Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
July-2022 Volume 24 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2022 Volume 24 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Correction Open Access

[Corrigendum] MicroRNA‑506‑3p targets SIRT1 and suppresses AMPK pathway activation to promote hepatic steatosis

  • Authors:
    • Liang-Kai Hu
    • Jian-Qing Chen
    • Hao Zheng
    • Yuan-Ping Tao
    • Yuan Yang
    • Xuan-Fu Xu
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology, Shidong Hospital, Shanghai 200438, P.R. China, Third Department of Hepatic Surgery, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai 200438, P.R. China
    Copyright: © Hu et al. This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY 4.0].
  • Article Number: 463
    |
    Published online on: May 23, 2022
       https://doi.org/10.3892/etm.2022.11390
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Article

Exp Ther Med 22:[Related article:] 1430, 2021; DOI: 10.3892/etm.2021.10865

Following the publication of this article, the authors regret that the paper contained some errors that should have been corrected before the article went to press. First, in the Materials and methods section, “miRNA transfection” subsection, on p. 2, right-hand column, line 6, the text “miR-505-3p mimics (5’-GGGAGCCAGGAACGAUUGAUGU-3’), inhib-itor (5’-ACUACUGAGCCGCAGUAGA-3’)” should have been written as “miR-506-3p mimics (5’-UAAGGCACCC-UUCUGAGUAGA-3’), inhibitor (5’-UCUACUCAGA-AGGGUGCCUUA-3’)”. Secondly, the authors have subsequently realized that certain of the primer sequences featured in Table I were written erroneously; specifically, the sequences for SREBP1, FASN, SCD1 and ACC1. A corrected version of Table I is shown opposite, where the proper sequences for SREBP1, FASN, SCD1 and ACC1 are shown, highlighted in bold.

Table I

Sequences of primers used for reverse transcription-quantitative PCR.

Table I

Sequences of primers used for reverse transcription-quantitative PCR.

PrimerSequence (5'-3')
SIRT1F: TGCGGGAATCCAAAGGATAA
 R: CAGGCAAGATGCTGTTGCA
miR-506-3pF: TAAGGCACCCTTCTGAGTAGA
 R: GCGAGCACAGAATTAATACGAC
SREBP1F: CCAGGGCAGGACACGAAC
 R: TGAAGGGTGGCTCGTCCAT
FASNF: ATGAGCACCAACGACACGAT
 R: GGTTCAGGAAGAGGTCCAGC
SCD1F: GAAGACGACATTCGCCCTGA
 R: CCATACAGGGCTCCCAAGTG
ACC1F: AACGGAGGCTGGGAAAATGG
 R: TGGAGTGTCCTTTCTGGTCAAC
U6F: CTCGCTTCGGCAGCACA
 R: AACGCTTCACGAATTTGCGT
GAPDHF: TGTGGGCATCAATGGATTTGG
 R: ACACCATGTATTCCGGGTCAAT

[i] SIRT1, sirtuin 1; miR, microRNA; SREBP1, sterol regulatory element-binding protein 1; FASN, fatty acid synthase; SCD1, stearoyl-CoA desaturase-1; ACC1, acetyl-CoA carboxylase 1; F, forward; R, reverse.

The authors are grateful to the Editor of Experimental and Therapeutic Medicine for allowing them the opportunity to publish this corrigendum, and allt he authors agree with its publication. The authors also regret any inconvenience that this mistake has caused.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Hu L, Chen J, Zheng H, Tao Y, Yang Y and Xu X: [Corrigendum] MicroRNA‑506‑3p targets SIRT1 and suppresses AMPK pathway activation to promote hepatic steatosis. Exp Ther Med 24: 463, 2022.
APA
Hu, L., Chen, J., Zheng, H., Tao, Y., Yang, Y., & Xu, X. (2022). [Corrigendum] MicroRNA‑506‑3p targets SIRT1 and suppresses AMPK pathway activation to promote hepatic steatosis. Experimental and Therapeutic Medicine, 24, 463. https://doi.org/10.3892/etm.2022.11390
MLA
Hu, L., Chen, J., Zheng, H., Tao, Y., Yang, Y., Xu, X."[Corrigendum] MicroRNA‑506‑3p targets SIRT1 and suppresses AMPK pathway activation to promote hepatic steatosis". Experimental and Therapeutic Medicine 24.1 (2022): 463.
Chicago
Hu, L., Chen, J., Zheng, H., Tao, Y., Yang, Y., Xu, X."[Corrigendum] MicroRNA‑506‑3p targets SIRT1 and suppresses AMPK pathway activation to promote hepatic steatosis". Experimental and Therapeutic Medicine 24, no. 1 (2022): 463. https://doi.org/10.3892/etm.2022.11390
Copy and paste a formatted citation
x
Spandidos Publications style
Hu L, Chen J, Zheng H, Tao Y, Yang Y and Xu X: [Corrigendum] MicroRNA‑506‑3p targets SIRT1 and suppresses AMPK pathway activation to promote hepatic steatosis. Exp Ther Med 24: 463, 2022.
APA
Hu, L., Chen, J., Zheng, H., Tao, Y., Yang, Y., & Xu, X. (2022). [Corrigendum] MicroRNA‑506‑3p targets SIRT1 and suppresses AMPK pathway activation to promote hepatic steatosis. Experimental and Therapeutic Medicine, 24, 463. https://doi.org/10.3892/etm.2022.11390
MLA
Hu, L., Chen, J., Zheng, H., Tao, Y., Yang, Y., Xu, X."[Corrigendum] MicroRNA‑506‑3p targets SIRT1 and suppresses AMPK pathway activation to promote hepatic steatosis". Experimental and Therapeutic Medicine 24.1 (2022): 463.
Chicago
Hu, L., Chen, J., Zheng, H., Tao, Y., Yang, Y., Xu, X."[Corrigendum] MicroRNA‑506‑3p targets SIRT1 and suppresses AMPK pathway activation to promote hepatic steatosis". Experimental and Therapeutic Medicine 24, no. 1 (2022): 463. https://doi.org/10.3892/etm.2022.11390
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team