Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
May 2013 Volume 31 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May 2013 Volume 31 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Multiple roles of SOCS proteins: Differential expression of SOCS1 and SOCS3 in atherosclerosis

  • Authors:
    • Xiao Liang
    • Ming He
    • Tao Chen
    • Yan Liu
    • Yu-Ling Tian
    • Yu-Liang Wu
    • Yan Zhao
    • Yan Shen
    • Zu-Yi Yuan
  • View Affiliations / Copyright

    Affiliations: Department of Cardiovascular Medicine, The First Affiliated Hospital of Medical School, Xi'an Jiaotong University, Xi’an, Shaanxi 710061, P.R. China
  • Pages: 1066-1074
    |
    Published online on: March 27, 2013
       https://doi.org/10.3892/ijmm.2013.1323
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Pro-inflammatory cytokines play a key pathogenic role in atherosclerosis, which are induced by the Janus kinase/signal transducer and activator of transduction (JAK/STAT) pathway. Furthermore, the JAK/STAT pathway is negatively regulated by the suppressor of cytokine signaling (SOCS) proteins. However, the change in SOCS expression levels and the correlation between SOCS expression and cholesterol levels in atherosclerosis is not yet well understood. To this end, a mouse model of atherosclerosis was established using apolipoprotein-deficient (ApoE-/-) mice. The mice were fed either a chow or high-fat diet. The mRNA and protein expression of SOCS1 and SOCS3 in plaque and vessels were determined at different time points. Furthermore, SOCS1 and SOCS3 mRNA expression was detected in the peripheral blood mononuclear cells (PBMCs) obtained from 18 male subjects with no coronary heart disease (non-CHD) population. The expression of SOCS1 in the ApoE-/- mice first increased and then decreased and the high-fat diet accelerated the appearance of the peak; the expression of SOCS3 increased with the increased feeding duration, and this trend was more pronounced in the mice fed the high-fat diet. SOCS1/CD68 and SOCS3/CD68 showed opposite trends in expression with the increased duration of the high-fat diet. Interleukin-6 (IL-6) expression in the main aorta of the ApoE-/- mice fed the high-fat diet also increased with the increased feeding duration. In the non-CHD population, the total serum cholesterol levels positively correlated with SOCS3 mRNA expression in the PBMCs (r=0.433, P=0.012). These results demonstrate the differential expression of SOCS1 and SOCS3 in atherosclerosis and suggest that SOCS3, together with IL-6 may promote the formation and development of atherosclerosis.

Introduction

Atherosclerosis is a chronic inflammatory disease that is associated with a variety of inflammatory cytokines and chemokines that control the balance of pro-inflammation and anti-inflammation (1,2). This balance plays a critical role in the prognosis of atherosclerosis. Suppressor of cytokine signaling (SOCS) proteins are intracellular regulators of receptor signal transduction (3), which mainly regulate the Janus kinase/signal transducer and activator of transduction (JAK/STAT) pathway and play a regulatory role in the expression and activation of interleukin (IL)-6 (4), tumor necrosis factor-α (TNF-α), as well as other inflammatory cytokines (5,6).

SOCS protein expression closely correlates with the occurrence and development of inflammatory diseases through the regulation of gene expression and cellular activation, proliferation and differentiation (7). Previous studies have demonstrated that SOCS1 inhibits inflammation (8); SOCS1 reduces acute inflammation by regulating the activity of T cells (9), and SOCS1−/− mice suffer from fatal myocarditis (10). However, the role of SOCS3 remains controversial (11); intracellular protein therapy with SOCS3 has been shown to inhibit inflammation and apoptosis (12). SOCS3 transgenic mice have a Th2 response (13), while in mice with experimental autoimmune encephalomyelitis, inflammation was attenuated upon the intravenous injection of SOCS3−/− dentritic cells (14). In addition, bone marrow-derived macrophages differentiate into the M2 phenotype in SOCS3−/− rats, even under the conditions of classic activation (15). Macrophages express different SOCS proteins under various stimulatory conditions. Interferon-γ mainly induces SOCS1 expression (16) and interleukins, such as IL-6 and IL-10, induce SOCS3 expression (17). In the SOCS protein family, different subtypes play different roles in inflammatory diseases (18,19).

Hyperlipidemia, particularly hypercholesterolemia, is the most recognized risk factor for atherosclerosis (20). Circulating cholesterol may cause endothelial cell dysfunction on its own or by its chemical modifications, thus affecting the chemotaxis and adhesion of leukocytes and the release of several inflammation-activating cytokines (21–23), which further promotes the deposition of cholesterol under the arterial intima. The interaction between cholesterol and inflammation occurs throughout the onset and development of atherosclerosis (24). However, the mechanisms by which hypercholesterolemia influences SOCS expression and the ensuing effects (i.e., atherosclerosis) remain unclear. Through observations and quantitative analysis of the expression of SOCS1 and SOCS3 in atherosclerotic plaque in apolipoprotein-deficient (ApoE−/−) mice at different intervention time points, this study aimed to clarify the trends and possible mechanisms of action of SOCS1 and SOCS3 proteins in the formation of atherosclerotic plaque following exposure to high cholesterol levels, and to investigate the correlation between blood cholesterol levels and the expression of SOCS1 and SOCS3. The objective of this study was to further clarify the role of SOCS1 and SOCS3 in the occurrence and development of atherosclerosis.

Materials and methods

Animals

The animal experiments were carried out in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication no. 85-23, revised 1996). The ApoE−/− mice were kept under constant temperature conditions (18°C) with a 12-h light-dark cycle (light from 8:00 a.m. to 8:00 p.m.) and allowed free access to food and water; these mice were a gift from Dr Edward M. Rubin at the University of California, Berkeley (Berkeley, CA, USA). C57BL/6j mice were purchased from the Fourth Military Medical University, Xi’an, China. C57BL/6j and ApoE−/− mice were fed a chow diet (4% fat and 0% cholesterol) after being weaned at 3 weeks of age, then half of the ApoE−/− mice were switched to a high-fat diet containing 21% fat and 0.15% cholesterol from 6 weeks of age. The C57BL/6j mice were sacrificed at 12, 20 and 28 weeks, while the ApoE−/− mice were sacrificed at 12, 16, 20, 24 and 28 weeks (Fig. 1). The protocols for the experiments (sacrifice, blood and main aorta harvest) were approved by the Institutional Ethics Committee for Animal Experiments of Xi’an Jiaotong University, Xi’an, China and the mice were sacrificed after anesthesia, as previously described (25).

Figure 1

Time and feeding schedule of the animal model. w, weeks; N, number of mice.

Clinical trials

Subjects included 18 male patients who were 35–45 years of age and recruited from the First Affiliated Hospital of the Medical College of Xi’an Jiaotong University. Coronary heart disease (CHD) was diagnosed by the American Heart Association (AHA) 2007 criteria (26). Subjects who were suffering from CHD, hypertension, diabetes, acute or chronic infection, fever, cancer, autoimmune disease, severe liver, kidney or other major organ diseases, had surgery within the last 2 weeks, or were taking anti-inflammatory drugs and/or immune inhibitors during the month preceding the study, were excluded. Informed consent was obtained from all subjects. The study was carried out according to the principles outlined in the Declaration of Helsinki and the study protocol was approved by the Xi’an Jiaotong University Ethics Committee. Peripheral blood mononuclear cells (PBMCs) were separated by density gradient centrifugation with lymphocyte isolation solution (Shanghai Huajing Biotech Co., Shanghai, China) and stored at −80°C.

Detection of lipid and glucose in serum

Serum was separated by the centrifugation of venous blood from mice and patients at 3,000 rpm for 15 min, and total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) levels were measured using assay kits (Dongou Bioengineering, Beijing, China) while glucose levels were measured using an Accu-Chek1 Advantage Glucometer (Roche Diagnostics, Inc., Indianapolis, IN, USA), according to the manufacturer’s instructions. Each sample was examined 3 times.

Chemical and immunohistochemical staining

The root of the aorta was dissected under a microscope and frozen in optimal cutting temperature embedding medium for serial cryosectioning at 6 mm, covering 500 mm of the root. The first section was harvested when the 3 aortic valve cusps became visible in the lumen of the aorta, and every 5th section was harvested on 1 slide (8 sections/slide). Oil Red O staining was used to detect lipids in the plaque and the sections were analyzed using polarization microscopy. Immunohistochemistry was performed with antibodies against SOCS1 (1:100; Abcam, Cambridge, MA, USA) and SOCS3 (1:50; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). Negative controls in the absence of primary antibodies were also used. Section images were captured digitally using an Olympus BX51 imaging system and were quantified with Image-Pro Plus 6.0 software. The cross-sectional surface area of the lesion and total cross-sectional vessel area were also quantified, as previously described (27).

RNA extraction and quantitative PCR

SOCS1 and SOCS3 mRNA expression in the main aorta of the mice and in the PBMCs of patients were determined using quantitative PCR. Total RNA was isolated from the main aorta of the mice and PBMCs of patients with TRIzol reagent (Invitrogen, Carlsbad, CA, USA); the NanoDrop 1000 spectrophotometer (Thermo Scientific) was used to quantify the total RNA. The resulting RNA was reverse transcribed and analyzed by quantitative PCR using the SYBR PrimeScript™ RT-PCR Kit II (Takara Bio, Inc.). All real-time reactions were performed on the iQ5™ Multicolor Real-time PCR detection system (Bio-Rad, Hercules, CA, USA). A three-step PCR procedure of 5 sec at 95°C, 20 sec at 63.5°C and 10 sec at 72°C was applied for 45 cycles. GAPDH was used as a housekeeping gene. The primer sequences are shown in Table I. The data were analyzed using the 2−ΔΔCT method, as previously described (28). Each sample was examined 3 times.

Table I

Primers used for real-time PCR.

Table I

Primers used for real-time PCR.

Gene nameForward (5′-3′)Reverse (5′-3′)NM code
Mouse
 GAPDH TCAACGGCACAGTCAAGG ACTCCACGACATACTCAGCNM_008084.2
 SOCS1 TCCGATTACCGGCGCATCACG CTCCAGCAGCTCGAAAAGGCANM_009896.2
 SOCS3 CACAGCAAGTTTCCCGCCGCC GTGCACCAGCTTGAGTACACANM_007707.2
 IL-6 AGCCAGAGTCCTTCAGAGAGATAC GCTAAGGACCAAGACCATCCAATTNM_031168.1
 TNF-α GCTCTTCTGTCTACTGAACTTCGG CCAGACCCTCACACTCAGATCATNM_013693.2
 TNF-β GCAACATGTGGAACTCTACCAGAA GACGTCAAAAGACAGCCACTCANM_011577.1
Human
 GAPDH AACATCATCCCTGCCTCTACTG CTCCGACGCCTGCTTCACCNM_002046.3
 SOCS1 GCAGCCGACAATGCAGTCT CGAACGGAATGTGCGGAAGTGNM_003745.1
 SOCS3 GCCACCTACTGAACCCTCCTC TCCGACAGAGATGCTGAAGAGTGNM_003955.3

[i] SOCS, suppressor of cytokine signaling; IL-6, interleukin-6; TNF-α, tumor necrosis factor-α.

Western blot analysis

Proteins from the main aorta were extracted by RIPA buffer (Cybrdi, Inc.) according to the manufacturer’s instructions, and a protease inhibitor cocktail (Roche Diagnostics, Inc.) was added to all samples. The BCA protein assay reagent kit (Pierce) was used to quantify the total amount of protein. Equal amounts of protein extracts were separated by 10% SDS-PAGE gel and then transferred onto nitrocellulose membranes using a Bio-Rad transfer blotting system (Bio-Rad). Skim milk of 5% was used for blocking non-specific binding for 1 h at room temperature with slow shaking. The blots were incubated overnight at 4°C with anti-SOCS3 (1:500; Santa Cruz Biotechnology, Inc.), anti-SOCS1 (1:500; Abcam) or anti-GAPDH (1:1,000; Santa Cruz Biotechnology, Inc.). A horseradish peroxidase-conjugated anti-goat (1:10,000; Abcam) or anti-rabbit secondary antibody (1:5,000; Abcam) and enhanced chemiluminescent substrate (Pierce) were used for detection, as previously described (29). Each sample was examined 3 times.

Statistics analysis

Data were expressed as the means ± SD. The Student’s t-test or one-way ANOVA were used to analyze the differences among groups. Post hoc comparisons between groups were performed using the Newman-Keuls multiple comparison test. A value of P<0.05 was considered to indicate a statistically significant difference.

Results

General condition of the experimental animals

After being fed with different diets for 6 weeks, the total serum cholesterol levels of the ApoE−/− mice fed a high-fat diet were significantly higher than those of the mice fed the chow diet (2.52-fold) and the C57Bl/6j mice (31.05-fold) (P<0.01); however, the total serum cholesterol levels did not change significantly with the prolonged feeding time in each group. The TG, HDL-C and LDL-C levels in the serum of the ApoE−/− mice were higher than those in the serum of the C57BL/6j mice (P<0.01); however, the ApoE−/− mice with different dietary interventions showed no significant differences in the aforementioned indexes. Body weight increased significantly in each group with the increased feeding duration. No significant difference in serum glucose levels was observed among the groups (Table II).

Table II

Subject characteristics.

Table II

Subject characteristics.

ApoE−/− mice fed CDApoE−/− mice fed HDC57BL/6j mice fed CD



12 W16 W20 W24 W28 W12 W16 W20 W24 W28 W12 W20 W28 W
N101010871010887666
Male5554455454333
Female5554355433333
BW16.2±0.820.9±1.224.6±1.726.8±1.529.2±1.427.0±1.528.0±1.928.8±1.030.8±1.932.6±3.016.7±0.923.5±1.726.3±1.9
CHO720.2±48.0a726.6±124.0653.9±112.3764.8±56.0622.9±68.1 1813.4±243.5a1936.4±316.42043.5±425.71774.3±326.01947.3±374.658.4±12.563.5±21.760.3±20.7
TG132.5±34.2a173.5±63.2153.6±37.4180.4±47.3147.2±36.9159.3±32.5a170.1±50.3120.8±44.3191.6±37.9128.7±21.764.2±19.759.6±23.563.5±20.4
HDL-C102.7±19.6a127.3±23.5102.5±26.9137.6±36.2117.4±27.5136.5±11.5a146.3±19.5148.9±30.4140.3±19.6150.4±28.070.3±16.789.4±21.585.2±29.4
LDL-C104.2±21.5a132.5±24.3127.3±32.6132.5±29.0127.3±25.3139.0±80.2a156.5±77.5121.3±43.3144.8±66.765.4±27.17.4±2.46.9±3.27.6±3.3
GLU6.7±0.86.3±0.67.2±0.86.7±0.57.0±0.66.8±0.77.5±0.97.8±0.57.2±0.46.9±0.56.3±0.36.4±0.66.1±0.3

{ label (or @symbol) needed for fn[@id='tfn2-ijmm-31-05-1066'] } W, weeks; N, number; BW, body weight (g); CHO, serum cholesterol (mg/dl); TG, serum triglyceride (mg/dl); HDL-C, serum high-density lipoprotein cholesterol (mg/dl); LDL-C, serum low-density lipoprotein cholesterol (mg/dl); GLU, serum glucose (mmol/l); CD, chow diet; HD, high-fat diet.

a P<0.01 vs. C57BL/6j mice at 12 weeks.

Positive Oil Red O staining showed that the atherosclerotic plaque size at the aortic root and lipid deposition in the plaque of the ApoE−/− mice were consistently growing as the feeding duration increased. At 28 weeks, the Oil Red O positive area was 4.33-fold larger than that at 12 weeks in the group fed the chow diet (P<0.05) and 3.62-fold larger in the group fed the high-fat diet (P<0.01). The area of lipid deposit in the atherosclerotic plaque in the group fed the high-fat diet was larger than that in the group fed the chow diet in ApoE−/− mice of the same age (Fig. 2).

Figure 2

Oil Red O (ORO) staining to detected lipid deposit in atherosclerotic plaque in ApoE−/− mice at different time points. (A and B) ORO staining in plaque of ApoE−/− mice fed the chow and high-fat diet; magnification, ×100; bar, 200 μm. (C) ORO staining positive rate in plaque of ApoE−/− mice fed the chow and high-fat diet. The bars represent the means ± SD. W, weeks; CD, chow diet, HD, high-fat diet. *P<0.05 vs. mice fed the chow diet for 12 weeks; #P<0.05 vs. mice fed the high-fat diet for 12 weeks; ##P<0.01 vs. mice fed the high-fat diet for 12 weeks.

Trend in SOCS1 expression in the ApoE−/− mice

The results of immunohistochemical staining revealed that in the group fed the chow diet, SOCS1 expression in the plaque at the aortic root of the ApoE−/−mice showed an increasing trend first (eventually peaking at 24 weeks) and then decreased as the feeding duration increased (P<0.05). The same single peak trend appeared earlier in the group fed the high-fat diet at 20 weeks (P<0.05) (Fig. 3A, B and E). Surprisingly, the results of the real-time PCR and western blot analyses after the extraction of RNA and protein levels showed a similar trend in the expression of SOCS1 in the animals fed the different diets. In the group fed the chow diet, the SOCS1 protein expression level was 11.85-fold higher and the mRNA expression level was 3.68-fold higher at 24 weeks than at 12 weeks (P<0.01) (Fig. 4A and B). In the group fed the high-fat diet, the SOCS1 protein expression level was 4.32-fold higher and the mRNA expression level was 2.02-fold higher at 20 weeks than at 12 weeks (P<0.01) (Fig. 4C).

Figure 3

Immunohistochemistry for the detection of the expression of SOCS1 and SOCS3 in plaque of AopE−/− mice at different time points. (A-D) Expression of SOCS1 and SOCS3 in plaque of ApoE−/− mice fed the chow and high-fat diet; magnification, ×200; bar, 100 μm. (E and F) SOCS1 and SOCS3 positive rate in plaque of ApoE−/− mice fed the chow and high-fat diet. The bars represent the means ± SD. W, weeks; CD, chow diet, HD, high-fat diet. *P<0.05 vs. mice fed the chow diet for 12 weeks; **P<0.01 vs. mice fed the chow diet for 12 weeks; #P<0.05 vs. mice fed the high-fat diet for 12 weeks; ##P<0.01 vs. mice fed the high-fat diet for 12 weeks.

Figure 4

Protein and mRNA expression of SOCS1 and SOCS3 in main aorta of ApoE−/− mice fed the chow and high-fat diet. (A and B) Protein expression of SOCS1 and SOCS3 in the main aorta of ApoE−/− mice fed the chow and high-fat diet. (C) mRNA expression of SOCS1 and SOCS3 in the main aorta of ApoE−/− mice fed the chow and high-fat diet. The bars represent the means ± SD. W, weeks; CD, chow diet, HD, high-fat diet. GAPDH was detected as an internal reference. *P<0.05 vs. mice fed the chow diet for 12 weeks; **P<0.01 vs. mice fed the chow diet for 12 weeks; #P<0.05 vs. mice fed the high-fat diet for 12 weeks; ##P<0.01 vs. mice fed the high-fat diet for 12 weeks.

Upregulation of SOCS3 in the ApoE−/− mice

SOCS1 and SOCS3 belong to the SOCS family of proteins. To confirm whether they have the same expression tendency in ApoE−/− mice, we also detected the SOCS3 mRNA and protein level. Immunohistochemical staining showed that in the groups fed the chow and high-fat diet, the SOCS3-positive areas within the plaque of the ApoE−/− mice were enlarged with the increased feeding duration. The results of the real-time PCR and western blot analyses were consistent with the immunohistochemical results. The expression of SOCS3 mRNA and protein in the aorta of the ApoE−/− mice increased significantly after 20 weeks, regardless of the type of diet, and at 28 weeks, the expression of SOCS3 mRNA had significantly increased (P<0.01) (Figs. 3C, D and F and Fig. 4). At the same time point, the SOCS3 expression level was higher in the group fed the high-fat diet than in the group fed the chow diet. The differential expression of SOCS1 and SOCS3 suggests that they play different roles in atherosclerosis.

Expression levels of SOCS1 and SOCS3 in the aorta of C57Bl/6j mice

ApoE−/− mice are used in classic animal models of atherosclerosis, due to hyperlipidemia. We also used a wild-type control to identify the correlation between blood lipids and inflammatory cytokines. No formation of plaque was found in the aortic root in the C57Bl/6j mice of different ages in the group fed the chow diet (12, 20 and 28 weeks), and Oil Red O staining displayed no lipid deposition (data not shown). Immunohistochemical staining showed that the expression of SOCS1 and SOCS3 at the aortic root of C57Bl/6j mice of different ages was very limited (Fig. 5A). Real-time PCR conducted with RNA extracted from the aorta of C57Bl/6j mice revealed that the SOCS1 and SOCS3 expression level was 22% and 9% in the ApoE−/− mice in the group fed the chow diet at 12 weeks, respectively (P<0.01) (Fig. 5B).

Figure 5

Other information about SOCS expression in mice. (A) Immunol histochemistry was used to detect the positive rate of SOCS1 and SOCS3 in plaque of C57BL/6j mice fed the chow diet; magnification, ×200; bar, 100 μm. (B) mRNA expression of SOCS1 and SOCS3 in the main aorta in 12 week-old-ApoE−/− mice fed the high-fat diet and in C57BL/6j mice. CD, chow diet; HD, high-fat diet. (C) The positive rate of SOCS/CD68 in plaque of ApoE−/− mice fed the high-fat diet. *P<0.05 vs. mice fed the chow diet for 12 weeks; **P<0.01 vs. mice fed the chow diet for 12 weeks (SOCS1); #P<0.05 vs. mice fed the chow diet for 12 weeks; ##P<0.01 vs. mice fed the chow diet for 12 weeks (SOCS3). (D and E) TNF-α and IL-6 mRNA expression in main aorta of ApoE−/− mice the high-fat diet. *P<0.05 vs. mice fed the high-fat duet for 12 weeks; **P<0.01 vs. mice fed the high-fat duet for 12 weeks. The bars represent the means ± SD. W, weeks.

SOCS1/CD68 and SOCS3/CD68 show opposite trends in expression with the increasing feeding duration of the high-fat diet

As SOCS proteins are expressed in several cell types but mainly in macrophages, which induce the majority of inflammatory cytokines in disease, we detected the ratio of SOCS1/3 and macrophages (CD68) to clarify the contribution of macrophages in disease progression. According to the immunohistochemical staining results of the ApoE−/− mice fed the high-fat diet, the CD68-positive area in the aortic root plaque increased in size as the feeding period increased, and the ratio of the SOCS1/CD68 stained areas decreased gradually over time (from 0.68±0.32 at 12 weeks to 0.39±0.21 at 28 weeks, P<0.05). The ratio of the stained area of SOCS3/CD68 showed an inverse trend as compared to SOCS1 (0.56±0.32 at 12 weeks to 0.73±0.42 at 28 weeks, P<0.05) (Fig. 5C). These results suggest that SOCS1 and SOCS3 play different roles in disease progression.

Expression of inflammatory cytokines in vascular tissue of ApoE−/− mice

It is well known that SOCS protein expression correlates with the expression of inflammatory cytokines. To confirm whether a correlation exists between SOCS3 and IL-6 expression in atherosclerosis, as shown in other diseases, we detected the expression levels of a number of inflammatory cytokines. As the high-fat diet feeding duration increased, the expression levels of IL-6 mRNA in the aorta of the ApoE−/− mice increased continuously (the expression levels at 28 weeks were 40.64-fold higher than those at 12 weeks), whereas no change in the mRNA expression of TNF-α was observed (Fig. 5D and E).

Positive correlation between total serum cholesterol levels and SOCS3 mRNA expression in PBMCs of the non-CHD population

To confirm our above results, we also investigated the correlation between SOCS expression and cholesterol levels in humans. In the PBMCs of the non-CHD population (n=18, males, 35–45 years of age), a positive correlation was observed between the total serum cholesterol levels and SOCS3 mRNA expression (r=0.433, P=0.012) (Fig. 6). However, no correlation was observed between the total serum cholesterol levels and the expression of SOCS1 mRNA in the PBMCs (r=0.061, P=0.45). Further analysis revealed no correlation between the expression of SOCS1 and SOCS3 mRNA, age, body mass index (BMI) and other factors (P>0.05) (data not shown).

Figure 6

The correlation between total serum cholesterol (CHO) levels and SOCS3 mRNA in peripheral blood mononuclear cells (PBMCs) from the non-coronary heart disease (CHD) population.

Discussion

In the present study, we investigated SOCS1 and SOCS3 expression in ApoE−/− mice exposed to high levels of cholesterol for increasing periods of time. SOCS1 expression showed a single peak change, whereas SOCS3 expression showed a continuous increase. In the animals exposed to different levels of cholesterol, high cholesterol levels increased SOCS1 and SOCS3 expression in ApoE−/− mice of the same age but had no effect on the respective change oinf SOCS1 and SOCS3 expression with the increased feeding duration. IL-6 expression in the aortas of the ApoE−/− mice increased with the increase in SOCS3 expression. In addition, SOCS3 mRNA expression positively correlated with cholesterol levels in the non-CHD population. In conclusion, SOCS1 and SOCS3 expression differ in ApoE−/− mice with the progression of the disease and SOCS3 may play a pro-atherosclerotic role.

In this study, the trend in SOCS1 and SOCS3 expression, which was similar to that shown in the study by Tang et al (30), demonstrated that although these 2 proteins belong to the SOCS family, they play opposing roles in the initiation and development of atherosclerosis. According to previous studies, the existence of the SH2 domain in the SOCS protein family may compete with JAK to bind STAT, thus inhibiting the phosphorylation of STAT and subsequent inflammatory response (31). As a result, studies on the SOCS protein family have focused on inflammatory disease or a variety of inflammatory pathways (32). Previous studies have demonstrated a consistent view on the role of SOCS1 (33), which has been shown to inhibit the progression of inflammatory disease. However, the role of SOCS3 remains controversial, as described in the Introduction. The trend in the expression of SOCS1 which exerts an anti-inflammation effect was consistent with that of pathophysiological processes. Although the role of SOCS3 in atherosclerosis remains controversial, the results of this study revealed that SOCS3 may play the following roles in atherosclerosis: i) SOCS3 may exert a pro-inflammatory effect, which is consistent with the progression of the disease; its expression increased with increasing cholesterol levels and the prolonged feeding duration; ii) SOCS3 may play multiple roles in atherosclerosis and other inflammatory diseases; in various types of inflammatory diseases, the reflected net effect may differ or involve a more complex mechanism of immune regulation; thus, its role cannot simply be explained as a balance of anti-inflammation and pro-inflammation; iii) SOCS3 is expressed during the late stages of atherosclerotic lesions, indicating that it plays an important role in the late stages of the disease and may play a crucial role in maintaining plaque stability, which requires further validation studies; and iv) SOCS3 expression may be subjected to the regulation of other inflammatory factors during the progression of atherosclerosis. When the pro-inflammatory/anti-inflammatory balance tilted in favor of pro-inflammation, the expression of SOCS3 also increased. In the long process of the onset and development of human atherosclerosis, immune-inflammatory mechanisms play an important role, and both pro-inflammatory and anti-inflammatory factors are present in this complex network (34). Overall, SOCS proteins ultimately inhibit the progression of inflammation by inhibiting the phosphorylation of STAT, and the JAK/STAT pathway influences the progression of atherosclerosis. Based on the results obtained in this study, we hypothesized that SOCS1 and SOCS3, through changes in their expression, affect the downstream signaling pathway, thus influencing the development of atherosclerosis. Upon exposure to high cholesterol levels, these 2 factors show differential expression patterns, suggesting that during the development of atherosclerosis, SOCS1 and SOCS3 may play different roles in addition to the common mechanisms of SOCS proteins (i.e., SOCS1 has a clear anti-inflammatory effect while SOCS3 may play a pro-inflammatory role).

The SOCS protein family is mainly expressed in activated macrophages (3), and under the induction of high cholesterol, the number of macrophages in the atherosclerotic plaque of ApoE−/− mice continuously increased. Descriptive studies on cholesterol and SOCS expression in disease are limited. During the prolonged high cholesterol exposure in our study, the differential expression of SOCS1 and SOCS3 was independent of the changes in the number of macrophages. The expression of anti-inflammatory SOCS1 per macrophage decreased with the increase in the exposure time to high cholesterol levels, while an opposite trend was observed with SOCS3. The difference in the expression trends of these 2 proteins further suggests that the 2 proteins play different roles in the occurrence and development of atherosclerosis. If these 2 factors antagonize each other, then the expression of SOCS1, with anti-inflammatory effects, would gradually decrease, while that of SOCS3, which may have pro-inflammatory effects, would steadily increase in line with the accelerated disease process. These different trends were mainly observed in the differential expression patterns of these 2 proteins in plaque.

In the C57Bl/6j mice of the control group, the expression of SOCS1 and SOCS3 in the aorta remained low, and no plaque was generated, regardless of the age of the mice. In the ApoE−/− mice, even when those fed a normal diet, the total serum cholesterol level was 10-fold higher than that in the C57Bl/6j mice; when the ApoE−/− mice were fed the high-fat diet, their plasma cholesterol level increased by >29-fold compared to the C57Bl/6j mice. This indicates that high cholesterol is not only an important factor leading to the generation of atherosclerotic plaque, but also an important condition that induces the expression of SOCS1 and SOCS3 proteins. This also indicates that the changes in SOCS1 and SOCS3 expression over time are related to the exposure to a high-fat diet as opposed to age. Hypercholesterolemia plays a crucial role in the occurrence and development of atherosclerosis, promotes subintimal lipid deposition, and this metabolic disorder also contributes to immune-inflammatory response changes in the body. The change in the metabolic level, represented by high levels of cholesterol, affects a variety of cytokines and chemotactic proteins that are involved in the inflammatory response and alters the inflammatory network equilibrium, which affects the speed of subendocardial lipid deposition through the inflammatory cascade reaction. SOCS1 and SOCS3 are one link in the aforementioned inflammatory network, through which a high-fat diet can affect the progress of disease development; therefore, it is important to clarify the role of SOCS proteins in atherosclerosis. In addition, in non-CHD human populations, we observed that SOCS3 mRNA expression in PBMCs positively correlated with total serum cholesterol levels, which further suggests that a high-fat diet is an important factor in the induction of SOCS3 protein expression. With the increase in cholesterol levels, the expression of SOCS3 also increased. In the circulation, SOCS3 mRNA could only be observed in the PBMCs when the cholesterol reached a certain level (~100 mg/dl). We can therefore hypothesize that the SOCS3 protein, as a pro-inflammatory cytokine, may mediate inflammatory activation in response to high cholesterol levels; that is, high cholesterol plays a role in pro-inflammation by stimulating SOCS3 expression. This theory has never been mentioned in previous studies. There was no correlation observed between SOCS1, cholesterol and TG in our human study population, which was consistent with our findings in the animal experiments; the effect of a high-fat diet on SOCS1 expression cannot be summarized using a single linear correlation.

When analyzing mouse aortic RNA, we found that the mRNA expression levels of IL-6 but not those of TNF-α significantly increased when the mice were exposed to high cholesterol levels. The expression of IL-6, a pro-inflammatory cytokine thought to be most closely associated with chronic inflammation caused by metabolic abnormalities, was increased continuously with prolonged exposure to high cholesterol. This change in the expression levels of this indicator suggests that as the effect of hypercholesterolemia accumulated, vascular inflammation also increased. Together with our observation of SOCS3, this suggests that the SOCS3 protein in ApoE−/− mice with atherosclerosis may be regulated by the induction of IL-6 in the disease. Li et al (35) found that free cholesterol-loaded mouse peritoneal macrophages are an abundant resource of TNF-α and IL-6. In addition, Frisdal et al (36) showed that lipid loading in human macrophages was accompanied by a strong increase of IL-6 secretion, followed by the activation of the JAK2/STAT3 signaling pathway by IL-6 to reduce lipid accumulation. Taking into account our results, as well as those of the above studies, we hypothesized that the high level of cholesterol increased IL-6 expression, subsequently activating JAK2/STAT3. In addition, SOCS3, as a classic negative regulator of JAK2/STAT3, was upregulated with the progression of inflammation aggravated by hyperlipidemia.

By examining the changes in aortic SOCS1 and SOCS3 expression in ApoE−/− mouse models exposed to high cholesterol for different lengths of time, this study observed the differential expression patterns of SOCS1 and SOCS3 in plaque. These results suggest that SOCS1 and SOCS3 play different roles in the development of atherosclerosis in ApoE−/− mice. SOCS3 induced by IL-6 upregulated during hyperlipidemia, may promote the development of atherosclerosis. It is of great importance that we clarify the specific mechanisms of action of SOCS proteins in atherosclerosis.

Acknowledgements

This study was supported by the Natural Science Foundation of China (30570732 and 30871043 to Z.Y. and 30700320 to Y.L.), the National Science Fund for Distinguished Young Scholars (81025002 to Z.Y.).

References

1 

Ross R: Atherosclerosis - an inflammatory disease. N Engl J Med. 340:115–126. 1999. View Article : Google Scholar

2 

Tedgui A and Mallat Z: Cytokines in atherosclerosis: pathogenic and regulatory pathways. Physiol Rev. 86:515–581. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Ortiz-Munoz G, Martin-Ventura JL, Hernandez-Vargas P, et al: Suppressors of cytokine signaling modulate JAK/STAT-mediated cell responses during atherosclerosis. Arterioscler Thromb Vasc Biol. 29:525–531. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Yan C, Cao J, Wu M, et al: Suppressor of cytokine signaling 3 inhibits LPS-induced IL-6 expression in osteoblasts by suppressing CCAAT/enhancer-binding protein {beta} activity. J Biol Chem. 285:37227–37239. 2010.PubMed/NCBI

5 

Albanesi C, Fairchild HR, Madonna S, et al: IL-4 and IL-13 negatively regulate TNF-alpha- and IFN-gamma-induced beta-defensin expression through STAT-6, suppressor of cytokine signaling (SOCS)-1, and SOCS-3. J Immunol. 179:984–992. 2007. View Article : Google Scholar

6 

Alexander WS and Hilton DJ: The role of suppressors of cytokine signaling (SOCS) proteins in regulation of the immune response. Annu Rev Immunol. 22:503–529. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Yoshimura A, Naka T and Kubo M: SOCS proteins, cytokine signalling and immune regulation. Nat Rev Immunol. 7:454–465. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Davey GM, Heath WR and Starr R: SOCS1: a potent and multifaceted regulator of cytokines and cell-mediated inflammation. Tissue Antigens. 67:1–9. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Egan PJ, Lawlor KE, Alexander WS and Wicks IP: Suppressor of cytokine signaling-1 regulates acute inflammatory arthritis and T cell activation. J Clin Invest. 111:915–924. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Metcalf D, Di Rago L, Mifsud S, et al: The development of fatal myocarditis and polymyositis in mice heterozygous for IFN-gamma and lacking the SOCS-1 gene. Proc Natl Acad Sci USA. 97:9174–9179. 2000. View Article : Google Scholar : PubMed/NCBI

11 

Ilangumaran S, Ramanathan S and Rottapel R: Regulation of the immune system by SOCS family adaptor proteins. Semin Immunol. 16:351–365. 2004. View Article : Google Scholar : PubMed/NCBI

12 

Jo D, Liu D, Yao S, et al: Intracellular protein therapy with SOCS3 inhibits inflammation and apoptosis. Nat Med. 11:892–898. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Li Y, Chu N, Rostami A and Zhang GX: Dendritic cells transduced with SOCS-3 exhibit a tolerogenic/DC2 phenotype that directs type 2 Th cell differentiation in vitro and in vivo. J Immunol. 177:1679–1688. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Matsumura Y, Kobayashi T, Ichiyama K, et al: Selective expansion of foxp3-positive regulatory T cells and immunosuppression by suppressors of cytokine signaling 3-deficient dendritic cells. J Immunol. 179:2170–2179. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Liu Y, Stewart KN, Bishop E, et al: Unique expression of suppressor of cytokine signaling 3 is essential for classical macrophage activation in rodents in vitro and in vivo. J Immunol. 180:6270–6278. 2008. View Article : Google Scholar : PubMed/NCBI

16 

O’Keefe GM, Nguyen VT, Ping Tang LL and Benveniste EN: IFN-gamma regulation of class II transactivator promoter IV in macrophages and microglia: involvement of the suppressors of cytokine signaling-1 protein. J Immunol. 166:2260–2269. 2001.

17 

Croker BA, Krebs DL, Zhang JG, et al: SOCS3 negatively regulates IL-6 signaling in vivo. Nat Immunol. 4:540–545. 2003. View Article : Google Scholar : PubMed/NCBI

18 

Yoshimura A, Suzuki M, Sakaguchi R, et al: SOCS, inflammation, and autoimmunity. Front Immunol. 3:202012. View Article : Google Scholar

19 

Wormald S and Hilton DJ: Inhibitors of cytokine signal transduction. J Biol Chem. 279:821–824. 2004. View Article : Google Scholar : PubMed/NCBI

20 

Brown MS and Goldstein JL: Lipoprotein metabolism in the macrophage: implications for cholesterol deposition in atherosclerosis. Annu Rev Biochem. 52:223–261. 1983. View Article : Google Scholar : PubMed/NCBI

21 

Gower RM, Wu H, Foster GA, et al: CD11c/CD18 expression is upregulated on blood monocytes during hypertriglyceridemia and enhances adhesion to vascular cell adhesion molecule-1. Arterioscler Thromb Vasc Biol. 31:160–166. 2011. View Article : Google Scholar

22 

Gokalp D, Tuzcu A, Bahceci M, et al: Levels of proinflammatory cytokines and hs-CRP in patients with homozygous familial hypercholesterolaemia. Acta Cardiol. 64:603–609. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Sima AV, Stancu CS and Simionescu M: Vascular endothelium in atherosclerosis. Cell Tissue Res. 335:191–203. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Steinberg D: Atherogenesis in perspective: hypercholesterolemia and inflammation as partners in crime. Nat Med. 8:1211–1217. 2002. View Article : Google Scholar : PubMed/NCBI

25 

Tian Y, Yuan Z, Liu Y, et al: Pioglitazone modulates the balance of effector and regulatory T cells in apolipoprotein E deficient mice. Nutr Metab Cardiovasc Dis. 21:25–32. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Anderson JL, Adams CD, Antman EM, et al: ACC/AHA 2007 guidelines for the management of patients with unstable angina/non-ST-Elevation myocardial infarction: a report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines (Writing Committee to Revise the 2002 Guidelines for the Management of Patients With Unstable Angina/Non-ST-Elevation Myocardial Infarction) developed in collaboration with the American College of Emergency Physicians, the Society for Cardiovascular Angiography and Interventions, and the Society of Thoracic Surgeons endorsed by the American Association of Cardiovascular and Pulmonary Rehabilitation and the Society for Academic Emergency Medicine. J Am Coll Cardiol. 50:e1–e157. 2007.

27 

Zhao Y, Yuan Z, Liu Y, et al: Activation of cannabinoid CB2 receptor ameliorates atherosclerosis associated with suppression of adhesion molecules. J Cardiovasc Pharmacol. 55:292–298. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Xue JH, Yuan Z, Wu Y, et al: High glucose promotes intracellular lipid accumulation in vascular smooth muscle cells by impairing cholesterol influx and efflux balance. Cardiovasc Res. 86:141–150. 2010. View Article : Google Scholar

29 

He L, He M, Lv X, et al: NF-kappaB binding activity and pro-inflammatory cytokines expression correlate with body mass index but not glycosylated hemoglobin in Chinese population. Diabetes Res Clin Pract. 90:73–80. 2010. View Article : Google Scholar

30 

Tang J, Kozaki K, Farr AG, et al: The absence of platelet-derived growth factor-B in circulating cells promotes immune and inflammatory responses in atherosclerosis-prone ApoE−/− mice. Am J Pathol. 167:901–912. 2005. View Article : Google Scholar

31 

Endo TA, Masuhara M, Yokouchi M, et al: A new protein containing an SH2 domain that inhibits JAK kinases. Nature. 387:921–924. 1997. View Article : Google Scholar : PubMed/NCBI

32 

Park SJ, Oh EJ, Yoo MA and Lee SH: Involvement of DNA-dependent protein kinase in regulation of stress-induced JNK activation. DNA Cell Biol. 20:637–645. 2001. View Article : Google Scholar : PubMed/NCBI

33 

Kinjyo I, Hanada T, Inagaki-Ohara K, et al: SOCS1/JAB is a negative regulator of LPS-induced macrophage activation. Immunity. 17:583–591. 2002. View Article : Google Scholar : PubMed/NCBI

34 

Libby P, Ridker PM and Hansson GK: Inflammation in atherosclerosis: from pathophysiology to practice. J Am Coll Cardiol. 54:2129–2138. 2009. View Article : Google Scholar : PubMed/NCBI

35 

Li Y, Schwabe RF, DeVries-Seimon T, et al: Free cholesterol-loaded macrophages are an abundant source of tumor necrosis factor-alpha and interleukin-6: model of NF-kappaB- and map kinase-dependent inflammation in advanced atherosclerosis. J Biol Chem. 280:21763–21772. 2005.

36 

Frisdal E, Lesnik P, Olivier M, et al: Interleukin-6 protects human macrophages from cellular cholesterol accumulation and attenuates the proinflammatory response. J Biol Chem. 286:30926–30936. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liang X, He M, Chen T, Liu Y, Tian Y, Wu Y, Zhao Y, Shen Y and Yuan Z: Multiple roles of SOCS proteins: Differential expression of SOCS1 and SOCS3 in atherosclerosis. Int J Mol Med 31: 1066-1074, 2013.
APA
Liang, X., He, M., Chen, T., Liu, Y., Tian, Y., Wu, Y. ... Yuan, Z. (2013). Multiple roles of SOCS proteins: Differential expression of SOCS1 and SOCS3 in atherosclerosis. International Journal of Molecular Medicine, 31, 1066-1074. https://doi.org/10.3892/ijmm.2013.1323
MLA
Liang, X., He, M., Chen, T., Liu, Y., Tian, Y., Wu, Y., Zhao, Y., Shen, Y., Yuan, Z."Multiple roles of SOCS proteins: Differential expression of SOCS1 and SOCS3 in atherosclerosis". International Journal of Molecular Medicine 31.5 (2013): 1066-1074.
Chicago
Liang, X., He, M., Chen, T., Liu, Y., Tian, Y., Wu, Y., Zhao, Y., Shen, Y., Yuan, Z."Multiple roles of SOCS proteins: Differential expression of SOCS1 and SOCS3 in atherosclerosis". International Journal of Molecular Medicine 31, no. 5 (2013): 1066-1074. https://doi.org/10.3892/ijmm.2013.1323
Copy and paste a formatted citation
x
Spandidos Publications style
Liang X, He M, Chen T, Liu Y, Tian Y, Wu Y, Zhao Y, Shen Y and Yuan Z: Multiple roles of SOCS proteins: Differential expression of SOCS1 and SOCS3 in atherosclerosis. Int J Mol Med 31: 1066-1074, 2013.
APA
Liang, X., He, M., Chen, T., Liu, Y., Tian, Y., Wu, Y. ... Yuan, Z. (2013). Multiple roles of SOCS proteins: Differential expression of SOCS1 and SOCS3 in atherosclerosis. International Journal of Molecular Medicine, 31, 1066-1074. https://doi.org/10.3892/ijmm.2013.1323
MLA
Liang, X., He, M., Chen, T., Liu, Y., Tian, Y., Wu, Y., Zhao, Y., Shen, Y., Yuan, Z."Multiple roles of SOCS proteins: Differential expression of SOCS1 and SOCS3 in atherosclerosis". International Journal of Molecular Medicine 31.5 (2013): 1066-1074.
Chicago
Liang, X., He, M., Chen, T., Liu, Y., Tian, Y., Wu, Y., Zhao, Y., Shen, Y., Yuan, Z."Multiple roles of SOCS proteins: Differential expression of SOCS1 and SOCS3 in atherosclerosis". International Journal of Molecular Medicine 31, no. 5 (2013): 1066-1074. https://doi.org/10.3892/ijmm.2013.1323
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team