Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
April-2026 Volume 31 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2026 Volume 31 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Metformin triggers apoptosis via endoplasmic reticulum stress in HER2‑positive breast cancer cell lines

  • Authors:
    • Eser Çakmak
    • Birşen Bilgici
  • View Affiliations / Copyright

    Affiliations: Department of Medical Biochemistry, Faculty of Medicine, Ondokuz Mayıs University, Atakum, Samsun 55139, Turkey
    Copyright: © Çakmak et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 111
    |
    Published online on: February 13, 2026
       https://doi.org/10.3892/etm.2026.13106
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The antidiabetic drug metformin has potential as an anticancer agent, particularly due to its observed efficacy in breast cancer. Metformin exerts its cytotoxic effects in the induction of endoplasmic reticulum (ER) stress, which can trigger apoptotic cell death pathways. Therefore, the present study aimed to investigate the dose‑dependent effects of metformin on ER stress and apoptosis in HER2‑positive breast cancer SKBR3 cells. For this purpose, SKBR3 cells were treated with 5, 10 and 20 mM metformin. Cell proliferation was assessed using real‑time cell analysis, while expression levels of ER stress‑associated genes [glucose‑regulated protein 78 kDa (GRP78), PRKR‑like ER kinase (PERK), inositol‑requiring enzyme 1 (IRE1), activating transcription factor 6 (ATF6) and CHOP)] were measured by revese transcription‑quantitative PCR. Apoptosis was analyzed by Annexin V‑FITC/PI flow cytometry in cells treated with 10 and 20 mM metformin. Findings revealed that metformin (5, 10 and 20 mM) dose‑dependently inhibited cell proliferation and activated ER stress pathways. Significant increases were observed in gene expression following treatment with 5, 10 and 20 mM metformin, respectively, including  GRP78 (3.70‑, 5.06‑ and 7.33‑fold; all P<0.0001) PERK (2.48‑, 4.36‑ and 9.11‑fold; all P<0.0001), IRE1 (2.15‑fold, P=0.001; 2.90‑fold, P<0.001; 5.55‑fold, P<0.0001), ATF6 (2.43‑2.44‑ and 3.63‑fold; all P<0.0001) and particularly in pro‑apoptotic CHOP (3.31‑, 27.47‑ and 49.85‑fold; all P<0.0001). Flow cytometry revealed that 10 and 20 mM metformin significantly increased early apoptosis to 6.05% (P<0.001) and 7.28% (P<0.001) and late apoptosis to 13.24% (P<0.001) and 20.59% (P<0.001), respectively, compared with controls (early apoptosis, 0.02%; late apoptosis, 0.05%). The present findings demonstrated that metformin activates ER stress response and induces apoptosis in HER2‑positive breast cancer cells in a dose‑dependent manner. This supports the potential of metformin as an adjuvant therapy, though further in vivo studies are needed to evaluate its clinical applicability.

Introduction

Breast cancer (BC) represents a paramount global health challenge, being the most commonly diagnosed cancer among women worldwide with an estimated 2.30 million new cases in 2022(1). In the same year, it was the leading cause of cancer-associated mortalities among women globally and ranked first in incidence in 157 countries and in mortality in 112 countries (2). Human epidermal growth factor receptor (HER)-positive status is observed in 15-20% of patients with BC (3) and is associated with aggressive disease progression and poor prognosis (4).

Recent studies have shown that endoplasmic reticulum (ER) stress and the unfolded protein response (UPR) are key in oncogenic transformation, survival and cancer progression (5,6). Cancer cells undergo chronic ER stress due to factors such as hypoxia, nutrient deprivation, oxidative stress and genetic mutations, adapting by activating UPR. However, severe ER stress triggers programmed cell death by activating the pro-apoptotic components of the UPR. The accumulation of misfolded proteins in the ER activates three key sensors: PRKR-like ER kinase (PERK), activating transcription factor 6 (ATF6) and inositol-requiring enzyme 1 (IRE1), thereby initiating the UPR. While this response initially promotes cell survival, prolonged or intense stress leads to divergent outcomes, whereby PERK phosphorylates eukaryotic translation initiation factor 2α (eIF2α), suppressing global translation while inducing transcription factors such as activating transcription factor 4 (ATF4) and CHOP. CHOP upregulates pro-apoptotic genes, promoting cell death. Meanwhile, ATF6 activates ER chaperones, including glucose-regulated protein 78 kDa (GRP78) and glucose-regulated protein 94 kDa, as well as X-box binding protein 1 (XBP1) (5-7). IRE1, through its endoribonuclease activity, mediates XBP1 splicing or triggers apoptosis through the JNK pathway (7). This regulatory network highlights the dual role of ER stress in maintaining cellular homeostasis or inducing apoptosis, depending on the duration and intensity of the stress signals.

The precise molecular mechanisms governing the balance between ER stress-dependent pro-survival and pro-death signals in BC pathogenesis remain incompletely understood. XBP1 is highly expressed in estrogen receptor-positive BC (8), where estrogen activates the UPR through GRP78 to enhance cell survival and promote tumor progression (9,10). In triple-negative BC (TNBC), the spliced form of X-box binding protein 1 (XBP1s)-hypoxia-inducible factor 1-α complex has been shown to support poor prognosis (11), while the IRE1α/XBP1s pathway is activated by the MYC proto-oncogene to maintain cell survival (12). Furthermore, the PERK/eIF2α pathway initiates autophagy and redox control in TNBC and persistent ER stress activates apoptotic mechanisms through caspase-8, Noxa, CHOP and JNK (13-15). In HER2-positive BC, activation of the PERK-ATF4-CHOP axis increases cell sensitivity to apoptosis through upregulation of TNF receptor superfamily member 10b and caspase-8(16), highlighting the complex interplay between ER stress pathways and BC subtype-specific outcomes.

The majority of chemotherapeutic agents exert therapeutic effects through either cell cycle inhibition or activation of apoptotic pathways. Apoptosis, defined as a programmed and regulated cell death mechanism, serves a key role in maintaining homeostasis (17). However, tumor cells develop resistance to chemotherapeutic agents by suppressing apoptosis (18). Therefore, triggering apoptotic processes in malignant cells represents a potential therapeutic response. Furthermore, the modulatory effect of the tumor microenvironment on ER stress-induced apoptosis may be an important factor in the emergence of adaptive mechanisms (19). Specifically, conditions within the tumor microenvironment, such as hypoxia, nutrient deprivation and stromal cell crosstalk, can activate compensatory pro-survival signaling, thereby dampening the apoptotic response to ER stress (19).

Metformin is a prescribed oral antidiabetic drug and is a first-line medication for managing type 2 diabetes (20). Beyond its glucose-lowering effects, this biguanide is a safe drug that interacts with numerous oncogenic and tumor-suppressive pathways, such as AMPK-dependent and -independent mechanisms, making it an attractive option for cancer prevention and treatment (21). Studies have shown that metformin use is associated with a 31% decrease in overall cancer risk compared with other antidiabetic drugs and insulin. Although its exact antitumor mechanisms are not fully understood, AMPK activation and the inhibition of proliferative signaling pathways may serve important roles (21,22). Current research, including both in vivo and in vitro studies, indicates that metformin may have anticancer effects in BC treatment and may be considered a therapeutic option (23-25).

The literature presents conflicting results regarding the effects of metformin, a potential anticancer agent in BC treatment, on ER stress (26-28). Modulation of the UPR is a potential strategy in cancer treatment and enhancing pro-apoptotic signals of ER stress, in particular, may allow selective targeting of cancer cells (29). Against this background, the present study aimed to investigate the dose-dependent effects of metformin on ER stress and apoptosis in SKBR3 cells, an aggressive HER2-positive BC model.

Materials and methods

Cell culture

HER2+ BC SKBR3 cells (wild-type) was obtained from the American Type Culture Collection and cultured in 25 cm2 flasks using McCoy's 5A modified medium (cat. no. 16600-082) containing 10% FBS (cat. no. 10500-064), 1% L-glutamine (cat. no. 25030-081) and 1% 100U penicillin/0.1 mg streptomycin (cat. no. 15140-122; all Gibco; Thermo Fisher Scientific, Inc.) with 5% CO2 at 37˚C. The complete medium was removed once the cells reached 70-80% confluence and cells were rinsed with PBS. After PBS removal, the cells were detached using trypsin-EDTA (0.25% trypsin and 0.02% EDTA; cat. no. 25200-056; Gibco, Thermo Fisher Scientific, Inc.). A total of 5x103 cells/well were transferred into an e-plate for a proliferation-cytotoxicity assay. For gene expression and apoptosis analysis by flow cytometry, cells were seeded in 25 cm2 flasks.

Study groups

For the real-time cell analyzer (RTCA) and gene expression studies the following groups were used: Control and 5, 10 and 20 mM metformin. For Annexin V-FITC/PI analysis, only control and 10 and 20 mM metformin groups were included. Only complete medium was added for the control group. The administered metformin doses were selected based on the literature (24,25).

RTCA

RTCA operates based on electronic impedance readings obtained from sensor electrodes located beneath e-plates. As cells attach to or detach from the surface electrodes, the change in electronic impedance is mathematically expressed as cell index (CI) values (30). Cells were cultured in plates designed for the xCELLigence Real-Time Cell Analysis system (Agilent Technologies, Inc.) at 5x103 cells/well and incubated with 5% CO2 for 24 h at 37˚C. Furthermore, the medium containing metformin (cat. no. D15095-9; Sigma-Aldrich; Merck KGaA; 5, 10 and 20 mM) was added to different wells. Complete medium without metformin was added to the control wells. The e-plates were monitored for 6 days.

Reverse transcription-quantitative PCR

Following 24 h of treatment with metformin (5, 10 and 20 mM) at 37˚C in a 5% CO2 incubator, the medium was removed. Using the One Step-RNA Reagent (cat. no. BS410A Bio Basic Inc.), RNA isolation was performed. The quality and quantity of obtained RNA was evaluated by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). mRNA was converted to cDNA using the iScript™ cDNA Synthesis kit (cat. no. 1708891; Bio-Rad Laboratories, Inc.) according to the manufacturer's protocol. Using the SsoAdvanced™ Universal SYBR Green Supermix (cat. no. 1725271; Bio-Rad Laboratories, Inc.) GAPDH, GRP78, PERK, IRE1, ATF6 and CHOP gene expression was measured through qPCR, using the Biorad CFX 96 system (Bio-Rad Laboratories, Inc.) with the following cycling protocol: initial denaturation: 98˚C for 30 sec; 40 cycles of [denaturation: 98˚C for 15 sec, annealing/extension: 60˚C for 30 sec]. Primer sequences were designed using the NCBI Primer-BLAST tool. The relative gene expression was quantified using the 2-ΔΔCq method (31). The primer sequences of the genes are detailed in Table I.

Table I

PCR primer sequences.

Table I

PCR primer sequences.

GeneForward primer (5'-3')Reverse primer (3'-5')
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG
GRP78 ACAATCAAGGTCTATGAAGGTGAAAGAC CTCGAAGAATACCATTCACATCTATCTC
PERK AATCATAGCTCCTTCACCACAAA CATCTTCCACATCACAGTCTGTA
IRE1 CACAGTGACGCTTCCTGAAAC GCCATCATTAGGATCTGGGAGA
ATF6 AGCATGTTCCTGAGGAGTTGG AGGCTTATCTTCCTTCAGTGGC
CHOP GGAAACAGAGTGGTCATTCCC CTGCTTGAGCCGTTCATTCTC

[i] GRP78, glucose-regulated protein 78 kDa; PERK, PRKR-like ER kinase; IRE1, inositol-requiring enzyme 1; ATF6, activating transcription factor 6; CHOP, C/EBP homologous protein.

Annexin V-FITC/PI analysis

Early and late apoptotic cell populations were detected using an Annexin V-FITC/PI apoptosis detection kit (cat. no. E-CK-A211; Elabscience Bionovation Inc.), according to the manufacturer's protocol. Following 24 h metformin treatment as aforementioned, cells were harvested by trypsinization, washed in PBS and stained for apoptosis analysis using an Annexin V-FITC/PI assay. The staining procedure was performed as follows: Cells were resuspended at a density of 5x105 cells per sample in 500 µl of 1X Annexin V Binding Buffer. Each sample was then stained by adding 5 µl of Annexin V-FITC conjugate and 5 µl of PI directly to the cell suspension. The mixture was gently vortexed and then incubated at room temperature (~25˚C) in the dark for 15-20 min. After the incubation,cells were analyzed immediately by flow cytometry (BD FACSCalibur™; BD Biosciences) using the BD CellQuest™ acquisition and analysis software (version 5.2.1; BD Biosciences).

Statistical analysis

Statistical analyses were performed using SPSS (version 25; IBM Corp.) Data distribution normality was assessed using the Shapiro-Wilk test. For parametric data, one-way ANOVA was employed, followed by Tukey's post hoc test. Data are presented as mean ± SEM. For non-parametric data the Kruskal-Wallis test was used, followed by Dunn's test with Bonferroni correction for multiple comparisons. All experiments were performed in quadruplicate. P<0.05 was considered to indicate a statistically significant difference.

Results

Metformin inhibits cell proliferation in a dose-dependent manner

The anti-proliferative effects of metformin were analyzed using RTCA via electrical impedance. While the CI in the control group continued to increase, all doses of metformin (5, 10 and 20 mM) exhibited antiproliferative and cytotoxic activity by day 6, as evidenced by a decrease in CI values based on electrical impedance signals (Fig. 1).

Cell proliferation following
metformin treatment. All doses of metformin exhibited
antiproliferative activity.

Figure 1

Cell proliferation following metformin treatment. All doses of metformin exhibited antiproliferative activity.

Metformin induces dose-dependent upregulation of ER stress marker genes

Treatment with 5, 10 and 20 mM metformin increased GRP78 gene expression by 3.70±0.11-, 5.06±0.08- and 7.33±0.08-fold (all P<0.0001), respectively (Fig. 2). Treatment with 5, 10 and 20 mM metformin increased PERK gene expression by 2.48±0.09-, 4.36±0.06- and 9.11±0.36-fold (all P<0.0001), respectively (Fig. 3). Treatment with 5, 10 and 20 mM metformin increased IRE1 gene expression levels by 2.15±0.08- (P=0.001), 2.90±0.03- (P<0.001) and 5.55±0.10-fold (P<0.0001), respectively (Fig. 4). Treatment with 5, 10 and 20 mM metformin increased ATF6 gene expression levels by 2.43±0.01-, 2.44±0.07- and 3.63±0.05-fold (all P<0.0001), respectively (Fig. 5). Treatment with 5, 10 and 20 mM metformin increased CHOP gene expression levels by 3.31±0.06-, 27.47±0.44- and 49.85±0.9-fold (all P<0.0001), respectively (Fig. 6).

Gene expression changes of GRP78.
Metformin increased GRP78 gene expression in a dose-dependent
manner ****P<0.0001. GRP78, glucose-regulated protein
78 kDa.

Figure 2

Gene expression changes of GRP78. Metformin increased GRP78 gene expression in a dose-dependent manner ****P<0.0001. GRP78, glucose-regulated protein 78 kDa.

Gene expression changes of PERK.
Metformin increased PERK gene expression in a dose-dependent manner
****P<0.0001. PERK, PRKR-like ER kinase.

Figure 3

Gene expression changes of PERK. Metformin increased PERK gene expression in a dose-dependent manner ****P<0.0001. PERK, PRKR-like ER kinase.

Gene expression changes of IRE1.
Metformin increased IRE1 gene expression in a dose-dependent manner
**P<0.01, ***P<0.001 and
****P<0.0001. IRE1, inositol-requiring enzyme 1.

Figure 4

Gene expression changes of IRE1. Metformin increased IRE1 gene expression in a dose-dependent manner **P<0.01, ***P<0.001 and ****P<0.0001. IRE1, inositol-requiring enzyme 1.

Gene expression changes of ATF6.
Metformin increased ATF6 gene expression
****P<0.0001. ATF6, activating transcription factor
6.

Figure 5

Gene expression changes of ATF6. Metformin increased ATF6 gene expression ****P<0.0001. ATF6, activating transcription factor 6.

Gene expression changes of CHOP.
Metformin increased CHOP gene expression in a dose-dependent
manner. ****P<0.0001. CHOP, C/EBP homologous
protein.

Figure 6

Gene expression changes of CHOP. Metformin increased CHOP gene expression in a dose-dependent manner. ****P<0.0001. CHOP, C/EBP homologous protein.

Metformin triggers apoptosis in a dose-dependent manner

Treatment with 10 and 20 mM metformin significantly increased early apoptotic cells to 6.05 and 7.28, as well as late apoptotic cells to 13.24 and 20.59% (all P<0.001), respectively, compared with the control group (Fig. 7). These results demonstrated dose-dependent induction of apoptosis (Fig. 8).

Flow cytometry analysis of
metformin-induced apoptotic death. Treatment with 10 and 20 mM
metformin significantly increased early apoptotic cells to 6.05 and
7.28 and late apoptotic cells to 13.24 and 20.59% (all P<0.001),
respectively, compared with the control group.

Figure 7

Flow cytometry analysis of metformin-induced apoptotic death. Treatment with 10 and 20 mM metformin significantly increased early apoptotic cells to 6.05 and 7.28 and late apoptotic cells to 13.24 and 20.59% (all P<0.001), respectively, compared with the control group.

Percentage of early and late
apoptotic cells following metformin treatment. Metformin increased
the percentage of early and late apoptotic cells in a
dose-dependent manner. *P<0.001.

Figure 8

Percentage of early and late apoptotic cells following metformin treatment. Metformin increased the percentage of early and late apoptotic cells in a dose-dependent manner. *P<0.001.

Discussion

Within the present study, the multifaceted anticancer effects of metformin on the HER2-positive aggressive BC cell line SKBR3 were investigated. RTCA revealed that metformin (5, 10 and 20 mM) exhibited notable antiproliferative activity on day 6. This proliferation inhibition was functionally associated with dose-dependent increases in ER stress markers and apoptosis. Administration of 5, 10 and 20 mM metformin led to a significant dose-dependent increase in the gene expression of GRP78, PERK, IRE1, ATF6 and CHOP. Percentages of early and late apoptotic cells significantly increased in a dose-dependent manner in the 10 and 20 mM metformin groups. Collectively, these results support the hypothesis that metformin induces ER stress-mediated apoptosis by upregulating the ER chaperone GRP78 and key components of the UPR - namely PERK, IRE1 and ATF6 - which in turn activates the pro-apoptotic CHOP pathway. Despite the antitumor role of metformin having been widely reported, its molecular mechanism in inhibiting tumor progression remains unclear (21,32). Both in vitro and in vivo studies demonstrate that metformin exerts anticancer effects on BC through both AMPK-dependent and -independent mechanisms. The AMPK-dependent mechanisms include liver kinase B1-mediated AMPK phosphorylation, inhibition of mTOR through AMPK, forkhead box O3 activation and the regulation of histone deacetylases. AMPK-independent effects occur through numerous pathways, including microRNA modulation, increased oxidative stress, antifolate activity, inhibition of angiogenesis, NF-κB activation by suppressing proinflammatory cytokines such as IL-6 and IL-17, downregulation of specificity protein (SP)-1/SP3/SP4 transcription factors, upregulation of caveolin-1 and the modulation of cell cycle regulatory proteins (21,32). A potential anticancer mechanism of metformin may involve activation of ER stress-induced apoptotic cascades. The literature has consistently demonstrated the cytotoxic effects of metformin across a number of BC cell lines (24-28,33-35). In MCF-7 cells (BC cell line, ER positive), 10 µM metformin markedly decreases viability and migration compared with controls (27). Li et al (28) reported that 0.125 mg/ml metformin promotes death in glucose-deprived MDA-MB-231 cells (BC cell line, triple-negative). A number of studies using SKBR3 cells have shown dose- and time-dependent effects (24,25,33-36). For example, Chen et al (33) observed that 0.5-8.0 mM metformin inhibits proliferation and induces apoptosis, while Neamati et al (34) found that 30-100 mM treatment increases the number of apoptotic cells by 48 h. Xu et al (35) demonstrated that 20-120 µM metformin caused time-dependent proliferation, inhibition and G1-phase arrest, with 96.25 µM treatment increasing early and late apoptosis to 4.48 and 17.13%, respectively, at 48 h. Ahmadpour et al (24) and Amaral et al (25) demonstrated that 10-80 and 0.01-5.00 mM metformin concentrations, respectively, dose-dependently decrease viability at numerous timepoints. Notably, metformin exhibits enhanced efficacy against trastuzumab-resistant cells (36). The present findings of increased early/late apoptosis and reduced viability with 10-20 mM metformin treatment are consistent with the aforementioned effects.

The dichotomous role of ER stress in promoting cancer cell survival or triggering apoptosis remains subject to debate (37), although sustained or severe ER stress leads to cell death (38). While numerous studies using various cell lines, mostly consistent with the present findings, have demonstrated that metformin causes ER stress-induced apoptosis (26-28,39-45), there are also studies suggesting it reduces ER stress (46-48). However this may be due to the cell lines used as well as the metformin dose. According to studies in non-cancerous cell lines, low-dose metformin suppresses ER stress-induced apoptosis (46-48). For example, in a colitis model, 1 mM metformin decreases GRP78, CHOP, caspase-12, PERK and eIF2α expression levels and apoptosis (46). Furthermore, in pancreatic β cells, 0.05 mM metformin suppresses palmitate-induced ER stress induction in an AMPK-independent manner (47), and in ovarian granulosa cells, 1 mM metformin inhibits testosterone-induced ER stress and UPR activation by suppressing mitogen-activated protein kinase P38-α phosphorylation (48). In studies with cancer cell lines, metformin causes ER stress-induced apoptosis, supporting the present findings (39-45); in a study using prostate cancer cells, application of 5 mM metformin increased the expression of ER stress-associated CHOP, phosphorylated (p)-eIF2α, calreticulin, GRP78 and SR Ca2+-ATPase 1 genes through miR-708-5p, thereby inducing apoptosis (39). In addition, a study of colon cancer cells demonstrated that the application of 1, 5 and 25 mM metformin induces dose-dependent increases in PERK, p-eIF2α, ATF4 and CHOP levels (40). In colon cancer cells, 5 mM metformin activates CHOP and inhibites cell proliferation by causing cell cycle arrest (41) and in thyroid cancer cells, metformin application inhibits proliferation and induces apoptosis in a concentration- (1.25, 2.50, 5, 10 or 20 mM) and time-dependent (24-48 h) manner. Furthermore, 5, 10 and 20 mM metformin activate ER stress by increasing GRP78, CHOP and caspase-12 expression (42). Similarly, metformin (0-20 mM and 0-48 h) decreases the cell proliferation index and increases the expression of GRP78, CHOP and caspase-12 in papillary thyroid carcinoma cells (43). Furthermore, in endometrial cancer cells, metformin increases CHOP expression levels while decreasing GRP78 expression levels (44). Similarly, metformin induces UPR-mediated cell death by decreasing GRP78 expression and upregulating IRE1α and CHOP in acute lymphoblastic leukemia cells (45).

Studies demonstrating metformin-induced ER stress-mediated apoptosis in BC remain limited (26-28). In MCF-7 cells, Huang et al (26) reported that metformin (0-40 mM) dose-dependently increases CHOP expression, inhibits proliferation, promotes apoptosis and induces cell cycle arrest. Alizade et al (27) found that 10 µM metformin decreases viability and migration after 48 h, upregulating apoptosis-related caspase-3, Bax, apoptosis regulator, apoptosis-inducing factor mitochondria associated 1, CHOP and GRP78 expression while downregulating Bcl-2 and WEE1 G2 checkpoint kinase. In MDA-MB-231 cells, Li et al (28) demonstrated that 0.125 mg/ml metformin under glucose deprivation enhances UPR through the ATF4/ATF3/CHOP pathway while inhibiting anti-apoptotic Bcl-2 and BCL-xl effects. To the best of our knowledge, no studies have investigated the association between metformin and ER stress-induced apoptosis in aggressive HER2-positive BC cells. In the present study, a dose-dependent induction of endoplasmic reticulum stress was suggested, as increases in the expression of ER stress markers GRP78, PERK, IRE1, ATF6 and CHOP following treatment with 5, 10 and 20 mM metformin was observed. The upregulation of chaperone GRP78 and the three primary UPR sensors (PERK, IRE1 and ATF6) demonstrated ER stress induction. Notable increases in CHOP gene expression at 10 and 20 mM metformin doses were detected, mediated by PERK and ATF6 activation, an indicator of ER stress-induced apoptosis. This was supported by Annexin V-FITC/PI assays showing significant increases in early and late apoptotic cells at these concentrations. IRE1 upregulation may promote apoptosis through JNK or caspase-12 pathways. Furthermore, elevated IRE1, PERK and ATF6 levels may sustain the ER stress response by maintaining GRP78 activation.

The present study provided functional and transcriptional evidence that metformin induces ER stress and triggers apoptosis in HER2-positive BC cells. However, certain limitations must be acknowledged. Activation of ER stress pathways could not be directly demonstrated at the protein level. Secondly, the present study was not conducted in multiple HER2-positive cell lines to strengthen the generalizability of the findings. However, the present results in SKBR3 cells are consistent with the literature, which reports that metformin reduces viability in a dose-dependent manner in HER2-positive BT-474 cells (BC cell line, ER/PR/HER2-positive). Finally, the present study employed high metformin concentrations (49), consistent with preclinical literature, to elucidate ER stress and apoptosis mechanisms. However, these concentrations are markedly higher than those of therapeutic plasma levels (10-40 µM) achieved with standard oral dosing in diabetes treatment (50). Reasons behind the high in vitro dose requirement may include continuous drug exposure, the absence of serum protein binding and non-physiological conditions of the cell culture environment, such as high glucose and growth factor levels. These conditions may maximize cell proliferation and survival signals, necessitating higher drug concentrations to suppress oncogenic mechanisms (51). This represents a key limitation for the direct clinical translation of the present results, which require validation through in vivo animal experiments. The effects of metformin on ER stress and apoptosis are context-dependent. The literature reports varying and contradictory outcomes depending on cell type, metabolic profile, microenvironmental conditions and the dose (21,25,39,48,52,53). Therefore, validating the present findings in other cancer models and in vivo systems is key to define the therapeutic potential of metformin.

In conclusion, the present findings demonstrated that metformin treatment inhibited proliferation in a time- and dose-dependent manner in SKBR3 cells, activated the ER stress response to potentiate apoptotic signaling and disrupted cell survival mechanisms. These results suggest that the ER stress-apoptosis axis may represent a therapeutic target in HER2-positive BC. However, further in vivo investigations are warranted to evaluate the clinical translatability of metformin.

Acknowledgements

Not applicable.

Funding

Funding: No funding was received.

Availability of data and materials

The data generated in the present study are included in the figures and/or tables of this article.

Authors' contributions

EÇ and BB conceived and designed the study. EÇ conducted data analysis and wrote the manuscript. All authors have read and approved the final manuscript. EÇ and BB confirm the authenticity of all the raw data.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Filho AM, Laversanne M, Ferlay J, Colombet M, Piñeros M, Znaor A, Parkin DM, Soerjomataram I and Bray F: The GLOBOCAN 2022 cancer estimates: Data sources, methods, and a snapshot of the cancer burden worldwide. Int J Cancer. 156:1336–1346. 2025.PubMed/NCBI View Article : Google Scholar

2 

Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I and Jemal A: Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 74:229–263. 2024.PubMed/NCBI View Article : Google Scholar

3 

Amin MB, Greene FL, Edge SB, Compton CC, Gershenwald JE, Brookland RK, Meyer L, Gress DM, Byrd DR and Winchester DP: The Eighth Edition AJCC Cancer Staging Manual: Continuing to build a bridge from a population-based to a more ‘personalized’ approach to cancer staging. CA Cancer J Clin. 67:93–99. 2017.PubMed/NCBI View Article : Google Scholar

4 

Chavez-MacGregor M, Mittendorf EA, Clarke CA, Lichtensztajn DY, Hunt KK and Giordano SH: Incorporating tumor characteristics to the American joint committee on cancer breast cancer staging system. Oncologist. 22:1292–1300. 2017.PubMed/NCBI View Article : Google Scholar

5 

Yu X, Li W, Sun S and Li J: Endoplasmic reticulum stress in cancer progression: A comprehensive review of its role and mechanisms. Int J Med Sci. 22:4561–4585. 2025.PubMed/NCBI View Article : Google Scholar

6 

Ghemrawi R, Kremesh S, Mousa WK and Khair M: The Role of ER stress and the unfolded protein response in cancer. Cancer Genomics Proteomics. 22:363–381. 2025.PubMed/NCBI View Article : Google Scholar

7 

Çakmak E and Bilgici B: The relationship between cancer and endoplasmic reticulum stress-induced apoptosis. Kırıkkale Üni Tıp Derg. 27:111–119. 2025.

8 

Ding L, Yan J, Zhu J, Zhong H, Lu Q, Wang Z, Huang C and Ye Q: Ligand-independent activation of estrogen receptor alpha by XBP-1. Nucleic Acids Res. 31:5266–5274. 2003.PubMed/NCBI View Article : Google Scholar

9 

Scriven P, Coulson S, Haines R, Balasubramanian S, Cross S and Wyld L: Activation and clinical significance of the unfolded protein response in breast cancer. Br J Cancer. 101:1692–1698. 2009.PubMed/NCBI View Article : Google Scholar

10 

Kiang JG, Gist ID and Tsokos GC: 17 beta-estradiol-induced increases in glucose-regulated protein 78kD and 94kD protect human breast cancer T47-D cells from thermal injury. Chin J Physiol. 40:213–219. 1997.PubMed/NCBI

11 

Chen X, Iliopoulos D, Zhang Q, Tang Q, Greenblatt MB, Hatziapostolou M, Lim E, Tam WL, Ni M, Chen Y, et al: Xbp1 promotes triple-negative breast cancer by controlling the hif1alpha pathway. Nature. 508:103–107. 2014.PubMed/NCBI View Article : Google Scholar

12 

Zhao N, Cao J, Xu L, Tang Q, Dobrolecki LE, Lv X, Talukdar M, Lu Y, Wang X, Hu DZ, et al: Pharmacological targeting of MYC-regulated IRE1/XBP1 pathway suppresses MYC-driven breast cancer. J Clin Invest. 128:1283–1299. 2018.PubMed/NCBI View Article : Google Scholar

13 

Cano-González A, Mauro-Lizcano M, Iglesias-Serret D, Gil J and López-Rivas A: Involvement of both caspase-8 and Noxa-activated pathways in endoplasmic reticulum stress-induced apoptosis in triple-negative breast tumor cells. Cell Death Dis. 9(134)2018.PubMed/NCBI View Article : Google Scholar

14 

Zhou W, Fang H, Wu Q, Wang X, Liu R, Li F, Xiao J, Yuan L, Zhou Z, Ma J, et al: Ilamycin E, a natural product of marine actinomycete, inhibits triple-negative breast cancer partially through ER stress-CHOP-Bcl-2. Int J Biol Sci. 15:1723–1732. 2019.PubMed/NCBI View Article : Google Scholar

15 

Dávila-González D, Choi DS, Rosato RR, Granados-Principal SM, Kuhn JG, Li WF, Qian W, Chen W, Kozielski AJ, Wong H, et al: Pharmacological inhibition of NOS Activates ASK1/JNK pathway augmenting docetaxel-mediated apoptosis in triple-negative breast cancer. Clin Cancer Res. 24:1152–1162. 2018.PubMed/NCBI View Article : Google Scholar

16 

Martín-Pérez R, Palacios C, Yerbes R, Cano-González A, Iglesias-Serret D, Gil J, Reginato MJ and López-Rivas A: Activated ERBB2/HER2 licenses sensitivity to apoptosis upon endoplasmic reticulum stress through a PERK-dependent pathway. Cancer Res. 74:1766–1777. 2014.PubMed/NCBI View Article : Google Scholar

17 

Benner SE and Hong WK: Clinical chemoprevention: Developing a cancer prevention strategy. J Natl Cancer Inst. 85:1446–1447. 1993.PubMed/NCBI View Article : Google Scholar

18 

Campbell KJ and Tait SWG: Targeting BCL-2 regulated apoptosis in cancer. Open Biol. 8(180002)2018.PubMed/NCBI View Article : Google Scholar

19 

Chen X and Cubillos-Ruiz JR: Endoplasmic reticulum stress signals in the tumour and its microenvironment. Nat Rev Cancer. 21:71–88. 2021.PubMed/NCBI View Article : Google Scholar

20 

Nathan DM, Buse JB, Davidson MB, Ferrannini E, Holman RR, Sherwin R and Zinman B: American Diabetes Association; European Association for Study of Diabetes. Medical management of hyperglycemia in type 2 diabetes: A consensus algorithm for the initiation and adjustment of therapy: A consensus statement of the American diabetes association and the European association for the study of diabetes. Diabetes Care. 32:193–203. 2009.PubMed/NCBI View Article : Google Scholar

21 

Faria J, Negalha G, Azevedo A and Martel F: Metformin and breast cancer: Molecular targets. J Mammary Gland Biol Neoplasia. 24:111–123. 2019.PubMed/NCBI View Article : Google Scholar

22 

Ala M and Ala M: Metformin for cardiovascular protection, inflammatory bowel disease, osteoporosis, periodontitis, polycystic ovarian syndrome, neurodegeneration, cancer, inflammation and senescence: What is next? ACS Pharmacol Transl Sci. 4:1747–1770. 2021.PubMed/NCBI View Article : Google Scholar

23 

Cejuela M, Martin-Castillo B, Menendez JA and Pernas S: Metformin and breast cancer: Where are we now? Int J Mol Sci. 26(5407)2025.PubMed/NCBI View Article : Google Scholar

24 

Ahmadpour F, Igder S, Eftekhari Moghadam AR, Moradipoodeh B, Sepahdar A, Mokarram P, Fallahi J and Mohammadzadeh G: Metformin as a potential therapeutic agent in breast cancer: Targeting miR-125a methylation and epigenetic regulation. Int J Mol Cell Med. 13:272–285. 2024.PubMed/NCBI View Article : Google Scholar

25 

Amaral MEA, Nery LR, Leite CE, de Azevedo Junior WF and Campos MM: Pre-clinical effects of metformin and aspirin on the cell lines of different breast cancer subtypes. Invest New Drugs. 36:782–796. 2018.PubMed/NCBI View Article : Google Scholar

26 

Huang Y, Zhou Z, Zhang J, Hao Z, He Y, Wu Z, Song Y, Yuan K, Zheng S, Zhao Q, et al: lncRNA MALAT1 participates in metformin inhibiting the proliferation of breast cancer cell. J Cell Mol Med. 25:7135–7145. 2021.PubMed/NCBI View Article : Google Scholar

27 

Alizade A, Evyapan G, Celik IS and Ozdem B: Metformin induces mitochondria-mediated and endoplasmic reticulum stress-mediated apoptosis and inhibits angiogenesis-related gene expression in breast cancer cells via targeting VEGF-A/VEGFR2/NRP1. Croat Med J. 66:115–124. 2025.PubMed/NCBI View Article : Google Scholar

28 

Li Y, Zhang Q, Yang J, He W, Jiang Y, Chen Y and Wang Y: Metformin combined with glucose starvation synergistically suppress triple-negative breast cancer by enhanced unfolded protein response. Biochem Biophys Res Commun. 675:146–154. 2023.PubMed/NCBI View Article : Google Scholar

29 

Kim C and Kim B: . Anti-cancer natural products and their bioactive compounds inducing ER stress-mediated apoptosis: A review. Nutrients. 10(1021)2018.PubMed/NCBI View Article : Google Scholar

30 

Roshan Moniri M, Young A, Reinheimer K, Rayat J, Dai LJ and Warnock GL: Dynamic assessment of cell viability, proliferation and migration using real time cell analyzer system (RTCA). Cytotechnology. 67:379–386. 2015.PubMed/NCBI View Article : Google Scholar

31 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

32 

Saini N and Yang X: Metformin as an anti-cancer agent: Actions and mechanisms targeting cancer stem cells. Acta Biochim Biophys Sin (Shanghai). 50:133–143. 2018.PubMed/NCBI View Article : Google Scholar

33 

Chen TW, Liang YN, Feng D, Tao LY, Qi K, Zhang HY, Wang HX, Lin QS and Kong H: Metformin inhibits proliferation and promotes apoptosis of HER2 positive breast cancer cells by downregulating HSP90. J BUON. 18:51–56. 2013.PubMed/NCBI

34 

Neamati D, Khedri A, Aberomand M, Hemmati AA, Mohammadzadeh M, Akbari Baghbani K and Mohammadzadeh G: Metformin synergistically increases the anticancer effects of lapatinib through induction of apoptosis and modulation of Akt/AMPK pathway in SK-BR3 breast cancer cell line. Iran J Basic Med Sci. 24:1529–1537. 2021.PubMed/NCBI View Article : Google Scholar

35 

Xu Y, Xu T, Xiong Y and Huang J: Metformin inhibits proliferation and promotes apoptosis of HER-2 positive breast cancer cells possibly through the Hippo-YAP pathway. Nan Fang Yi Ke Da Xue Xue Bao. 42:740–746. 2022.PubMed/NCBI View Article : Google Scholar : (In Chinese).

36 

Liu B, Fan Z, Edgerton SM, Yang X, Lind SE and Thor AD: Potent anti-proliferative effects of metformin on trastuzumab-resistant breast cancer cells via inhibition of erbB2/IGF-1 receptor interactions. Cell Cycle. 10:2959–2966. 2011.PubMed/NCBI View Article : Google Scholar

37 

Zhang W, Shi Y, Oyang L, Cui S, Li S, Li J, Liu L, Li Y, Peng M, Tan S, et al: Endoplasmic reticulum stress-a key guardian in cancer. Cell Death Discov. 10(343)2024.PubMed/NCBI View Article : Google Scholar

38 

Walter P and Ron D: The unfolded protein response: From stress pathway to homeostatic regulation. Science. 334:1081–1086. 2011.PubMed/NCBI View Article : Google Scholar

39 

Yang J, Wei J, Wu Y, Wang Z, Guo Y, Lee P and Li X: Metformin induces ER stress-dependent apoptosis through miR-708-5p/NNAT pathway in prostate cancer. Oncogenesis. 4(e158)2015.PubMed/NCBI View Article : Google Scholar

40 

Lee DE, Lee GY, Lee HM, Choi SY, Lee SJ and Kwon OS: Synergistic apoptosis by combination of metformin and an O-GlcNAcylation inhibitor in colon cancer cells. Cancer Cell Int. 23(108)2023.PubMed/NCBI View Article : Google Scholar

41 

Lee DE, Lee HM, Jun Y, Choi SY, Lee SJ and Kwon OS: Metformin induces apoptosis in TRAIL-resistant colorectal cancer cells. Biochim Biophys Acta Mol Cell Res. 1872(119873)2025.PubMed/NCBI View Article : Google Scholar

42 

Ye J, Qi L, Chen K, Li R, Song S, Zhou C and Zhai W: Metformin induces TPC-1 cell apoptosis through endoplasmic reticulum stress-associated pathways in vitro and in vivo. Int J Oncol. 55:331–339. 2019.PubMed/NCBI View Article : Google Scholar

43 

Dong LR, Li M, Li S, Liu AD, Xiong YJ, Tang H and Song XD: Metformin induced apoptosis of papillary thyroid carcinoma BCPAP cells. Lin Chuang Er Bi Yan Hou Tou Jing Wai Ke Za Zhi. 31:937–940. 2017.PubMed/NCBI View Article : Google Scholar : (In Chinese).

44 

Conza D, Mirra P, Calì G, Insabato L, Fiory F, Beguinot F and Ulianich L: Metformin dysregulates the unfolded protein response and the WNT/β-Catenin pathway in endometrial cancer cells through an AMPK-Independent mechanism. Cells. 10(1067)2021.PubMed/NCBI View Article : Google Scholar

45 

Leclerc GM, Leclerc GJ, Kuznetsov JN, DeSalvo J and Barredo JC: Metformin induces apoptosis through AMPK-dependent inhibition of UPR signaling in ALL lymphoblasts. PLoS One. 8(e74420)2013.PubMed/NCBI View Article : Google Scholar

46 

Wang J, Chen C, Ren Y, Zhou X and Yu S: Metformin alleviates intestinal epithelial barrier damage by inhibiting endoplasmic reticulum stress-induced cell apoptosis in colitis cell model. Zhejiang Da Xue Xue Bao Yi Xue Ban. 50:627–632. 2021.PubMed/NCBI View Article : Google Scholar : (In Chinese).

47 

Kim HI, Lee JS, Kwak BK, Hwang WM, Kim MJ, Kim YB, Chung SS and Park KS: Metformin ameliorates lipotoxic β-Cell dysfunction through a concentration-dependent dual mechanism of action. Diabetes Metab J. 43:854–866. 2019.PubMed/NCBI View Article : Google Scholar

48 

Jin J, Ma Y, Tong X, Yang W, Dai Y, Pan Y, Ren P, Liu L, Fan HY, Zhang Y and Zhang S: Metformin inhibits testosterone-induced endoplasmic reticulum stress in ovarian granulosa cells via inactivation of p38 MAPK. Hum Reprod. 35:1145–1158. 2020.PubMed/NCBI View Article : Google Scholar

49 

Keshandehghan A, Nikkhah S, Tahermansouri H, Heidari-Keshel S and Gardaneh M: Co-Treatment with sulforaphane and nano-metformin molecules accelerates apoptosis in HER2+ breast cancer cells by inhibiting key molecules. Nutr Cancer. 72:835–848. 2020.PubMed/NCBI View Article : Google Scholar

50 

Stambolic V, Woodgett JR, Fantus IG, Pritchard KI and Goodwin PJ: Utility of metformin in breast cancer treatment, is neoangiogenesis a risk factor? Breast Cancer Res Treat. 114:387–389. 2009.PubMed/NCBI View Article : Google Scholar

51 

Dowling RJ, Niraula S, Stambolic V and Goodwin PJ: Metformin in cancer: Translational challenges. J Mol Endocrinol. 48:R31–R43. 2012.PubMed/NCBI View Article : Google Scholar

52 

Morales DR and Morris AD: Metformin in cancer treatment and prevention. Annu Rev Med. 66:17–29. 2015.PubMed/NCBI View Article : Google Scholar

53 

Quentin T, Steinmetz M, Poppe A and Thoms S: Metformin differentially activates ER stress signaling pathways without inducing apoptosis. Dis Model Mech. 5:259–269. 2012.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Çakmak E and Bilgici B: Metformin triggers apoptosis via endoplasmic reticulum stress in HER2‑positive breast cancer cell lines. Exp Ther Med 31: 111, 2026.
APA
Çakmak, E., & Bilgici, B. (2026). Metformin triggers apoptosis via endoplasmic reticulum stress in HER2‑positive breast cancer cell lines. Experimental and Therapeutic Medicine, 31, 111. https://doi.org/10.3892/etm.2026.13106
MLA
Çakmak, E., Bilgici, B."Metformin triggers apoptosis via endoplasmic reticulum stress in HER2‑positive breast cancer cell lines". Experimental and Therapeutic Medicine 31.4 (2026): 111.
Chicago
Çakmak, E., Bilgici, B."Metformin triggers apoptosis via endoplasmic reticulum stress in HER2‑positive breast cancer cell lines". Experimental and Therapeutic Medicine 31, no. 4 (2026): 111. https://doi.org/10.3892/etm.2026.13106
Copy and paste a formatted citation
x
Spandidos Publications style
Çakmak E and Bilgici B: Metformin triggers apoptosis via endoplasmic reticulum stress in HER2‑positive breast cancer cell lines. Exp Ther Med 31: 111, 2026.
APA
Çakmak, E., & Bilgici, B. (2026). Metformin triggers apoptosis via endoplasmic reticulum stress in HER2‑positive breast cancer cell lines. Experimental and Therapeutic Medicine, 31, 111. https://doi.org/10.3892/etm.2026.13106
MLA
Çakmak, E., Bilgici, B."Metformin triggers apoptosis via endoplasmic reticulum stress in HER2‑positive breast cancer cell lines". Experimental and Therapeutic Medicine 31.4 (2026): 111.
Chicago
Çakmak, E., Bilgici, B."Metformin triggers apoptosis via endoplasmic reticulum stress in HER2‑positive breast cancer cell lines". Experimental and Therapeutic Medicine 31, no. 4 (2026): 111. https://doi.org/10.3892/etm.2026.13106
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team