads (15) and these reads were further analyzed. These sequences were matched with known sequences in the databases of piRBase (v2.0 of piRBase) miRNA (miRbase v19.0; mirdb.org/) Rfram (version 10.0) (16) and the matched sequences were considered to be known piRNAs, miRNAs and other small RNAs. piRNAs were selected for subsequent analysis and functional annotation (17-19).

Differentially expressed genes (DEGs) between the AZS patients and the fertile controls were identified using DEG-seq software (version 1.18.0). Genes with q-values (FDRs) <0.05 and fold-changes >2.0 were considered differentially expressed (20,21). The miRanda algorithm (version 3.3a) was used to predict piRNA target genes and the threshold parameters were s ≥150, ΔG ≤-30 kcal/mol and strict 5' seed pairing (18,22,23). Gene Ontology (GO; geneontology.org) functional analysis and the Kyoto Encyclopedia of Genes and Genomes (KEGG; genome.jp/kegg/) database were used to annotate and analyze the pathways of the target genes of the different piRNAs. Significant enrichment items were screened according to a P-value ≤0.05.

Statistical analysis

Differences in demographic variables and expression levels of piRNA in the AZS group and the fertile control group were evaluated via the χ2 test. Fisher's exact test and hypergeometric distribution test were performed to assess the enrichment significance of GO items or KEGG pathways in the differentially expressed genes.

To evaluate the specificity and sensitivity of each piRNA in the diagnostic value of AZS, the ROC curves and AUC were analyzed. A high Youden's index (sensitivity and specificity-1) was used to calculate the cut-off value of the optimal diagnostic point of the ROC curve. Binary logistic regression and ROC curves were used to improve the diagnostic efficiency. All the statistical analyses were performed in SPSS (Version 23, SPSS Inc.) and R software (v 3.5.0; r-project.org/). P<0.05 was considered to indicate a statistically significant difference.

Results

Patient data analysis and seminal plasma piRNA profiling

A total of seven semen samples were collected from AZS patients and male healthy controls according to the WHO guidelines. The basic information and sperm parameters of the AZS patients and healthy controls are presented in Table I. There were no distinct differences in age, BMI and smoking or drinking habits between the AZS and control groups (P>0.05). However, there were obvious differences in motility and sperm morphology (P<0.001) between the AZS and control groups. The semen samples were observed under a light microscope equipped with a 100x oil objective and were found to be free of seminiferous epithelium cells, somatic cells and white blood cells.

Table I

Basic information and parameters of AZS and fertile controls.

Table I

Basic information and parameters of AZS and fertile controls.

CharacteristicAZS (194.0)Fertile controls (143)P-value
Age (years)34.00±5.333.5±5.320.927
BMI23.50±3.6924.6±2.790.923
Smoking  0.87
     Yes146 (75.00%)107 (75%) 
     No48 (25%)36 (25%) 
Drinking  0.96
     Yes139 (71%)1033 (71%) 
     No55 (29%)40.00 (29%) 
Sperm volume (ml)4±0.683±0.630.87
pH7.6±0.157.7±0.180.56
Sperm density (x106/ml)58.59±6.3434.12±5.43 <0.001a
PR16.18±3.262.55±3.8 <0.001a
Sperm activity rate22.12±5.6477.34±3.2 <0.001a

[i] AZS, asthenozoospermia; PR, progressive motility.

[ii] aDifference was statistically significant (P<0.05).

Small RNAs were extracted from the semen specimens of healthy controls and AZS patients and analyzed by Illumina high-throughput sequencing. First, the splice sequences were eliminated from the raw reads and small RNA sequences of different lengths were obtained. After quality control steps, small RNAs in the range of 10 to 45 nucleotides (nt) were obtained. Length distribution analysis showed that all the samples contained many RNAs shorter than 45 nt, which was consistent with the lengths of miRNAs (18-224 nt) and piRNAs (26-330 nt; Fig. 1). In general, piRNAs account for a part of the total RNA content in seminal plasma. Among the 77 million piRNAs annotated in the piRBase database, 1,585,622 piRNAs were detected in the healthy control and AZS samples.

Figure 1

Small RNA length distribution map. RNAs 18-24 nucleotides in length are miRNAs and RNAs 26-31 nucleotides in length are piRNAs. Patient: asthenozoospermia vs. control.

Identification of differential piRNA expression

DEG-seq software was used to analyze the differences in piRNA expression levels between the AZS and normal groups. A total of 283 differentially expressed piRNAs were obtained with a significance threshold of |log2FC|≥1 and P-value ≤0.05, including 114 upregulated DEGs and 169 downregulated DEGs. Volcano plots and heatmaps of the DEGs are shown in Fig. 2A and B. Fig. 2C and D and Table II present 20 DEpiRNAs, including the top 10 most strongly upregulated DEpiRNAs and the top 10 most strongly downregulated DEpiRNAs.

Figure 2

DEpiRNAs between patients with AZS and normal controls. (A and B) Visual images of DEGs between the AZS and normal groups. (C and D) Visual images of the top 20 DEGs between the AZS and fertile control groups. The green and red dots indicate the upregulated and downregulated genes, respectively (threshold of |log2fold change |≥1.0 and P≤0.05). The grey dots indicate that there were no differentially expressed genes. Rows and columns are used to represent DEGs and samples. Case: AZS vs. normal. Different degrees of color represent the expression level of DEGs. DEpiRNAs, differentially expressed piwi-interacting RNAs; AZS, asthenozoospermia; DEGs, differentially expressed genes.

Table II

Differentially expressed genes between AZS and controls (top 10).

Table II

Differentially expressed genes between AZS and controls (top 10).

UpregulatedDownregulated
GenelogFCP-valueGenelogFCP-value
piR-265918.4909850.004693piR-15551-6.520240.009999
piR-326947.7125830.000754piR-29529-6.493040.009822
piR-187257.2218090.009867piR-25106-6.178030.006124
piR-167826.3337060.006759piR-2645-5.632360.006583
piR-254916.2243440.004153piR-9170-5.575970.002927
piR-59525.675970.006451piR-2912-5.329210.003
piR-186115.6698880.008762piR-23203-4.820640.005891
piR-185865.5279720.009949piR-6148-4.65610.007541
piR-158115.4067270.007682piR-32713-4.106660.006346
piR-177254.9567040.004188piR-29155-4.073760.009545
114  169  

[i] AZS, asthenozoospermia; piR, piwi-interacting RNA.

GO and KEGG pathway analysis

GO enrichment analysis was used to explore the potential functions of these DEpiRNA-target genes. The top 30 most frequent GO terms are shown in Fig. 3 and Table III. As shown in Fig. 3A-C, the top 3 cellular component (CC) terms were nucleus, cytosol and cytoplasm; the top 3 biological process (BP) terms were transcription, regulation of transcription and signal transduction; and the top 3 molecular function terms (MF) were metal ion binding, ATP and DNA binding.

Figure 3

Enrichment analyses of DEpiRNA. (A-C) Top 30 GO enriched terms among all differentially expressed genes and among upregulated and downregulated genes. (D-F) Top 20 KEGG pathways enriched among the total differentially expressed, upregulated and downregulated genes. DEpiRNAs, differentially expressed piwi-interacting RNAs; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Table III

Top 30 GO terms of DEpiRNA-target genes.

Table III

Top 30 GO terms of DEpiRNA-target genes.

 Biological processCellular componentMolecular function
Top 30 GO terms of total DEpiRNA-target genesTranscription, DNA-templatedNucleusMetal ion binding
Regulation of transcription, DNA-templatedCytosolATP binding
Signal transductionCytoplasmDNA binding
Positive regulation of transcription from RNA polymerase II promoterPlasma membraneRNA binding
Negative regulation of transcription from RNA polymerase II promoterNucleoplasmIdentical protein binding
Intracellular signal transductionIntegral component of membraneDNA binding transcription factor activity
Multicellular organism developmentExtracellular exosomeZinc ion binding
Cell differentiationMembraneCalcium ion binding
Positive regulation of transcription, DNA-templatedIntegral component of plasma membrane 
Protein homodimerization activity  
Negative regulation of transcription, DNA-templatedMitochondrionProtein serine/threonine kinase activity
Top 30 GO terms of upregulatedTranscription, DNA-templatedNucleusMetal ion binding
Regulation of transcription, DNA-templatedCytosol 
DEpiRNA-target genesATP binding  
Positive regulation of transcription from RNA polymerase II promoterCytoplasm 
DNA binding  
Signal transductionPlasma membraneRNA binding
Multicellular organism developmentIntegral component of membraneIdentical protein binding
Negative regulation of transcription from RNA polymerase II promoterNucleoplasmZinc ion binding
Intracellular signal transductionExtracellular exosomeDNA binding transcription factor activity
G-protein coupled receptor signaling pathwayMembraneCalcium ion binding
Cell adhesionIntegral component of plasma membraneActin binding
Cell differentiationExtracellular regionProtein homodimerization activity
The top 30 GO terms of downregulatedTranscription, DNA-templatedCytosolMetal ion binding
Regulation of transcription, DNA-templatedNucleusRNA binding
DEpiRNA-target genePositive regulation of transcription from RNA polymerase II promoterCytoplasmATP binding
G-protein coupled receptor signaling pathwayPlasma membraneDNA binding
Intracellular protein transportNucleoplasmIdentical protein binding
Intracellular signal transductionIntegral component of membrane 
Calcium ion binding  
Cell adhesionExtracellular exosomeIon channel binding
Signal transductionMembraneDNA binding transcription factor activity
Multicellular organism developmentGolgi apparatusRab GTPase binding
Negative regulation of transcription from RNA polymerase II promoterCell junctionProtein serine;threonine kinase activity

[i] GO, Gene Ontology; DEpiRNAs, differentially expressed piwi-interacting RNA.

KEGG pathway analysis was used to identify all the pathways and the top 20 most highly enriched pathways related to the DEpiRNA-target genes (Fig. 3D-F, Table IV). The target genes enriched among the AZS DEGs were mainly involved in focal adhesion, actin cytoskeleton, axon guidance, ErbB signaling pathway and other signal transduction pathways.

Table IV

Top 20 KEGG pathways of DEpiRNA-target genes (upregulated and downregulated).

Table IV

Top 20 KEGG pathways of DEpiRNA-target genes (upregulated and downregulated).

Gene itemTop 20 KEGG pathways
Total DEpiRNA-target genesMicroRNAs in cancer
 Proteoglycans in cancer
 Bacterial invasion of epithelial cells
 Regulation of actin cytoskeleton
 Signaling pathways regulating pluripotency of stem cells
 Tight junction
 Adherens junction
 Cell adhesion molecules (CAMs)
 Focal adhesion
 Axon guidance
 Sulfur relay system
 ErbB signaling pathway
 Sulfur metabolism
 Glycosphingolipid biosynthesis-ganglio series
 Inositol phosphate metabolism
 Glycosaminoglycan biosynthesis-keratan sulfate
 Neomycin, kanamycin and gentamicin biosynthesis
 Other types of O-glycan biosynthesis
 D-Arginine and D-ornithine metabolism
 Valine, leucine and isoleucine biosynthesis
Upregulated DEpiRNA-target genesMicroRNAs in cancer
 Protein digestion and absorption
 Cushing syndrome
 Aldosterone synthesis and secretion
 Protein digestion and absorption
 Insulin signaling pathway
 Cholinergic synapse
 Neurotrophin signaling pathway
 Circadian entrainment
 ECM-receptor interaction
 Focal adhesion
 Axon guidance
 Phospholipase D signaling pathway
 cAMP signaling pathway
 Calcium signaling pathway
 Ras signaling pathway
 ErbB signaling pathway
 Glycerophospholipid metabolism
 Acute myeloid leukemia
 Glioma
Downregulated DEpiRNA-target genesCentral carbon metabolism in cancer
 Proteoglycans in cancer
 Salmonella infection
 Mineral absorption
 Protein digestion and absorption
 Carbohydrate digestion and absorption
 Endocrine and other factor-regulated calcium reabsorption
 Cortisol synthesis and secretion
 Thyroid hormone signaling pathway
 Synaptic vesicle cycle
 Circadian rhythm
 Tight junction
 Hippo signaling pathway
 Ubiquitin mediated proteolysis
 Calcium signaling pathway
 MAPK signaling pathway
 EGFR tyrosine kinase inhibitor resistance
 Nicotinate and nicotinamide metabolism
 Valine, leucine and isoleucine biosynthesis
 Purine metabolism

[i] KEGG, Kyoto Encyclopedia of Genes and Genomes; DEpiRNAs, differentially expressed piwi-interacting RNA.

Validation of piRNAs expression

To validate the small RNA-seq results, RT-qPCR analysis was performed on 8 piRNAs among the DEGs. The present study selected four upregulated piRNAs (hsa-32694, hsa-26591, hsa-18725 and hsa-18586) and four downregulated piRNAs (hsa-6148, hsa-32713, hsa-2912 and hsa-15551) to quantify their expression in the AZS and normal group semen samples. The primer sequences used for investigating piRNA expression are listed in Table V. As shown in Fig. 4, the expression of piR-hsa-32694, piR-hsa-26591, piR-hsa-18725 and piR-hsa-18586 was upregulated in the AZS group compared with the normal group and the downregulated expression patterns were also consistent with the small RNA-seq results.

Figure 4

Expression levels of piRNAs in the semen from AZS patients and controls. (A) piR-has-32694, (B) piR-has-26591, (C) piR-has-18725, (D) piR-has-18586, (E) piR-has-6148, (F) piR-has-3217, (G) piR-has-15551 and (H) piR-has-2912. ***P<0.01 control vs. AZS). piRNA/piR, piwi-interacting RNA; AZS, asthenozoospermia.

Table V

Primers sequences of the piRNA.

Table V

Primers sequences of the piRNA.

Gene symbol (piRNA)Primer 5'→3'
piR-hsa-26591 GACGAGGTGGCCGAGTGGTT
piR-hsa-32694 GAACAAGAAGACACTCGTGG
piR-hsa-18725 GACACTCGTGGAGGCGTCA
piR-hsa-18586 AGACACTCGTGGAGACGTC
piR-hsa-32713 CCTAGAAGACTGACTCTTTGC
piR-hsa-6148 TAGTGGTTATCACTTTCGCCT
piR-hsa-2912 TCCAACTGCTCTACGACACA
piR-hsa-15551 TGCGACGAGATGCTGCTTC
hsa-5S GGAGACCGCCTGGGAATA

[i] piR, piwi-interacting RNA.

Evaluation of piRNAs as a diagnostic marker for AZS

Illumina high-throughput sequencing analysis indicated that the piR-hsa-32694, piR-hsa-26591, piR-hsa-18725 and piR-hsa-18586 expression levels were obviously different between AZS patients and controls. Therefore, the diagnostic value of these four piRNAs as potential biomarkers for AZS was assessed and evaluated. ROC curve analysis was used to calculate whether piR-hsa-32694, piR-hsa-26591, piR-hsa-18725 and piR-hsa-18586 could distinguish AZS patients from controls. As shown in Fig. 5, 150 patients with AZS and 100 normal controls were used as a training cohort to build a diagnostic model using binary logistic regression. The AUCs of piR-hsa-18586, piR-hsa-18725, piR-hsa-26591 and piR-hsa-32694 were 0.850 (95% CI: 0.861-0.9644 P<0.007), 0.875 (95% CI: 0.761-0.9244 P<0.004), 0.913 (95% CI: 0.751-0.9134 P<0.001) and 0.883 (95% CI: 0.721-0.9744 P<0.003), respectively. To improve the diagnostic power, these four piRNAs were combined as diagnostic model. An AUC of 0.935 (95% CI: 0.741-0.978; P<0.001) was observed when the model was applied to a testing cohort (250 specimens mentioned above and the recollected samples of 40 controls and 40 AZS patients) to estimate the diagnostic accuracy of the joint diagnosis model (Fig. 6). These results showed that the combined diagnostic model could distinguish AZS patients from controls (specificity=95%, sensitivity=90%).

Figure 5

Diagnostic power of the four piRNA potential biomarkers, as determined using receiver operating characteristic curve analysis. (A) piR-has-18586, (B) piR-has-18725, (C) piR-has-26591, (D) piR-has-32694. [The optimal diagnostic point was assessed at the cut-off values with the highest Youden's indices (sensitivity and specificity-1)] piRNA/piR, piwi-interacting RNA; AUC, area under curve.

Figure 6

Diagnostic model of AZS using four piRNAs (expression of piR-has-18586, piR-has-18725, piR-has-26591 and piR-has-32694 used as a training set). piRNA/piR, piwi-interacting RNA; AUC, area under curve.

Discussion

The present study identified the comprehensive piRNA expression pattern in the semen samples of AZS patients. The small RNA sequencing data revealed that a total of 283 significant DEpiRNAs (114 upregulated and 169 downregulated) were obtained at a threshold of |log2FC|≥1 and P≤0.05. Further analyses, including DEpiRNA analysis and GO and KEGG pathway analyses, were performed to predict the functions of DEpiRNAs, which revealed the critical roles of piRNAs in regulating spermatogenesis. These sequencing results were validated by RT-qPCR analysis of eight piRNAs, specifically, four upregulated piRNAs (piR-hsa-32694, piR-hsa-26591, piR-hsa-18725 and piR-hsa-18586) and four downregulated piRNAs (piR-hsa-6148, piR-hsa-32713, piR-hsa-2912 and piR-hsa-15551). Of these, piR-hsa-32694, piR-hsa-26591, piR-hsa-18725, piR-hsa-18586 and piR-hsa-2912 produced RT-qPCR results consistent with the sequencing results, whereas piR-hsa-6148, piR-hsa-32713 and piR-hsa-15551 did not show significant differences in expression between the AZS and control samples. The expression of piR-hsa-32694, piR-hsa-26591, piR-hsa-18725 and piR-hsa-18586 was significantly upregulated in patients with AZS. The diagnostic power of these four piRNAs was further analyzed using ROC analysis and piR-hsa-26591 was found to be the piRNA with the most potential for diagnosing AZS, with an AUC of 0.913 (95% CI: 0.795-0.994). A logistic regression model including all four piRNAs was constructed and ROC analysis revealed that the combination model achieved good diagnostic efficacy (AUC: 0.935). Therefore, these piRNAs were identified as hub genes that participate in AZS pathogenesis and could serve as biomarkers for this disease.

Human spermatogenesis is a carefully coordinated and precisely regulated biological process that includes rigorous regulation of gene expression at specific phases (24). ncRNAs, such as circular RNAs, long non-coding RNAs and miRNAs, are critical regulators of gene transcription and translation in different phases of spermatogenesis (25-27). piRNAs are small ncRNAs that are mainly expressed in human germ cells. piRNAs can maintain cell genome integrity, inhibit transposon transcription and translation and participate in cell heterochromatin formation, epigenetic regulation and mammalian germ cell genesis (28). To date, there have been few reports describing the changes in the piRNA profile in human AZS patients. In light of the role of piRNAs in male reproduction, the changes in the expression profile of piRNAs in sperm from patients with AZS was studied and the the differential expression of piRNAs in AZS patients and controls analyzed to explore the unknown pathological mechanism of AZS.

Studies have shown that piRNAs affect gene silencing mainly by binding to Piwi subfamily proteins of the Ago/Piwi protein family. Human piwi family proteins, PIWIL1, PIWIL2, PIWIL3 and PIWIL4 are expressed in testis tissues (1,3,4). Dai et al (29) showed that a piwi mutation is pathogenic, causing male infertility and established a clear relationship between the human piwi gene and male infertility. In addition to its main functions in transposon silencing, the piwi/piRNA mechanism affects the degradation of generous mRNA transcripts in various germ cells through miRNA- or/and short interfering RNA-like mechanisms (30,31). The present study predicted the target genes of piRNAs that were differentially expressed between the control group and the AZS group to explore how the DEpiRNAs might alter sperm function. In addition, enrichment analysis based on these predicted target genes showed that cell macromolecule biosynthesis, spermatogenesis, male gametogenesis, cytoplasmic transport and RNA metabolism were altered in the AZS group. Enrichment pathway analysis showed that the DEpiRNA target genes were involved in focal adhesion kinase (FAK), actin cytoskeleton, axon guidance, the ErbB signaling pathway and other signal transduction pathways. A notable study showed that FAK coordinates the transport of spermatozoa and prealbumin spermatids through the epithelium along the functional axis of the acroplasmic thinning-blood testicular barrier basement membrane (32). A study of pig sperm found that altered expression of many mRNAs is associated with infertility and involved in metabolic processes. Specifically, these altered genes ensure the production of fertile sperm by promoting 26S proteasome exchange, nucleoprotein digestion and cytoplasmic residue absorption and supporting cell phagocytosis to eliminate damaged RNA (33,34). Through the analysis of animal models and human patient data, López-Lemus et al (35) found that testis (germinal epithelium) is one of the organs damaged by the multisystem effect of Nonalcoholic fatty liver disease (NAFLD). Previous studies on animal models reported that NAFLD does not affect sperm morphology by reducing testosterone synthesis (35,36). A study of the European eel (Anguilla anguilla) shows that the liver seems to serve a role in determining the number of sperm by producing some fatty acids (37). The results of the present study also supported the hypothesis that the metabolism of FAK, fatty acids and other macromolecules affects sperm development and maturation.

Previous reports identified mRNAs that are related to sperm motility, particularly transcripts encoding flagella-associated protein 45 (CFAP45) and bromodomain-containing 2 (BRD2). The content of CFAP45 in low motile power sperm is significantly higher compared with that in high motile power sperm, while the content of BRD2 mRNA in sperm from AZS patients is significantly lower (38,39). This indicates that low sperm motility could be attributed to the abnormal expression of CFAP45 and BRD2. The present study found that the expression of four piRNAs, piR-hsa-32694, piR-hsa-26591, piR-hsa-18725 and piR-hsa-18586, was significantly upregulated in AZS patients. Furthermore, the ROC curve analysis revealed that the AUC of the combination of the four piRNAs was equal to 0.935 and demonstrated 93.8% sensitivity and 89.3% specificity. These results suggested that these four piRNAs were significantly and independently associated with sperm motility and male infertility. Bioinformatics analysis showed that CAFP45 and BRD2 were the potential target genes of piR-hsa-26591. Whether piR-hsa-26591 silences the expression of CAFP45 and BRD2 and leads to decreased sperm motility and infertility in AZS patients requires further study. Overall, the present study may provide insights into the use of human sperm cell-specific piRNAs as biomarkers for AZS screening. The present study has some limitations. First, the small number of samples limited the statistical power of the microarray analysis. Second, it did not use a luciferase reporter assay to further verify the relationship between piR-hsa-26591 and CAFP45.

In summary, the present study identified a piRNA expression profile and defined the potential function of DEpiRNAs in AZS. Moreover, the findings also provide some information regarding the pathological mechanisms of male infertility.

Acknowledgements

Not applicable.

Funding

Funding: The present study was funded by the Provincial Natural Science Foundation of Jiangxi (grant nos. 20181BAB205024 and 20181BAB205013), Project of Jiangxi Provincial Health Department (grant nos. 20181075, 20181084 and 2017A100), Science and Technology Research Project of Jiangxi Provincial Department of Education (grant nos. 20160165, 171353, 170096 and 170014) and Graduate Innovation Fund Project of Jiangxi Province (grant no. YC2012-B011).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

All the authors were involved in the conception and design of the study and data interpretation. LH and HC performed the experiments, XW and RW analyzed the data and PG, WH and WS helped perform the experiments. LH prepared the manuscript. HC oversaw the project and proofread the manuscript. LH and HC confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The protocol of the present study was approved by the Medical Ethics Committee of Nanchang University, the Second Affiliated Hospital and Jiangxi Maternal and Child Health Hospital (China; approval no. 2018089). All donors provided informed consent for the collection and use of their samples for this protocol.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Vander Borght M and Wyns C: Fertility and infertility: Definition and epidemiology. Clin Biochem. 62:2–10. 2018.PubMed/NCBI View Article : Google Scholar

2 

Wu X, Pan Y, Fang Y, Zhang J, Xie M, Yang F, Yu T, Ma P, Li W and Shu Y: The biogenesis and functions of piRNAs in human diseases. Mol Ther Nucleic Acids. 21:108–20. 2020.PubMed/NCBI View Article : Google Scholar

3 

Ozata DM, Gainetdinov I, Zoch A, O'Carroll D and Zamore PD: PIWI-interacting RNAs: Small RNAs with big functions. Nat Rev Genet. 20:89–108. 2019.PubMed/NCBI View Article : Google Scholar

4 

Charlesworth AG, Nitschko V, Renaud MS and Claycomb JM: PIWI puts spermatogenesis in its place. Dev Cell. 57:149–151. 2022.PubMed/NCBI View Article : Google Scholar

5 

Heyn H, Ferreira HJ, Bassas L, Bonache S, Sayols S, Sandoval J, Esteller M and Larriba S: Epigenetic disruption of the PIWI pathway in human spermatogenic disorders. PLoS One. 7(e47892)2012.PubMed/NCBI View Article : Google Scholar

6 

Kamaliyan Z, Pouriamanesh S, Soosanabadi M, Gholami M and Mirfakhraie R: Investigation of piwi-interacting RNA pathway genes role in idiopathic non-obstructive azoospermia. Sci Rep. 8(142)2018.PubMed/NCBI View Article : Google Scholar

7 

Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, et al: Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. Sci Rep. 6(24229)2016.PubMed/NCBI View Article : Google Scholar

8 

Lu JC, Huang YF and Lü N: WHO laboratory manual for the examination and processing of human semen: Its applicability to andrology laboratories in China. Zhonghua Nan Ke Xue. 16:867–871. 2010.PubMed/NCBI(In Chinese).

9 

None. WHO laboratory manual for the examination of human semen and sperm-cervical mucus interaction. J Androl. 17(442)1996.

10 

Satoru K, Shigeru O, Kiyoshi K, Toshifumi K, Hideo M and Rihachi I: Purification of human sperm by a discontinuous Percoll density gradient with an innercolumn. Biol Reprod. 35:1059–1063. 1986.PubMed/NCBI View Article : Google Scholar

11 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

12 

Martin M: Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 17:10–12. 2011.

13 

Gordon A and Hannon GJ: Fastx-toolkit. FASTQ/A short-reads pre-processing tools, 2010. http://hannonlabcshl.edu/fastx_toolkit.

14 

Patel RK and Jain M: NGS QC toolkit: A toolkit for quality control of next generation sequencing data. PLoS One. 7(e30619)2012.PubMed/NCBI View Article : Google Scholar

15 

Fu Y, He W, Zhou C, Fu X, Wan Q, He L and Wei B: Bioinformatics analysis of circRNA expression and construction of ‘circRNA-miRNA-mRNA’ competing endogenous RNAs networks in bipolar disorder patients. Front Genet. 12(718976)2021.PubMed/NCBI View Article : Google Scholar

16 

Wang J, Zhang P, Lu Y, Li Y, Zheng Y, Kan Y, Chen R and He S: piRBase: A comprehensive database of piRNA sequences. Nucleic Acids Res. 47:D175–D180. 2019.PubMed/NCBI View Article : Google Scholar

17 

Griffiths-Jones S, Saini HK, van Dongen S and Enright AJ: miRBase: Tools for microRNA genomics. Nucleic Acids Res. 36:D154–D158. 2008.PubMed/NCBI View Article : Google Scholar

18 

Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ: miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 34 (Database Issue):D140–D144. 2006.PubMed/NCBI View Article : Google Scholar

19 

Griffiths-Jones S, Bateman A, Marshall M, Khanna A and Eddy SR: Rfam: An RNA family database. Nucleic Acids Res. 31:439–441. 2003.PubMed/NCBI View Article : Google Scholar

20 

Love MI, Huber W and Anders S: Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15(550)2014.PubMed/NCBI View Article : Google Scholar

21 

Tino P: Basic properties and information theory of Audic-Claverie statistic for analyzing cDNA arrays. BMC Bioinformatics. 10(310)2009.PubMed/NCBI View Article : Google Scholar

22 

John B, Enright AJ, Aravin A, Tuschl T, Sander C and Marks DS: Human MicroRNA targets. PLoS Biol. 2(e363)2004.PubMed/NCBI View Article : Google Scholar

23 

Enright AJ, John B, Gaul U, Tuschl T, Sander C and Marks DS: MicroRNA targets in Drosophila. Genome Biol. 5(R1)2003.PubMed/NCBI View Article : Google Scholar

24 

Alexa A and Rahnenfuhrer J: topGO: Enrichment analysis for gene ontology. R package version. 28:2013.

25 

Manfrevola F, Chioccarelli T, Cobellis G, Fasano S, Ferraro B, Sellitto C, Marella G, Pierantoni R and Chianese R: CircRNA role and circRNA-dependent network (ceRNET) in asthenozoospermia. Front Endocrinol (Lausanne). 11(395)2020.PubMed/NCBI View Article : Google Scholar

26 

Lu H, Xu D, Wang P, Sun W, Xue X, Hu Y, Xie C and Ma Y: RNA-sequencing and bioinformatics analysis of long noncoding RNAs and mRNAs in the asthenozoospermia. Biosci Rep. 40(BSR20194041)2020.PubMed/NCBI View Article : Google Scholar

27 

Heidary Z, Zaki-Dizaji M, Saliminejad K and Khorram Khorshid HR: MicroRNA profiling in spermatozoa of men with unexplained asthenozoospermia. Andrologia. 51(e13284)2019.PubMed/NCBI View Article : Google Scholar

28 

Larriba E and Del Mazo J: An integrative piRNA analysis of mouse gametes and zygotes reveals new potential origins and gene regulatory roles. Sci Rep. 8(12832)2018.PubMed/NCBI View Article : Google Scholar

29 

Dai P, Wang X and Liu MF: A dual role of the PIWI/piRNA machinery in regulating mRNAs during mouse spermiogenesis. Sci China Life Sci. 63:447–449. 2020.PubMed/NCBI View Article : Google Scholar

30 

Gou LT, Kang JY, Dai P, Wang X, Li F, Zhao S, Zhang M, Hua MM, Lu Y, Zhu Y, et al: Ubiquitination-deficient mutations in human piwi cause male infertility by impairing histone-to-protamine exchange during spermiogenesis. Cell. 169:1090–1104.e13. 2017.PubMed/NCBI View Article : Google Scholar

31 

Hasuwa H, Ishino K and Siomi H: Human PIWI (HIWI) is an azoospermia factor. Sci China Life Sci. 61:348–350. 2018.PubMed/NCBI View Article : Google Scholar

32 

Xiao X, Mruk DD, Wong CK and Cheng CY: Germ cell transport across the seminiferous epithelium during spermatogenesis. Physiology (Bethesda). 29:286–298. 2014.PubMed/NCBI View Article : Google Scholar

33 

Yang CC, Lin YS, Hsu CC, Tsai MH, Wu SC and Cheng WT: Seasonal effect on sperm messenger RNA profile of domestic swine (Sus Scrofa). Anim Reprod Sci. 119:76–84. 2010.PubMed/NCBI View Article : Google Scholar

34 

Percipalle P: New insights into co-transcriptional sorting of mRNA for cytoplasmic transport during development. Semin Cell Dev Biol. 32:55–62. 2014.PubMed/NCBI View Article : Google Scholar

35 

López-Lemus UA, Garza-Guajardo R, Barboza-Quintana O, Rodríguez-Hernandez A, García-Rivera A, Madrigal-Pérez VM, Guzmán-Esquivel J, García-Labastida LE, Soriano-Hernández AD, Martínez-Fierro ML, et al: Association between nonalcoholic fatty liver disease and severe male reproductive organ impairment (germinal epithelial loss): Study on a mouse model and on human patients. Am J Mens Health. 12:639–648. 2018.PubMed/NCBI View Article : Google Scholar

36 

Li Y, Liu L, Wang B, Xiong J, Li Q, Wang J and Chen D: Impairment of reproductive function in a male rat model of non-alcoholic fatty liver disease and beneficial effect of N-3 fatty acid supplementation. Toxicol Lett. 222:224–232. 2013.PubMed/NCBI View Article : Google Scholar

37 

Baeza R, Mazzeo I, Vílchez MC, Gallego V, Peñaranda DS, Pérez L and Asturiano JF: Relationship between sperm quality parameters and the fatty acid composition of the muscle, liver and testis of European eel. Comp Biochem Physiol A Mol Integr Physiol. 181:79–86. 2015.PubMed/NCBI View Article : Google Scholar

38 

Dougherty GW, Mizuno K, Nöthe-Menchen T, Ikawa Y, Boldt K, Ta-Shma A, Aprea I, Minegishi K, Pang YP, Pennekamp P, et al: CFAP45 deficiency causes situs abnormalities and asthenospermia by disrupting an axonemal adenine nucleotide homeostasis module. Nat Commun. 11(5520)2020.PubMed/NCBI View Article : Google Scholar

39 

Jodar M, Kalko S, Castillo J, Ballescà JL and Oliva R: Differential RNAs in the sperm cells of asthenozoospermic patients. Hum Reprod. 27:1431–1438. 2012.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
He L, Wu X, Wu R, Guo P, He W, Sun W and Chen H: Seminal plasma piRNA array analysis and identification of possible biomarker piRNAs for the diagnosis of asthenozoospermia. Exp Ther Med 23: 347, 2022.
APA
He, L., Wu, X., Wu, R., Guo, P., He, W., Sun, W., & Chen, H. (2022). Seminal plasma piRNA array analysis and identification of possible biomarker piRNAs for the diagnosis of asthenozoospermia. Experimental and Therapeutic Medicine, 23, 347. https://doi.org/10.3892/etm.2022.11275
MLA
He, L., Wu, X., Wu, R., Guo, P., He, W., Sun, W., Chen, H."Seminal plasma piRNA array analysis and identification of possible biomarker piRNAs for the diagnosis of asthenozoospermia". Experimental and Therapeutic Medicine 23.5 (2022): 347.
Chicago
He, L., Wu, X., Wu, R., Guo, P., He, W., Sun, W., Chen, H."Seminal plasma piRNA array analysis and identification of possible biomarker piRNAs for the diagnosis of asthenozoospermia". Experimental and Therapeutic Medicine 23, no. 5 (2022): 347. https://doi.org/10.3892/etm.2022.11275
Copy and paste a formatted citation
x
Spandidos Publications style
He L, Wu X, Wu R, Guo P, He W, Sun W and Chen H: Seminal plasma piRNA array analysis and identification of possible biomarker piRNAs for the diagnosis of asthenozoospermia. Exp Ther Med 23: 347, 2022.
APA
He, L., Wu, X., Wu, R., Guo, P., He, W., Sun, W., & Chen, H. (2022). Seminal plasma piRNA array analysis and identification of possible biomarker piRNAs for the diagnosis of asthenozoospermia. Experimental and Therapeutic Medicine, 23, 347. https://doi.org/10.3892/etm.2022.11275
MLA
He, L., Wu, X., Wu, R., Guo, P., He, W., Sun, W., Chen, H."Seminal plasma piRNA array analysis and identification of possible biomarker piRNAs for the diagnosis of asthenozoospermia". Experimental and Therapeutic Medicine 23.5 (2022): 347.
Chicago
He, L., Wu, X., Wu, R., Guo, P., He, W., Sun, W., Chen, H."Seminal plasma piRNA array analysis and identification of possible biomarker piRNAs for the diagnosis of asthenozoospermia". Experimental and Therapeutic Medicine 23, no. 5 (2022): 347. https://doi.org/10.3892/etm.2022.11275
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team