Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
July-2022 Volume 24 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2022 Volume 24 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

miRNA‑124 regulates palmitic acid‑induced epithelial‑mesenchymal transition and cell migration in human retinal pigment epithelial cells by targeting LIN7C

  • Authors:
    • Xiao-Dong Han
    • Xu-Guang Jiang
    • Min Yang
    • Wen-Jun Chen
    • Li-Gang Li
  • View Affiliations / Copyright

    Affiliations: Department of Ocular Fundus Diseases, Xi'an Aier Ancient City Eye Hospital, Xi'an, Shaanxi 710082, P.R. China, Department of Cataracts, Xi'an Aier Ancient City Eye Hospital, Xi'an, Shaanxi 710082, P.R. China
    Copyright: © Han et al. This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY_NC 4.0].
  • Article Number: 481
    |
    Published online on: June 1, 2022
       https://doi.org/10.3892/etm.2022.11408
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The present study revealed that palmitic acid (PA) treatment induced epithelial‑mesenchymal transition (EMT) of retinal pigment epithelial (RPE) cells, which are involved in the progression of proliferative vitreoretinopathy (PVR). ARPE‑19 cells were treated with PA followed by miRNA screening and EMT marker detection using qRT‑PCR. Then, miR‑124 mimic or inhibitor was transfected into ARPE‑19 cells to explore the role of miR‑124 on the EMT of ARPE‑19 cells using transwell assay. The underlying mechanism of miRNA were predicted by bioinformatics method and confirmed by luciferase activity reporter assay. Furthermore, gain‑of‑function strategy was also used to explore the role of LIN7C in the EMT of ARPE‑19 cells. The expression of miRNA or mRNA expression was determined by qRT‑PCR and the protein expression was determined using western blot assay. The result presented that PA reduced the expression of E‑cadherin/ZO‑1 whilst increasing the expression of fibronectin/α‑SMA. In addition, PA treatment enhanced the expression of microRNA (miR)‑124 in ARPE‑19 cells. Overexpression of miR‑124 enhanced PA‑induced upregulation of E‑cadherin and ZO‑1 expression and downregulation of fibronectin and α‑SMA. Moreover, miR‑124 mimic also enhanced the migration of ARPE‑19 cells induced by PA treatment. Inversely, miR‑124 inhibitor presented opposite effect on PA‑induced EMT and cell migration in ARPE‑19 cells. Luciferase activity reporter assay confirmed that Lin‑7 homolog C (LIN7C) was a direct target of miR‑124 in ARPE‑19 cells. Overexpression of LIN7C was found to suppress the migration ability and expression of fibronectin and α‑SMA, while increasing expression of E‑cadherin and ZO‑1; miR‑124 mimic abrogated the inhibitive effect of LIN7C on the EMT of ARPE‑19 cells and PA further enhanced this abolishment. Collectively, these findings suggest that miR‑124/LIN7C can modulate EMT and cell migration in RPE cells, which may have therapeutic implications in the management of PVR diseases.

Introduction

Proliferative vitreoretinopathy (PVR) is a rare ocular inflammatory disease that can result in vision loss or even blindness (1,2). Treatment strategies for PVR has drastically improved over the past decade owing to advances in surgical techniques, such as gauge vitrectomy, scleral buckling, as well as three-dimensional mediated ophthalmic surgery (3). However, PVR remains the most common cause of recurring retinal detachment, occurring in 5-10% of all cases (4). Therefore, it is of great significance to understand the mechanism underlying PVR development to devise novel therapeutic strategies.

PVR development is dependent on the proliferation and migration of retinal pigment epithelial (RPE) cells, which forms the main component of PVR membranes (5). Mounting evidence has demonstrated that RPE cells can serve fibrotic roles in promoting PVR development (6-8). Mesenchymal-like RPE cells that underwent epithelial-to mesenchymal transition (EMT) have enhanced capability of proliferation, migration and invasion (9,10). This population of RPE cells is associated with the progression of PVR (9,10). Therefore, investigating the regulation of EMT in RPE cells may provide a potential therapeutic target for PVR treatment.

Palmitic acid (PA) is a long-chain saturated fatty acid found in palm oil that has multiple reported biological and nutritional effects (11,12). Wang et al (13) previously reported that saturated PA can induce myocardial inflammation by binding to the toll-like receptor 4 accessory protein myeloid differentiation factor 2. In colorectal cancer, PA can increase tumor cell proliferation in a β2-adrenergic receptor-dependent manner (14). In addition, PA can inhibit macrophage-mediated EMT in colorectal cancer (15). A previous study also demonstrated that PA can protect RPE cells against 4-hydroxynonenal-mediated stress and light-mediated retinal degeneration in mice (16). However, the function of PA in RPE cells and the development of PVR remain poorly understood at present.

MicroRNAs (miRNAs/miRs) belong to a group of small non-coding RNAs that are involved in various biological processes, including PVR (17,18). Accumulating evidence has demonstrated that miRNAs can induce or inhibit the EMT process in RPE cells (19,21). In addition, miRNAs, such as miR-182 and miR-34a, have been reported to modulate RPE cell proliferation and migration (20,22). Consequently, augmenting understanding into the miRNA-mediated regulation and function in RPE cells can potentially facilitate the development of miRNA manipulators to reverse the progression of PVR.

According to the aforementioned literature, miRNAs and their associated mechanisms might play critical role in the regulation of RPE cell activity during PVR. The present study aimed to explore the underlying mechanism of PA mediated miR-124 dysregulation on the EMT in ARPE-19 cells. In addition, the underlying target of miR-124 was investigated to further reveal the biofunction of miR-124 in the EMT of ARPE-19 cells. According to these investigations, we hope to provide more information in the understanding and therapeutic insights in PVR diseases.

Materials and methods

Cell culture and treatment

The human RPE cell line ARPE-19 was purchased from American Type Culture Collection. The cells were cultured in DMEM supplemented with 10% FBS (both Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin and 100 µg/ml streptomycin (Thermo Fisher Scientific, Inc.) in a 5% CO2 incubator at 37˚C. PA was purchased from MilliporeSigma and dissolved in 100% ethanol. The ARPE-19 cells were treated with PA at the indicated concentrations (0, 50, 100 200, and 400 µM) at 37˚C for 48 h and cells treated with equal volume of 100% ethanol was used as the control group.

Transfection

miR-124 mimic (50 nM; 5'-CGUGUUCACAGCGGACCUUGAU-3'), negative control mimic (NC mimic; 50 nM; 5'-AUUGGAACGAUACAGAGAAGAUU-3'), miR-124 inhibitor (50 nM; 5'-AUCAAGGUCCGCUGUGAACACG-3') and the NC inhibitor (50 nM; 5'-UUGUACUACACAAAAGUACUG-3') were purchased from Invitrogen (Thermo Fisher Scientific, Inc.). For knocking down LIN7C in ARPE-19 cells, short interfering (si)RNAs targeting LIN7C (100 nM; si-LIN7C #1, 5'-GGCTACTGTTGCTGCATTTGC-3'; si-LIN7C #2, 5'-GACCTAATACATTTCAAAACTTG-3'; and si-LIN7C #3, 5'-GGGAATTTGAGAAATATTTCATT-3' cloned into pLKO vector) and non-targeting sequence, si-NC, (100 nM; 5'-TAAGGCTATGAAGAGATAC-3') were obtained from Guangzhou RiboBio Co., Ltd. Overexpression plasmid pcDNA3.1-LINC7C (100 nM) and pcDNA3.1 (control plasmid; 100 nM) were purchased from Shanghai GenePharma Co., Ltd. Transfection was performed in ARPE-19 cells with 70% confluency using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's guidelines at 37˚C for 48 h. Following incubation at 37˚C for 48 h, cells were harvested for the following experiments.

Reverse transcription-quantitative (RT-qPCR)

RNA was extracted from the transfected/PA treated ARPE-19 cells using AccuRef Cell/Tissue Total RNA isolation kit (cat. no. AM0041; AccuRef Diagnostics; Applied StemCell, Inc.) and reverse-transcribed into complementary DNA using PrimeScript™ RT reagent kit (Takara) at 37˚C for 15 min, 85˚C for 5 sec and 4˚C for 15 min. qPCR was performed using SYBR® Green PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the following conditions: 95˚C for 10 min, 40 cycles of 95˚C for 10 sec and 57˚C for 20 sec, and 72˚C for 15 sec. The relative expression levels of miRNAs and genes were calculated using the 2-ΔΔCq method (23) and GAPDH/U6 were used as the internal controls. The primers designed by the Primer Premier 5 software (PREMIER) and used in the study are listed in Table I.

Table I

Primers used in the present study.

Table I

Primers used in the present study.

ProteinForward (5'-3')Reverse (5'-3')
E-cadherin GCTCGCTGAACTCCTCTGA TCGCCGCCACCATACATA
ZO-1 CGGTCCTCTGAGCCTGTAAG GGATCTACATGCGACGACAA
α-SMA CCACTGCTGCTTCCTCTTC CGCCGACTCCATTCCAAT
Fibronectin GTGTCCTCCTTCCATCTTC CAGACTGTCGGTACTCACG
LIN7C AACGCTACTGCAAAGGCTACT TGAATCCAAGGCCCTCTTCTG
MRPS33 TTCTCTGCTCATCACACGGC GGCAAGGAGTTAGAGTTCCGTAT
PAGR1 GCGAAGAGGAGAGATCCGATG GTGGGCATGTGTGGTTTTTCC
TSPAN8 AGTGCCCCAGGAGCTATGA AGATTTCTGTATCCACGGACATTTA
NABP1 CGCGCCTGTCCCAATATGA TTGGTCACGCGTCCTATCTC
SPIN1 CTCCCTGATAGAGTTGCGACA AGACCATTCCCCTCCACTCA
AZI2 CTTCGAAGAAACCGGAAGCC GCATCCATGACAACCAGAAGC
NOA1 TTTCCTCTGCAGGTTGGGTT GGTGTATAGCCTCGGAGATGC
TXNRD1 CGCCGTAGGTCAGCTAAAGAT GAAGCAGGGCTCTGGAGTCT
GAPDH ACGGCAAGTTCAACGGCACAG GAAGACGCCAGTAGACTCCACGAC
miR-124 CGUGUUCACAGCGGACCUUGAUUniversal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.)
miR-23b ATCACATTGCCAGGGATTACCACUniversal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.)
miR-221 AGCTACATTGTCTGCTGGGTTTCUniversal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.)
miR-124 TAAGGCACGCGGTGAATGCCAAUniversal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.)
U6 CGCTTCGGCAGCACATATACT GAATTTGCGTGTCATCCTTGC

[i] ZO-1, zonula occludens protein 1; α-SMA, α-smooth muscle actin; LIN7C, lin-7 homolog C; MRPS33, mitochondrial ribosomal protein 33; PAGR1, PAXIP1 associated glutamine rich protein 1; TSPAN8, tetraspanin 8; NABP1, nucleic acid binding protein 1; SPIN1, spindling 1; AZI2, 5-azacytidine induced 2; NOA1, nitric oxide associated 1; TXNRD1, thioredoxin reductase 1; miR, microRNA.

Western blotting

The cultured ARPE-19 cells were lysed using 1X CST lysis buffer (Cell Signaling Technology, Inc.) supplemented with the proteinase inhibitor cocktail (Pierce; Thermo Fisher Scientific, Inc.). Total proteins were extracted and the protein concentration was determined using a BCA protein quantification kit (Pierce; Thermo Fisher Scientific, Inc.). Equal amounts of proteins (25 µg per lane or 10 µg per lane for LIN7C overexpression assay) were separated using 12% SDS-PAGE and transferred onto polyvinylidene difluoride membranes (MilliporeSigma). The membranes were blocked with 5% non-fat milk at room temperature for 1 h and then incubated with primary antibodies overnight at 4˚C. The following primary antibodies from Abcam were used: Zonula occludens protein 1 (ZO-1; 1:1,000; cat. no. ab216880), E-cadherin (1:10,000; cat. no. ab40772), α-smooth muscle actin (SMA; 1:500; cat. no. ab124964), and fibronectin (1:1,000; cat. no. ab2413). In addition, LIN7C (1:1,000; cat. no. SAB2101347) was purchased from Sigma-Aldrich (Merck KGaA). To control sample loading, the membranes were stripped with the western blotting stripping buffer (AccuRef Diagnostics; Applied StemCell, Inc.) and re-probed with the anti-mouse GAPDH antibody from Abcam (1:10,000; cat. no. ab181602) at room temperature for 1.5 h. The membranes were washed and incubated with a HRP-conjugated goat anti-mouse (1:5,000; cat. no. ab47827; Abcam) or anti-rabbit (1:5,000; cat. no. ab7090; Abcam) secondary antibody at room temperature for 1 h and then visualized using an enhanced chemiluminescence kit (Pierce; Thermo Fisher Scientific, Inc.). With GAPDH as the internal control, the relative expression of protein bands was quantified using Image J Software (Version 1.5; National Institutes of Health).

Transwell assay

Cell migration was analyzed with a Transwell assay using a Transwell chamber (8-µm pores; Corning, Inc.). Transfected/PA-treated ARPE-19 cells were resuspended in a serum-free DMEM and added into the upper chamber at a density of 2x104 per well. DMEM supplemented with 10% FBS was then added into the lower chamber. After incubation for 24 h at 37˚C, cells that migrated through the membrane were fixed by 4% paraformaldehyde at room temperature for 15 min and stained with 0.1% crystal violet at room temperature for 15 min (Sigma-Aldrich; Merck KGaA). The migrating cells were then imaged in a light microscope at 200x and counted manually.

Prediction of miRNA targets

The targets of miR-124 were predicted by TargetScan (https://www.targetscan.org/vert_72/), miRDB (http://mirdb.org/index.html), and microT (https://mrmicrot.imsi.athenarc.gr/?r=mrmicrot/index) online Tools. Then, the shared targeted genes were screened using the Venn analysis (https://bioinfogp.cnb.csic.es/tools/venny/) and presented in a Venn diagram.

Luciferase reporter assay

The ARPE-19 cells were seeded into 24-well plates at a density of 5.0x105 per well. Subsequently, 24 h later, luciferase reporter vector psiCHECK2 (Promega Corporation) containing the wild-type or mutant (0.25 µg each) 3'-untranslated regions (UTR) of LIN7C, purchased from Guangzhou RiboBio Co., Ltd, was transiently co-transfected with miR-124 mimics (100 nM) or NC (100 nM) into ARPE-19 cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol at 37˚C for 24 h. At 24 h post-transfection, the relative luciferase activity was analyzed using a Dual-Luciferase Reporter Assay System with Renilla luciferase activity as the internal control (Promega Corporation).

Prediction of miR-124 using bioinformatics

The underlying targets of miR-124 were predicted using TargetScan (targetscan.org/vert_72/), miRDB (http://mirdb.org/index.html), and microT (https://dianalab.e-ce.uth.gr/html/dianauniverse/index.php?r=microT_CDS) online databases with their default parameters. Then, the shared targets among these three databases were screened using Venn analysis.

Statistical analysis

All experiments were performed in triplicate and the results are presented as the mean ± standard deviation. Statistical analysis was performed using GraphPad prism (version 8.0; GraphPad Software, Inc.). Unpaired student's t-test or one-way analysis of variance followed by Tukey's post hoc test was performed to analyze the differences among ≥ two groups. P<0.05 was considered to indicate a statistically significant difference.

Results

PA treatment induces EMT and enhances miR-124 expression in ARPE-19 cells

To investigate the function of PA in EMT and the underlying mechanism, ARPE-19 cells were treated with PA at different concentrations (0, 50, 100, 200 and 400 µM) for 48 h. The results revealed that PA treatment decreased the protein expression levels of E-cadherin and ZO-1 whilst increasing the protein expression levels of fibronectin and α-SMA in a dose-dependent manner (Fig. 1A). Similarly, treatment with 200 µM PA significantly suppressed the mRNA expression levels of E-cadherin and ZO-1 but increased those of fibronectin and α-SMA in ARPE-19 cells compared with the control (Fig. 1B). RT-qPCR found that although miR-424, miR-221 and miR-23b expression was significantly enhanced upon PA treatment, the increase in miR-124 expression was the highest expression compared with that in the control group (Fig. 1C). Taken together, these data suggested that miR-124 may be involve in PA-induced EMT of ARPE-19 cells; therefore, the present study focused on the role of miR-124 in EMT and its regulation by PA treatment.

Figure 1

PA treatment induces EMT and increases miR-124 expression in ARPE-19 cells. ARPE-19 cells were treated with PA at different concentrations (0, 50, 100, 200 and 400 µM) for 48 h. (A) Protein and (B) mRNA expression levels of the key molecules in EMT (E-cadherin, ZO-1, fibronectin and α-SMA) were measured using western blotting and RT-qPCR. (C) ARPE-19 cells were treated with 200 µM PA for 48 h, before the expression of miR-424, miR-221, miR-23b and miR-124 were analyzed using RT-qPCR. *P<0.05 vs. 0 µM/control group. PA, palmitic acid; EMT, epithelial mesenchymal transition; miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; ZO-1, zonula occludens protein 1; α-SMA, α-smooth muscle actin.

Overexpression of miR-124 enhances PA-induced EMT and cell migration in ARPE-19 cells

Next, the possible function of miR-124 in EMT was explored, where ARPE-19 cells were transfected with either the NC or miR-124 mimics. Overexpression of miR-124, which was confirmed by RT-qPCR compared with that in corresponding control cells transfected with the NC mimic (Fig. 2A), mediated a similar effect to PA treatment. Specifically, miR-124 mimic transfection markedly decreased the expression of E-cadherin and ZO-1 but enhanced the expression of fibronectin and α-SMA on both mRNA and protein levels compared with those in the control group (Fig. 2B and C). Subsequently, overexpression of miR-124 together with PA treatment resulted in the lowest expression levels of E-cadherin and ZO-1 but the highest expression levels of fibronectin and α-SMA in ARPE-19 cells (Fig. 2B and C). All of these observations were significant compared with those in the PA-only group (Fig. 2B and C). In addition, it was observed that miR-124 mimics transfection or PA treatment markedly enhanced ARPE-19 cell migration compared with that in the control (Fig. 2D and E). By contrast, the overexpression of miR-124 significantly enhanced the cell migration of ARPE-19 cells treated with PA compared with that in cells treated with PA only (Fig. 2D and E). These findings suggest that miR-124 accelerated migration ability of ARPE-19 cells to promote PA-induced EMT.

Figure 2

miR-124 overexpression enhances PA-induced EMT and cell migration in ARPE-19 cells. (A) ARPE-19 cells were transfected with either the miR-124 mimics or NC, before the expression levels of miR-124 were determined at 48 h after transfection by RT-qPCR. (B) mRNA and (C) protein expression levels of the key molecules in EMT (E-cadherin, ZO-1, fibronectin and α-SMA) were measured using RT-qPCR and western blotting, respectively. (D and E) ARPE-19 cells were transfected with miR-124 mimics or NC and/or cultured in the presence or absence of 200 µM PA. Cells migration was analyzed using Transwell assay. (D) Number of migrated cells in the different groups was calculated and (E) representative images of Transwell cell migration assays are presented; scale bar=200 µm. *P<0.05. PA, palmitic acid; EMT, epithelial mesenchymal transition; miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; ZO-1, zonula occludens protein 1; α-SMA, α-smooth muscle actin; NC, negative control.

Knocking down miR-124 expression suppresses PA-induced EMT and cell migration in ARPE-19 cells

Furthermore, a loss-of-function assay was performed using a miR-124 inhibitor to investigate the function of miR-124. Transfection with the miR-124 inhibitor significantly suppressed the expression of miR-124 compared with that in cells transfected with the NC inhibitor (Fig. 3A). PA treatment decreased the expression of E-cadherin and ZO-1 whilst enhancing the expression of fibronectin and α-SMA compared with those in the control group, transfection with the miR-124 inhibitor resulted in the opposite effects (Fig. 3B and C). In the PA + miR-124 inhibitor group, miR-124 inhibitor transfection was also found to antagonize the effect of PA treatment, resulting in the E-cadherin, ZO-1, fibronectin and α-SMA expression levels in ARPE-19 cells returning to those comparable with the control group (Fig. 3B and C). In addition, transfection with the miR-124 inhibitor was revealed to markedly inhibit ARPE-19 cell migration compared with the control, whereas miR-124 inhibition significantly reversed the PA-enhanced ARPE-19 cell migration (Fig. 3D and E). These findings indicate that PA enhances the EMT of ARPE-19 cells via miR-124 and inhibition of miR-124 abrogated EMT of ARPE-19 cells induced by PA.

Figure 3

miR-124 knockdown suppresses PA-induced EMT and cell migration in ARPE-19 cells. (A) ARPE-19 cells were transfected with either the miR-124 inhibitor or NC, before the expression levels of miR-124 were determined at 48 h post-transfection using RT-qPCR. (B) mRNA and (C) protein levels of the key molecules in EMT (E-cadherin, ZO-1, fibronectin and α-SMA) were determined using RT-qPCR and western blotting, respectively. (D and E) ARPE-19 cells were transfected with miR-124 inhibitor or NC and/or cultured in the presence or absence of 200 µM PA before cell migration was analyzed using a Transwell assay. (D) Number of migrated cells in different groups were calculated and (E) representative images of Transwell cell migration assays are presented; scale bar=200 µm. *P<0.05. PA, palmitic acid; EMT, epithelial mesenchymal transition; miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; ZO-1, zonula occludens protein 1; α-SMA, α-smooth muscle actin; NC, negative control.

LIN7C is a direct target of miR-124 in ARPE-19 cells

To explore the mechanism by which miR-124 regulates EMT in ARPE-19 cells, bioinformatics analyses were performed to predict the potential targets of miR-124 using TargetScan, miRDB, and micro-T (Fig. 4A). A total of nine potential targets were predicted by all three tools (Fig. 4A). ARPE-19 cells were then transfected with miR-124 mimics or NC, before the relative expression of these potential target genes were analyzed 48 h later. As presented in Fig. 4B, transfection of miR-124 mimics significantly suppressed the expression of LIN7C compared with that in the NC group. There were also complementary binding sequences between miR-124 and the 3'-UTR of LIN7C (Fig. 4C). Luciferase reporter assay subsequently confirmed that miR-124 mimic could significantly decrease the luciferase activity of LIN7C-Wt but had no effect on the activity of LIN7C-Mut, suggesting a direct interaction between miR-124 and LIN7C (Fig. 4C). PA treatment was also confirmed to suppress LIN7C expression in a dose-dependent manner, with this reduction reaching significance at 200 and 400 µM compared with that in the 0 µM group (Fig. 4D). Furthermore, inhibition of miR-124 expression markedly enhanced the expression of LIN7C in ARPE-19 cells compared with the NC inhibitor group, whilst miR-124 inhibitor transfection reversed the suppressive effects of PA treatment on LIN7C expression (Fig. 4E and F). All of these findings indicate that LIN7C is a target of miR-124 in ARPE-19 cells.

Figure 4

LIN7C is a direct target of miR-124 in ARPE-19 cells. (A) Venn diagram presents the numbers of candidate mRNA targets of miR-124 predicted using three public algorithms TargetScan, miRDB and micro-T. (B) ARPE-19 cells were transfected with NC or miR-124 mimics. The mRNA expression levels of the indicated candidate targets of miR-124 were analyzed using RT-qPCR 48 h later. (C) Diagrams show the putative binding sites between miR-124 and corresponding WT or MUT sites of LIN7C 3'UTR. ARPE-19 cells were co-transfected with reporter vector containing WT or MUT LIN7C 3'-UTR, together with NC or miR-124 mimics. Dual luciferase activity was detected in ARPE-19 cells at 48 h post transfection. (D) Protein expression levels of LIN7C in ARPE-19 cells treated with PA at the indicated concentrations were determined by western blotting. (E and F) ARPE-19 cells were transfected with NC or miR-124 inhibitor with or without 200 µM PA treatment. At 48 h later, (E) mRNA and (F) expression protein levels of LIN7C in each treatment group were measured using RT-qPCR and western blot assays, respectively. *P<0.05 vs. NC mimic; #P<0.05 vs. NC inhibitor. LIN7C, lin-7 homolog C; miR, microRNA; NC, negative control; RT-qPCR, reverse transcription-quantitative PCR; WT, wild-type; MUT, mutant; UTR, untranslated region; PA, palmitic acid.

LIN7C regulates EMT and cell migration in ARPE-19 cells

To study the effect of LIN7C on EMT, the overexpression vector for LIN7C was constructed and transfected into ARPE-19 cells to overexpress LIN7C, which was successful compared with that in cells transfected with the empty pcDNA3.1 vector (Fig. 5A). By contrast, siRNAs targeting LIN7C were transfected into ARPE-19 cells to silence the expression of LIN7C. The result suggested that si-LIN7C 2# and 3# significantly decrease LIN7C expression, and si-LIN7C 3# presented a more effective effect than si-LIN7C 2# (Fig. 5B). Therefore, si-LIN7C 2# was selected and used for the following experiments. The overexpression of LIN7C was demonstrated to suppress EMT, with markedly enhanced expression levels of E-cadherin/ZO-1 and markedly decreased expression levels of fibronectin/α-SMA compared with those in the empty vector control group (Fig. 5C and D). Knockdown of LIN7C significantly enhanced EMT, namely significantly inhibiting expression of E-cadherin and ZO-1 but enhancing expression of fibronectin and α-SMA compared with the si-NC group (Fig. 5C and D). Furthermore, overexpression of LIN7C was demonstrated to markedly inhibit cell migration compared with that in the empty vector group, whilst its knockdown significantly enhanced cell migration compared with that in the si-NC group (Fig. 5E and F). Taken together, these results indicate that silencing LIN7C significantly promoted migration of ARPE-19 cells.

Figure 5

LIN7C regulates EMT and cell migration in ARPE-19 cells. (A) ARPE-19 cells were transfected with control empty plasmids or LIN7C-overexpressing plasmids. Protein and mRNA expression levels of LIN7C in ARPE-19 cells were determined using western blotting and RT-qPCR, respectively. (B) ARPE-19 cells were transfected with si-NC or LIN7C-specific siRNA oligos. Protein and mRNA expression levels of LIN7C in ARPE-19 cells were then determined using western blotting and RT-qPCR assays, respectively. (C-F) ARPE-19 cells were transfected with control empty plasmids or LIN7C-overexpressing plasmids, si-NC or si-LIN7C #2. Expression levels of the key molecules in EMT (E-cadherin, ZO-1, fibronectin and α-SMA) were determined using (C) RT-qPCR for mRNA and (D) western blotting for proteins. At 48 h post-transfection, ARPE-19 cells were cultured in Transwell chambers and migratory cells were stained with crystal-violet. (E) The number of migrated cells in one field of view in each group is quantified and (F) representative images of the Transwell cell migration assays are presented; scale bar, 200 µm. *P<0.05 and #P<0.05. EMT, epithelial mesenchymal transition; RT-qPCR, reverse transcription-quantitative PCR; ZO-1, zonula occludens protein 1; α-SMA, α-smooth muscle actin; NC, negative control; LIN7C, lin-7 homolog C; NC, negative control; si, short-interfering.

Overexpression of LIN7C abrogates PA-induced EMT and cell migration in ARPE-19 cells

To further investigate the role of LIN7C in EMT, the APRE-19 cells were transfected either with the control vector or the overexpression vector for LIN7C, with or without PA treatment. PA treatment was found to induce EMT compared with the pcDNA3.1 group, as demonstrated by decreased expression levels of E-cadherin and ZO-1 and enhanced expression levels of fibronectin and α-SMA (Fig. 6A and B). By contrast, overexpression of LIN7C markedly reversed the PA-induced EMT in ARPE-19 cells compared with that in the PA-only group (Fig. 6A and B). Overexpression of LIN7C also significantly suppressed cell migration compared with that in the empty vector group, whereas PA treatment produced the opposite effect. However, LIN7C overexpression significantly reduced PA-induced cell migration in ARPE-19 cells compared with the PA group (Fig. 6C and D). In addition, overexpression of miR-124 markedly reversed the upregulation of E-cadherin and ZO-1 and the downregulation of fibronectin and α-SMA previously mediated by LIN7C overexpression, which were in turn enhanced by PA treatment (Fig. 6E and F). In addition, overexpression of miR-124 significantly attenuated the inhibitory effects of LIN7C overexpression on the migration of ARPE-19 cells, which were significantly potentiated by PA treatment (Fig. 6G and H). Collectively, these data suggest that LIN7C could antagonize the EMT promotion function of PA in ARPE-19 cells.

Figure 6

Overexpression of LIN7C abrogates PA-induced EMT and cell migration in ARPE-19 cells. ARPE-19 cells were transfected with control vector, pLIN7C and/or treated with or without 200 µM PA. EMT-associated markers and migration in the cells were determined 48 h later. Expression levels of key molecules in EMT (E-cadherin, ZO-1, fibronectin and α-SMA) were determined using (A) RT-qPCR for mRNA and (B) western blotting for proteins. (C and D) ARPE-19 cells were transfected with control or pLIN7C and/or cultured in the presence or absence of 200 µM PA. Cell migration was analyzed using a Transwell assay. (C) Number of migrated cells in different groups were calculated and (D) representative images from Transwell cell migration assays are presented; scale bar, 200 µm. (E-H) ARPE-19 cells were transfected with pcDNA3.1 or pcDNA3.1-LIN7 and miR-NC or miR-124 followed by 200 µM PA treatment, before EMT-associated marker expression and cell migration were measured 48 h later. Expression levels of the key molecules in EMT (E-cadherin, ZO-1, fibronectin and α-SMA) were determined using (E) RT-qPCR for mRNA and (F) western blotting for proteins. (G) Number of migrated cells in the different groups were calculated and (H) representative images of Transwell cell migration assays are presented; scale bar, 200 µm. *P<0.05, **P<0.01, ***P<0.001. PA, palmitic acid; EMT, epithelial mesenchymal transition; miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; ZO-1, zonula occludens protein 1; α-SMA, α-smooth muscle actin; NC, negative control; LIN7C, lin-7 homolog C.

Discussion

Accumulating evidence has demonstrated that cell proliferation, migration and EMT of RPE cells are important for PVR development (24,25). Furthermore, blocking EMT in RPE cells as been previously shown to prevent PVR pathogenesis (26). The present study revealed that PA treatment induced EMT and enhanced miR-124 expression in ARPE-19 cells. miR-124 overexpression synergistically enhanced the PA-induced EMT and cell migration in ARPE-19 cells. Furthermore, LIN7C was established as a direct target of miR-124, whereby the overexpression of LIN7C abrogated the PA-induced EMT in ARPE-19 cells. Therefore, the PA/miR-124/LIN7C functional cascade was suggested to mediate EMT and cell migration in RPE cells.

PA has been reported to regulate miRNA expression, such as miR-221 and miR-130a (27,28). Therefore, the present study performed a PA-associated miRNA microarray to analyze the differentially expressed miRNAs in ARPE-19 cells with or without PA treatment. The present study demonstrated that the expression of multiple miRNAs have been demonstrated to be regulated by PA treatment, where miR-124 was among the most upregulated miRNAs in ARPE-19 cells. Chu-Tan et al (29) previously revealed that the dysregulated expression of miR-124 is associated with retinal inflammation and photoreceptor death, such that miR-124 overexpression can alleviate retinal degeneration via regulating CCL2. The regulatory effects of miR-124 on EMT has been investigated by previous studies on triple-negative breast cancer, nasopharyngeal carcinoma, non-small cell lung cancer and clear cell renal carcinoma (30-33). Consistently, the present study revealed that the miR-124 mimics enhanced EMT in ARPE-19 cells whilst the miR-124 inhibitor suppressed PA-induced EMT. In addition, miR-124 enhanced PA-induced ARPE-19 cell migration, which may further aggravate PVR progression.

miR-124 has been studied as a potential tumor suppressor in various tumors (30,31,34). In triple-negative breast cancer and clear cell renal carcinoma, miR-124 was found to negatively regulate the expression of zinc finger E-box-binding homeobox 2 (30,31,32). Calpain small subunit 4 has been identified to be a target of miR-124, whilst long non-coding RNA metastasis-associated lung adenocarcinoma transcript 1 was documented to sponge miR-124 expression in nasopharyngeal carcinoma cells (31). The present study revealed that miR-124 regulated LIN7C expression by directly binding to the 3'-UTR of LIN7C. LIN7C has been reported to be as a dynamic marker for polarity maturation in the zebra fish retinal epithelium (35). However, to the best of our knowledge, the function of LIN7C in PVR development has not been studied previously. The present study hypothesized that LIN7C regulated EMT and cell migration in ARPE-19 cells. Overexpression of LIN7C antagonized the effect of PA treatment on EMT induction. Therefore, the miR-124/LIN7C axis, in conjunction with PA treatment, may serve a key role in the EMT and pathogenesis of PVR. Nevertheless, how LIN7C modulated the EMT process and the underlying mechanism of miR-124/LIN7C in PVR warrant further investigation.

In summary, the present study demonstrated that PA treatment induced EMT and promoted the migration of RPE cells by upregulating miR-124 expression whilst inhibiting LIN7C expression. These findings suggest that targeting miR-124/LIN7C may prove to be useful in preventing and treating PVR.

Acknowledgements

Not applicable.

Funding

Funding: No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study available from the corresponding author on reasonable request.

Authors' contributions

XDH and LGL conceived and designed the experiments. XGJ and MY performed the experiments. WJC analyzed and interpreted the data. XDH and LGL confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Pastor JC: Proliferative vitreoretinopathy: An overview. Surv Ophthalmol. 43:3–18. 1998.PubMed/NCBI View Article : Google Scholar

2 

Di Lauro S, Kadhim MR, Charteris DG and Pastor JC: Classifications for proliferative vitreoretinopathy (PVR): An analysis of their use in publications over the last 15 years. J Ophthalmol. 2016(7807596)2016.PubMed/NCBI View Article : Google Scholar

3 

Coffee RE, Jiang L and Rahman SA: Proliferative vitreoretinopathy: Advances in surgical management. Int Ophthalmol Clin. 54:91–109. 2014.PubMed/NCBI View Article : Google Scholar

4 

Idrees S, Sridhar J and Kuriya AE: Proliferative vitreoretinopathy: A review. Int Ophthalmol Clin. 59:221–240. 2019.PubMed/NCBI View Article : Google Scholar

5 

Charteris DG: Proliferative vitreoretinopathy: Pathobiology, surgical management, and adjunctive treatment. Br J Ophthalmol. 79:953–960. 1995.PubMed/NCBI View Article : Google Scholar

6 

Lee SC, Kwon OW, Seong GJ, Kim SH, Ahn JE and Kay ED: Epitheliomesenchymal transdifferentiation of cultured RPE cells. Ophthalmic Res. 33:80–86. 2001.PubMed/NCBI View Article : Google Scholar

7 

Mudhar HS: A brief review of the histopathology of proliferative vitreoretinopathy (PVR). Eye (Lond). 34:246–250. 2020.PubMed/NCBI View Article : Google Scholar

8 

Zou H, Shan C, Ma L, Liu J, Yang N and Zhao J: Polarity and epithelial-mesenchymal transition of retinal pigment epithelial cells in proliferative vitreoretinopathy. Peer J. 8(e10136)2020.PubMed/NCBI View Article : Google Scholar

9 

He H, Kuriyan AE, Su CW, Mahabole M, Zhang Y, Zhu YT, Flynn HW, Parel JM and Tseng SC: Inhibition of proliferation and epithelial mesenchymal transition in retinal pigment epithelial cells by heavy chain-hyaluronan/pentraxin 3. Sci Rep. 7(43736)2017.PubMed/NCBI View Article : Google Scholar

10 

Tamiya S, Liu L and Kaplan HJ: Epithelial-mesenchymal transition and proliferation of retinal pigment epithelial cells initiated upon loss of cell-cell contact. Invest Ophthalmol Vis Sci. 51:2755–2763. 2010.PubMed/NCBI View Article : Google Scholar

11 

Carta G, Murru E, Banni S and Manca C: Palmitic acid: Physiological role, metabolism and nutritional implications. Front Physiol. 8(902)2017.PubMed/NCBI View Article : Google Scholar

12 

Mancini A, Imperlini E, Nigro E, Montagnese C, Daniele A, Orrù S and Buono P: Biological and nutritional properties of palm oil and palmitic acid: Effects on health. Molecules. 20:17339–17361. 2015.PubMed/NCBI View Article : Google Scholar

13 

Wang Y, Qian Y, Fang Q, Zhong P, Li W, Wang L, Fu W, Zhang Y, Xu Z, Li X and Liang G: Saturated palmitic acid induces myocardial inflammatory injuries through direct binding to TLR4 accessory protein MD2. Nat Commun. 8(13997)2017.PubMed/NCBI View Article : Google Scholar

14 

Fatima S, Hu X, Huang C, Zhang W, Cai J, Huang M, Gong RH, Chen M, Ho AHM, Su T, et al: High-fat diet feeding and palmitic acid increase CRC growth in β2AR-dependent manner. Cell Death Dis. 10(711)2019.PubMed/NCBI View Article : Google Scholar

15 

de Araujo Junior RF, Eich C, Jorquera C, Schomann T, Baldazzi F, Chan AB and Cruz LJ: Ceramide and palmitic acid inhibit macrophage-mediated epithelial-mesenchymal transition in colorectal cancer. Mol Cell Biochem. 468:153–168. 2020.PubMed/NCBI View Article : Google Scholar

16 

Gutierrez MA, Davis SS, Rosko A, Nguyen SM, Mitchell KP, Mateen S, Neves J, Garcia TY, Mooney S, Perdew GH, et al: A novel AhR ligand, 2AI, protects the retina from environmental stress. Sci Rep. 6(29025)2016.PubMed/NCBI View Article : Google Scholar

17 

Osada H and Takahashi T: MicroRNAs in biological processes and carcinogenesis. Carcinogenesis. 28:2–12. 2007.PubMed/NCBI View Article : Google Scholar

18 

Kaneko H and Terasaki H: Biological involvement of microRNAs in proliferative vitreoretinopathy. Transl Vis Sci Technol. 6(5)2017.PubMed/NCBI View Article : Google Scholar

19 

Usui-Ouchi A, Ouchi Y, Kiyokawa M, Sakuma T, Ito R and Ebihara N: Upregulation of Mir-21 levels in the vitreous humor is associated with development of proliferative vitreoretinal disease. PLoS One. 11(e0158043)2016.PubMed/NCBI View Article : Google Scholar

20 

Wang L, Dong F, Reinach PS, He D, Zhao X, Chen X, Hu DN and Yan D: MicroRNA-182 suppresses HGF/SF-induced increases in retinal pigment epithelial cell proliferation and migration through targeting c-Met. PLoS One. 11(e0167684)2016.PubMed/NCBI View Article : Google Scholar

21 

Takayama K, Kaneko H, Hwang SJ, Ye F, Higuchi A, Tsunekawa T, Matsuura T, Iwase T, Asami T, Ito Y, et al: Increased ocular levels of microRNA-148a in cases of retinal detachment promote epithelial-mesenchymal transition. Invest Ophthalmol Vis Sci. 57:2699–2705. 2016.PubMed/NCBI View Article : Google Scholar

22 

Hou Q, Zhou L, Tang J, Ma N, Xu A, Tang J, Zheng D, Chen X, Chen F, Dong XD and Tu L: LGR4 is a direct target of microRNA-34a and modulates the proliferation and migration of retinal pigment epithelial ARPE-19 cells. PLoS One. 11(e0168320)2016.PubMed/NCBI View Article : Google Scholar

23 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

24 

Li X, Zhao M and He S: RPE epithelial-mesenchymal transition plays a critical role in the pathogenesis of proliferative vitreoretinopathy. Ann Transl Med. 8(263)2020.PubMed/NCBI View Article : Google Scholar

25 

Tamiya S and Kaplan HJ: Role of epithelial-mesenchymal transition in proliferative vitreoretinopathy. Exp Eye Res. 142:26–31. 2016.PubMed/NCBI View Article : Google Scholar

26 

Nagasaka Y, Kaneko H, Ye F, Kachi S, Asami T, Kato S, Takayama K, Hwang SJ, Kataoka K, Shimizu H, et al: Role of Caveolin-1 for blocking the epithelial-mesenchymal transition in proliferative vitreoretinopathy. Invest Ophthalmol Vis Sci. 58:221–229. 2017.PubMed/NCBI View Article : Google Scholar

27 

Huang F, Chen J, Wang J, Zhu P and Lin W: Palmitic acid induces microRNA-221 expression to decrease glucose uptake in HepG2 cells via the PI3K/AKT/GLUT4 pathway. Biomed Res Int. 2019(8171989)2019.PubMed/NCBI View Article : Google Scholar

28 

Gu X, Wang XQ, Lin MJ, Liang H, Fan SY, Wang L, Yan X, Liu W and Shen FX: Molecular interplay between microRNA-130a and PTEN in palmitic acid-mediated impaired function of endothelial progenitor cells: Effects of metformin. Int J Mol Med. 43:2187–2198. 2019.PubMed/NCBI View Article : Google Scholar

29 

Chu-Tan JA, Rutar M, Saxena K, Aggio-Bruce R, Essex RW, Valter K, Jiao H, Fernando N, Wooff Y, Madigan MC, et al: MicroRNA-124 dysregulation is associated with retinal inflammation and photoreceptor death in the degenerating retina. Invest Ophthalmol Vis Sci. 59:4094–4105. 2018.PubMed/NCBI View Article : Google Scholar

30 

Ji H, Sang M, Liu F, Ai N and Geng C: miR-124 regulates EMT based on ZEB2 target to inhibit invasion and metastasis in triple-negative breast cancer. Pathol Res Pract. 215:697–704. 2019.PubMed/NCBI View Article : Google Scholar

31 

Shi B, Wang Y and Yin F: MALAT1/miR-124/Capn4 axis regulates proliferation, invasion and EMT in nasopharyngeal carcinoma cells. Cancer Biol Ther. 18:792–800. 2017.PubMed/NCBI View Article : Google Scholar

32 

Chen J, Zhong Y and Li L: miR-124 and miR-203 synergistically inactivate EMT pathway via coregulation of ZEB2 in clear cell renal cell carcinoma (ccRCC). J Transl Med. 18(69)2020.PubMed/NCBI View Article : Google Scholar

33 

Wu J, Weng Y, He F, Liang D and Cai L: LncRNA MALAT-1 competitively regulates miR-124 to promote EMT and development of non-small-cell lung cancer. Anticancer Drugs. 29:628–636. 2018.PubMed/NCBI View Article : Google Scholar

34 

Li Y, Yan J, Wang Y, Wang C, Zhang C and Li G: LINC00240 promotes gastric cancer cell proliferation, migration and EMT via the miR-124-3p / DNMT3B axis. Cell Biochem Funct. 38:1079–1088. 2020.PubMed/NCBI View Article : Google Scholar

35 

Luz M and Knust E: Fluorescently tagged Lin7c is a dynamic marker for polarity maturation in the zebrafish retinal epithelium. Biol Open. 2:867–871. 2013.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Han X, Jiang X, Yang M, Chen W and Li L: miRNA‑124 regulates palmitic acid‑induced epithelial‑mesenchymal transition and cell migration in human retinal pigment epithelial cells by targeting LIN7C. Exp Ther Med 24: 481, 2022.
APA
Han, X., Jiang, X., Yang, M., Chen, W., & Li, L. (2022). miRNA‑124 regulates palmitic acid‑induced epithelial‑mesenchymal transition and cell migration in human retinal pigment epithelial cells by targeting LIN7C. Experimental and Therapeutic Medicine, 24, 481. https://doi.org/10.3892/etm.2022.11408
MLA
Han, X., Jiang, X., Yang, M., Chen, W., Li, L."miRNA‑124 regulates palmitic acid‑induced epithelial‑mesenchymal transition and cell migration in human retinal pigment epithelial cells by targeting LIN7C". Experimental and Therapeutic Medicine 24.1 (2022): 481.
Chicago
Han, X., Jiang, X., Yang, M., Chen, W., Li, L."miRNA‑124 regulates palmitic acid‑induced epithelial‑mesenchymal transition and cell migration in human retinal pigment epithelial cells by targeting LIN7C". Experimental and Therapeutic Medicine 24, no. 1 (2022): 481. https://doi.org/10.3892/etm.2022.11408
Copy and paste a formatted citation
x
Spandidos Publications style
Han X, Jiang X, Yang M, Chen W and Li L: miRNA‑124 regulates palmitic acid‑induced epithelial‑mesenchymal transition and cell migration in human retinal pigment epithelial cells by targeting LIN7C. Exp Ther Med 24: 481, 2022.
APA
Han, X., Jiang, X., Yang, M., Chen, W., & Li, L. (2022). miRNA‑124 regulates palmitic acid‑induced epithelial‑mesenchymal transition and cell migration in human retinal pigment epithelial cells by targeting LIN7C. Experimental and Therapeutic Medicine, 24, 481. https://doi.org/10.3892/etm.2022.11408
MLA
Han, X., Jiang, X., Yang, M., Chen, W., Li, L."miRNA‑124 regulates palmitic acid‑induced epithelial‑mesenchymal transition and cell migration in human retinal pigment epithelial cells by targeting LIN7C". Experimental and Therapeutic Medicine 24.1 (2022): 481.
Chicago
Han, X., Jiang, X., Yang, M., Chen, W., Li, L."miRNA‑124 regulates palmitic acid‑induced epithelial‑mesenchymal transition and cell migration in human retinal pigment epithelial cells by targeting LIN7C". Experimental and Therapeutic Medicine 24, no. 1 (2022): 481. https://doi.org/10.3892/etm.2022.11408
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team