Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
May 2013 Volume 31 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May 2013 Volume 31 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Expression and localisation of osteopontin and prominin-1 (CD133) in patients with endometriosis

  • Authors:
    • Fabio D'Amico
    • Evangelia Skarmoutsou
    • Giuseppe Quaderno
    • Grazia Malaponte
    • Carmelo La Corte
    • Giuseppe Scibilia
    • Gabriella D'Agate
    • Paolo Scollo
    • Filippo Fraggetta
    • Demetrios A. Spandidos
    • Maria Clorinda Mazzarino
  • View Affiliations / Copyright

    Affiliations: Department of Biomedical Sciences, Pathology and Oncology Unit, University of Catania, Catania, Italy, Pathology Unit, Cannizzaro Hospital, Catania, Italy, Department of Obstetrics and Gynecology, Cannizzaro Hospital, Catania, Italy, Laboratory of Clinical Virology, Faculty of Medicine, University of Crete, Heraklion, Crete, Greece
    Copyright: © D'Amico et al. This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY_NC 3.0].
  • Pages: 1011-1016
    |
    Published online on: March 28, 2013
       https://doi.org/10.3892/ijmm.2013.1325
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

In this study, we investigated the expression and localisation of the proteins, osteopontin (OPN) and prominin-1 (CD133), as well as the plasma OPN levels in the endometrium of patients with endometriosis. Samples of ectopic endometriotic lesions and normal endometrium were obtained from 31 women with endometriosis and 28 healthy control subjects. The mRNA and protein expression of OPN and CD133 was analysed by real‑time RT-PCR and immunohistochemistry. The plasma levels of OPN were determined by ELISA. Our results revealed that OPN mRNA and protein expression, as well as its release in the blood, was significantly increased in the endometriotic lesions in comparison to normal tissue. Although the presence of CD133+ cells was detected in the normal endometrium, as well as in the endometriosis specimens, a significant quantitative variation of this protein was not demonstrated in the patients with endometriosis. In conclusion, our data indicate that OPN is involved in the development of endometriosis by enhancing the invasiveness, proliferation and survival of endometrial cells in ectopic lesions. CD133 cannot be used as a disease marker for endometriosis, although an involvement of this protein in the pathogenesis of endometriosis cannot be excluded.

Introduction

Endometriosis is a complex and chronic gynecological disorder characterised by the presence of endometrial tissue outside the uterus (1). Genetic, hormonal and environmental factors contribute to the susceptibility to endometriosis; however, the pathogenesis of this disease has not yet been fully elucidated.

Although endometriotic cells are not characterised by uncontrolled proliferation, they show some properties of malignant tissues, such as invasion, induction of metastasis, and the ability to evade apoptosis (2,3). In particular, it is known that the ability of endometriotic cells to invade surrounding tissue is induced by a group of proteins termed metastasis-inducing proteins (MIPs), such as osteopontin (OPN) (4).

OPN, a 70-kDa secreted glycoprotein, is mainly involved in cell adhesion and migration (5), and it has been found to be expressed in endometrial epithelium in normally cycling fertile women (6). However, various studies on the endometrial expression of OPN in patients with endometriosis have provided controversial results. A previous study demonstrated that the OPN protein is densely expressed in eutopic normal endometrium, as well as in epithelial cells of endometriotic cysts (7). Moreover, OPN mRNA expression, as well as its plasma levels, have been shown to be higher in patients with endometriosis compared to normal subjects (8). It has been reported that OPN mRNA levels are reduced during the early secretory phase of women with moderate-to-severe endometriosis (9,10).

Another feature of endometriosis is represented by its stem cell origin (11). It has been hypothesised that endometriosis may be caused by a dysregulation of stem cell function (12).

Prominin-1 (CD133), a stem cell-associated antigen, is a 120-kDa glycoprotein, and a member of the prominin family of pentaspan membrane proteins (13). CD133 has been shown to be localised in glandular and luminal epithelial cells of the normal endometrium (14).

The spreading of endometrial epithelial progenitor cells may represent one of the mechanisms involved in the pathogenesis of endometriosis, a disease characterised by a dense vascularisation of its lesions (15). It is known that OPN may influence the angiogenesis, proliferation and migration of endothelial progenitor cells, acting as a regulator of CD133+ progenitor cells (16,17).

The present study aimed to determine whether OPN and CD133 expression is altered in the human ectopic endometrium, and whether the expression of these two molecules correlates with the clinical features of endometriosis. The expression profiles of OPN and CD133 were analysed in ectopic lesions, as well as in normal endometrium by real-time RT-PCR and immunohistochemistry. Furthermore, we also evaluated the plasma levels of OPN in patients with endometriosis.

Materials and methods

Patient selection

Sixty-one women were enrolled in this study after providing written informed consent. Thirty-one patients underwent laparoscopic surgery at the Department of Obstetrics and Gynecology, Cannizzaro Hospital, Catania, Italy. As control subjects, 30 women with benign non-endometriotic ovarian cysts were enrolled in this study. Clinical data including, age, history of pregnancy, parity, body mass index (BMI) and serum CA125 levels were collected at surgery. Endometriosis was confirmed by a histopathological examination of samples and the extent of the disease was evaluated according to the revised classification of endometriosis provided by the American Society of Reproductive Medicine (18). Twenty-two cases were classified as minimal-to-mild disease (stage I and II) and 9 cases were classified as moderate-to-severe disease (stage III and IV). All the patients were in the proliferative phase of the menstrual cycle. The study protocol was approved by the local ethics committee.

RNA extraction and real-time RT-PCR

Fresh endometrial specimens were immediately transferred in RNAlater™ (Sigma-Aldrich, St. Louis, MO, USA) and stored at −80°C until RNA extraction. Tissue specimens were pulverised and then dissolved in TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according the manufacturer’s instructions. The concentration of the purified RNA was determined by spectrophotometry. For further analysis, equal RNA loading and integrity was confirmed by showing consistent intensities of 28S and 18S rRNA bands on RNase-free agarose gel electrophoresis. A total of 2 μg of RNA from each sample was reverse transcribed into cDNA using the SuperScript III First-Strand Synthesis System (Invitrogen) according to the manufacturer’s instructions. mRNA expression was measured by SYBR-Green quantitative real-time RT-PCR using the Rotor-Gene Q thermal cycler (Qiagen, Valencia, CA, USA). The primers used for PCR amplification were: CD133 forward, TTTCAAGGACTTGCG AACTCTCTT and reverse, GAACAGGGATGATGTTGGG TCTCA (167 bp); OPN forward, AGACCTGACATCC AGTACCCTG and reverse, GTGGGTTTCAGCACTCTGGT (188 bp). The PCR reaction was carried out in 25 μl buffer, containing 50 ng cDNA, 1 μM of each primer and 12.5 μl 2X Rotor-Gene SYBR-Green PCR Master Mix (Qiagen). The thermal cycling conditions were as follows: denaturation at 95°C for 5 min, followed by 40 cycles of denaturation for 10 sec at 95°C and annealing and extension for 15 sec at 60°C. As the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GADPH; QuantiTect Primer assay, Qiagen) was amplified in order to normalise the amount of total RNA present in each reaction. The quantification of the transcripts was carried out utilizing the dComparative QuantitationT software supplied with Rotor-Gene Q. Endometrial tissue from a normal subject was used as calibrator, and the mean efficiency of the take-off point of the cycling curves was used to calculate the fold change according to the formula: fold change= efficiencyCt1–Ct2, where Ct1 and Ct2 are the take-off values of the cycling curves being compared. Each real-time RT-PCR reaction was conducted in duplicate, in order to evaluate data reproducibility. The results are expressed as means ± SEM and the Student’s t-test was used to compare the means of two samples. Significance was accepted at the 5% level.

Plasma OPN measurement

Peripheral blood samples were collected from patients with endometriosis and control subjects by venous puncture, and immediately centrifuged at 1,500 × g at +4°C for 10 min. Plasma was stored at −80°C until analysis. Plasma OPN levels were measured using the commercially available Quantikine™ Human Osteopontin ELISA kit (R&D Systems, Minneapolis, MN, USA), according to the manufacturer’s instructions. Samples were run in duplicate, and the results are expressed in ng/ml. Data are presented as the means ± SEM. The Student’s t-test was used to compare the means of two samples. Significance was accepted at the 5% level.

Immunohistochemical analysis

Five-micrometer-thick paraffin-embedded sections were mounted on silanized slides. Following section deparaffinization and rehydration through a graded ethanol series at room temperature, antigen retrieval was performed in Tris-EDTA buffer (pH 9.0, 30 min) and in citrate buffer (pH 6.0, 20 min, 20 min) for OPN and CD133 immunostaining, respectively. As primary antibodies, rabbit polyclonal anti-OPN, diluted 1:1,000 (AB1870; Chemicon, Temecula, CA, USA) and anti-prominin-1, diluted 1:200 (PAB12663; Abnova, Taipei, Taiwan) were used. All the immunohistochemical steps were carried out by the fully automated Menarini Bond™ autostainer (Menarini Diagnostics, Florence, Italy). For the controls, the primary antibody was substituted with non-immune serum and the primary antibody was omitted, thus incubating the slides only with buffer. For the evaluation of immunoreactivity, staining intensities were scored on the basis of the percentage of positive cells for OPN and CD133 as follows: −, <5%; +, 5–50%; and ++, >50%. Immunohistochemical semiquantitative analysis was performed by comparing the results using the χ2 test. A p-value <0.05 was considered to indicate a statistically significant difference.

Results

Clinical and demographic features of patients with endometriosis and control subjects

Table I displays the demographic and clinical characteristics of the patients and the control subjects. The mean age of the patients affected by endometriosis and the controls was 36.45 years (SD ±9.18) and 33.77 years (SD ±8.09), respectively. The mean number of pregnancies, as well as the parity was not statistically significant between the patients and the healthy control subjects. The difference in BMI between the patients and control groups was not significant. Finally, serum CA125 levels were higher in the patients in comparison to the controls: 59.44±45.56 vs. 19.37±21.97 IU/ml, respectively (p=0.0001).

Table I

Demographic and clinical characteristics of the patients with endometriosis and the control subjects.

Table I

Demographic and clinical characteristics of the patients with endometriosis and the control subjects.

CharacteristicsControl subjects (n=30)Patients with endometriosis (n=31)P-value
Age, years33.77±8.0936.45±9.180.25
Number of pregnancies0.74±1.020.93±1.390.56
Parity0.59±0.890.86±1.270.36
Serum CA125 levels (IU/ml)19.37±21.9759.44±45.560.0001
BMI m2/kg24.51±2.5323.32±7.560.44

[i] Values are expressed as the means ± SD. The Student’s t-test was used for statistical comparisons between 2 groups. BMI, body mass index.

mRNA expression of OPN and CD133

The mRNA expression of OPN and CD133 in the control and ectopic endometrial tissues was examined by quantitative real-time RT-PCR. As shown in Fig. 1A, OPN mRNA expression was significantly higher in the patients with endometriosis compared to the controls: (3.79±1.30-fold increase vs. control subjects, p<0.010). A comparison of CD133 mRNA expression between the patients with endometriosis and the controls did not reveal any significant difference (Fig. 1B). A comparison of the OPN mRNA levels between the patients with stage I-II disease and those with stage III-IV disease did not reveal any significant difference (p=0.24) (data not shown).

Figure 1

Real-time RT-PCR analysis of osteopontin (OPN) and CD133 mRNA expression in the ectopic (endometriotic) and eutopic (control) endometrium. (A) OPN mRNA expression was significantly higher in patients with endometriosis in comparison to the control subjects. (B) Although CD133 expression was slightly higher in the patients with endometriosis in comparison to the control subjects, the difference was not statistically significant (*p<0.01).

Plasma OPN levels

As shown in Fig. 2, plasma OPN levels (means ± SEM) were higher in patients with endometriosis in comparison to the controls (602.3±125.7 vs. 375.1±53.2 ng/ml; p<0.01). A comparison of the OPN plasma levels between the patients with stage I-II disease and those with stage III-IV disease and the control group revealed similar results to those obtained between the total number of patients and the control group. Finally, a comparison of the plasma OPN levels between the patients with stage I-II disease and those with stage III-IV disease revealed no significant difference (data not shown). We analysed the correlation between plasma OPN and serum CA125 levels. A positive correlation between plasma OPN and serum CA125 levels was observed in the total number of endometriosis patients (Pearson’s test, r=0.41, p<0.05). However, a comparison between the 2 groups of patients (those with stage I-II and stage III-IV disease) did not reveal any statistically significant difference.

Figure 2

Plasma osteopontin levels in women with endometriosis and control subjects. The mean plasma osteopontin levels were higher in the patients with endometriosis compared to the control group (*p<0.01).

OPN and CD133 immunohistochemical analysis

In control sections, OPN immunostaining was localised in the cytoplasm of epithelial cells of the functional layer. Stromal cells were devoid of immunostaining for OPN (Fig. 3a). In the endometriotic tissue, OPN expression was higher in comparison to the control samples, and was localised in the cytoplasm of epithelial gland cells, as well as in several stromal macrophages (Fig. 3b). CD133 immunostaining in the control samples was exclusively localised on the surface of the epithelial cells lining the lumen of the functional layer (Fig. 3c). No immunostaining for CD133 was observed in the stroma. In the endometriotic lesion tissue, the immunohistochemical pattern for CD133 was similar to that observed in the control tissue (Fig. 3d). The results of the analysis of the intensity of the immunohistochemical reactions for OPN and CD133 are summarised in Table II.

Figure 3

Representative micrographs of immunohistochemistry of osteopontin (OPN) and CD133 expression in the eutopic normal endometrium and endometriotic lesions. (a) In normal tissue, OPN was exclusively immunolocalised in the cytoplasm of epithelium of the functional layer. (b) In endometriotic tissue (stage III-IV), OPN expression was higher in comparison to the control samples, and its localisation was restricted to the cytoplasm of epithelial gland cells, as well as to the macrophages in the stroma. (c) In the control tissue, the surface of epithelial cells lining the lumen was immunostained for CD133. (d) The immunohistochemical pattern for CD133 in endometriotic tissue (stage III-IV) was similar to that obtained in control tissue (bars: a, 80; b, 80; c, 90; and d, 80 μm).

Table II

Evaluation of immunostaining intensity of OPN and CD133 in normal tissue and endometriotic lesions.

Table II

Evaluation of immunostaining intensity of OPN and CD133 in normal tissue and endometriotic lesions.

Staining intensity

OPNCD133


n−+++−+++
Control endometrium303270-5241-
Stage I-II endometriosis221390 p<0.01a4180NS
Stage III-IV endometriosis9063 p<0.01a270NS

[i] Three ranges are utilised: −, <5%; +, 5–50%; and ++, >50%. A comparison of the results was performed using the χ2 test (astatistically significant difference; NS, not significant). OPN, osteopontin; n, number of patients.

Comparison of clinical findings of patients with endometriosis according to the severity of disease

No significant differences were observed between the age, number of pregnancies, parity, serum CA125 levels and BMI of the patients with endometriosis with stage I-II and stage III-IV disease. In particular, the mean age was 36±2.48 years in the patients with stage I-II disease vs. 35.75±5.94 years in the patients with stage III-IV disease (p=0.96); the number of pregnancies was 1.40±0.40 in the patients with stage I-II disease vs. 1.67±0.89 in the patients with stage III-IV disease (p=0.75); parity was 1.20±0.28 in the patients with stage I-II disease vs. 1.34±0.67 in the patients with stage III-IV disease (p=0.82); serum CA125 levels were 47.71±7.72 IU/ml in the patients with stage I-II disease vs. 72.96±38.74 IU/ml in the patients with stage III-IV disease (p=0.36); BMI was 25.28±3.08 m2/kg in the patients with stage I-II disease vs. 20.07±3.30 m2/kg in the patients with stage III-IV disease (p=0.33).

Discussion

The pathological processes involved in endometriosis have not yet been fully elucidated. However, endometriosis has been found to be associated with changes in the expression of several genes, including cytokines (19), such as the multifunctional cytokine OPN, which has been intensively investigated in endometriosis (7,8,10,20).

The results from the present study revealed that OPN mRNA expression, as well as its release in the blood, was significantly increased in endometriotic lesions in comparison to normal tissue. Our findings on OPN mRNA expression are in agreement with those of other studies, which have demonstrated an increased OPN mRNA expression, as well as increased OPN plasma levels in patients with endometriosis in comparison to control subjects, regardless of the phase of the menstrual cycle and diseases stage (8). Similarly, by means of oligonucleotide microarray analysis, complimentary DNA microarrays and quantitative real-time RT-PCR, OPN gene expression has been shown to be increased in endometriotic lesions in a rat model of endometriosis in comparison to normal rats (21,22). On the contrary, with the use of microarray analysis, a downregulation of OPN expression has been observed during the secretory phase in endometriotic lesions (9).

As regards immunohistochemical analysis, we found a higher semiquantitative expression of OPN in both groups of endometriosis patients (the first including patients with stage I-II disease and the second group including patients with stage III-IV disease) in comparison to the eutopic endometrium of the control subjects. Moreover, the OPN staining pattern obtained in the present study, was similar to that observed in the study by Odagiri et al(7), who demonstrated that this molecule was mainly immunolocalised in normal and ectopic endometrial epithelial cells. However, these authors did not find a significant difference in the staining intensity between endometriotic lesions and control samples. Moreover, another immunohistochemical study demonstrated different OPN expression intensities in endometriotic lesions in comparison to normal specimens, according to the histological grade (10). Recently, Casals et al(20) demonstrated no statistically significant difference in OPN expression between patients and the control subjects.

Such discrepancies may arise from the heterogeneity of the endometriotic samples included in the above studies. For this reason, we restricted the sampling of specimens from women who were in the proliferative phase, and subdivided the patients into 2 groups, one group including those patients with minimal-to-mild disease and the other group including patients with moderate-to-severe disease.

Since it is well known that the functional role of OPN includes cell adhesion, migration, differentiation and regulation of the metastatic spread of tumour cells, it can be hypothesised that the expression of OPN is increased in patients with endometriosis, which would enhance endometrial invasiveness, proliferation and survival in ectopic lesions.

A recent study revealed that a subset of endometriotic cells displayed certain features characteristic of somatic stem cells, such as the presence of CD133 (23). This cell subset seems to originate from bone marrow, and to display endothelial progenitor cell-like features (24). The proliferation and migration of endothelial progenitor cells are influenced by OPN (16,17), which may be required for the homing of these cells (25). OPN shows opposite effects depending on tissue and the physiological state of the cell. In general, OPN is a potent stimulator of cell proliferation, although it represents a negative regulator of hematopoietic stem cell proliferation (26). Possibly, such a mechanism may be mediated by β1-integrins (27), and OPN may induce a lateral organization of lipids and membrane proteins in lipid rafts (28), in order to activate associated signal transduction pathways (29). Although the role of CD133 in stem cells remains unclear, there is much evidence suggesting that this protein plays a potential role as an organiser of specific membrane domains (13), which seems essential for the maintenance of stem cell properties (30). Although we observed the presence of CD133+ cells in the normal endometrium, as well as in endometriosis specimens, we did not observe a significant quantitative variation of this protein in patients with endometriosis. However, the presence of the somatic stem cell marker, CD133, suggests the occurrence of a stem cell origin in the pathogenesis of the disease. There is emerging evidence for the occurrence of endometrial cancer stem cells within CD133+ and side population cells (31), which could explain the fact that endometriosis is associated with 10–15% of ovarian cancer cases (32).

Thus, further studies are required to determine whether CD133 is expressed and localised in endometrial stem cells, and whether this molecule may be used as a marker of stemness in the eutopic and ectopic endometrium.

In conclusion, the results from our study confirm that OPN is involved in the development of endometriosis by enhancing the invasiveness, proliferation and survival of endometrial cells in ectopic lesions. Furthermore, we suggest that the protein, CD133, cannot be used as a disease marker for endometriosis. Future studies are required in order to further clarify the possible role and specific mechanisms of action of these molecules in the pathogenesis of endometriosis, in order to improve the quality of life of patients with this debilitating and complex disease.

References

1 

de Ziegler D, Borghese B and Chapron C: Endometriosis and infertility: pathophysiology and management. Lancet. 376:730–738. 2012.PubMed/NCBI

2 

Swiersz LM: Role of endometriosis in cancer and tumor development. Ann NY Acad Sci. 955:281–292. 2002. View Article : Google Scholar : PubMed/NCBI

3 

Borghese B, Mondon F, Noël JC, Fayt I, Mignot TM, Vaiman D and Chapron C: Gene expression profile for ectopic versus eutopic endometrium provides new insights into endometriosis oncogenic potential. Mol Endocrinol. 22:2557–2562. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Anborgh PH, Mutrie JC, Tuck AB and Chambers AF: Role of the metastasis-promoting protein osteopontin in the tumour microenvironment. J Cell Mol Med. 14:2037–2044. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Liaw L, Skinner MP, Raines EW, Ross R, Cheresh DA, Schwartz SM and Giachelli CM: The adhesive and migratory effects of osteopontin are mediated via distinct cell surface integrins. Role of alpha v beta 3 in smooth muscle cell migration to osteopontin in vitro. J Clin Invest. 95:713–724. 1995. View Article : Google Scholar : PubMed/NCBI

6 

Apparao KB, Murray MJ, Fritz MA, Meyer WR, Chambers AF, Truong PR and Lessey BA: Osteopontin and its receptor alphav beta(3) integrin are coexpressed in the human endometrium during the menstrual cycle but regulated differentially. J Clin Endocrinol Metab. 86:4991–5000. 2001.PubMed/NCBI

7 

Odagiri K, Konno R, Fujiwara H, Netsu S, Ohwada M, Shibahara H and Suzuki M: Immunohistochemical study of osteopontin and L-selectin in a rat endometriosis model and in human endometriosis. Fertil Steril. 88:1207–1211. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Cho S, Ahn YS, Choi YS, Seo SK, Nam A, Kim HY, Kim JH, Park KH, Cho DJ and Lee BS: Endometrial osteopontin mRNA expression and plasma osteopontin levels are increased in patients with endometriosis. Am J Reprod Immunol. 61:286–293. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Burney RO, Talbi S, Hamilton AE, Vo KC, Nyegaard M, Nezhat CR, Lessey BA and Giudice LC: Gene expression analysis of endometrium reveals progesterone resistance and candidate susceptibility genes in women with endometriosis. Endocrinology. 148:3814–3826. 2007. View Article : Google Scholar

10 

Wei Q, St Clair JB, Fu T, Stratton P and Nieman LK: Reduced expression of biomarkers associated with the implantation window in women with endometriosis. Fertil Steril. 91:1686–1691. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Götte M, Wolf M, Staebler A, Buchweitz O, Kelsch R, Schüring AN and Kiesel L: Increased expression of the adult stem cell marker Musashi-1 in endometriosis and endometrial carcinoma. J Pathol. 215:317–329. 2008.PubMed/NCBI

12 

Maruyama T and Yoshimura Y: Stem cell theory for the pathogenesis of endometriosis. Front Biosci (Elite Ed). 4:2854–2863. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Corbeil D, Karbanová J, Fargeas CA and Jászai J: Prominin-1 (CD133): molecular and cellular features across species. Adv Exp Med Biol. 777:3–24. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Schwab KE, Hutchinson P and Gargett CE: Identification of surface markers for prospective isolation of human endometrial stromal colony-forming cells. Hum Reprod. 23:934–943. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Sasson IE and Taylor HS: Stem cells and the pathogenesis of endometriosis. Ann NY Acad Sci. 1127:106–115. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Wang Y, Yan W, Lu X, Qian C, Zhang J, Li P, Shi L, Zhao P, Fu Z, Pu P, Kang C, Jiang T, Liu N and You Y: Overexpression of osteopontin induces angiogenesis of endothelial progenitor cells via the avβ3/PI3K/AKT/eNOS/NO signaling pathway in glioma cells. Eur J Cell Biol. 90:642–648. 2011.PubMed/NCBI

17 

Yu M, Liu Q, Yi K, Wu L and Tan X: Effects of osteopontin on functional activity of late endothelial progenitor cells. J Cell Biochem. 112:1730–1736. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Revised American Society for Reproductive Medicine classification of endometriosis: 1996. Fertil Steril. 67:817–821. 1997. View Article : Google Scholar : PubMed/NCBI

19 

Eyster KM, Klinkova O, Kennedy V and Hansen KA: Whole genome deoxyribonucleic acid microarray analysis of gene expression in ectopic versus eutopic endometrium. Fertil Steril. 88:1505–1533. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Casals G, Ordi J, Creus M, Fábregues F, Carmona F, Casamitjana R and Balasch J: Expression pattern of osteopontin and αvβ3 integrin during the implantation window in infertile patients with early stages of endometriosis. Hum Reprod. 27:805–813. 2012.

21 

Flores I, Rivera E, Ruiz LA, Santiago OI, Vernon MW and Appleyard CB: Molecular profiling of experimental endometriosis identified gene expression patterns in common with human disease. Fertil Steril. 87:1180–1199. 2007. View Article : Google Scholar : PubMed/NCBI

22 

Konno R, Fujiwara H, Netsu S, Odagiri K, Shimane M, Nomura H and Suzuki M: Gene expression profiling of the rat endometriosis model. Am J Reprod Immunol. 58:330–343. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Chan RW, Ng EH and Yeung WS: Identification of cells with colony-forming activity, self-renewal capacity, and multipotency in ovarian endometriosis. Am J Pathol. 178:2832–2844. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Masuda H, Matsuzaki Y, Hiratsu E, Ono M, Nagashima T, Kajitani T, Arase T, Oda H, Uchida H, Asada H, Ito M, Yoshimura Y, Maruyama T and Okano H: Stem cell-like properties of the endometrial side population: implication in endometrial regeneration. PLoS One. 5:e103872010. View Article : Google Scholar : PubMed/NCBI

25 

Leen LL, Filipe C, Billon A, Garmy-Susini B, Jalvy S, Robbesyn F, Daret D, Allières C, Rittling SR, Werner N, Nickenig G, Deutsch U, Duplàa C, Dufourcq P, Lenfant F, Desgranges C, Arnal JF and Gadeau AP: Estrogen-stimulated endothelial repair requires osteopontin. Arterioscler Thromb Vasc Biol. 28:2131–2136. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Stier S, Ko Y, Forkert R, Lutz C, Neuhaus T, Grunewald E, Cheng T, Dombkowski D, Calvi LM, Rittling SR and Scadden DT: Osteopontin is a hematopoietic stem cell niche component that negatively regulates stem cell pool size. J Exp Med. 201:1781–1791. 2005. View Article : Google Scholar : PubMed/NCBI

27 

Nilsson SK, Johnston HM, Whitty GA, Williams B, Webb RJ, Denhardt DT, Bertoncello I, Bendall LJ, Simmons PJ and Haylock DN: Osteopontin, a key component of the hematopoietic stem cell niche and regulator of primitive hematopoietic progenitor cells. Blood. 106:1232–1239. 2005. View Article : Google Scholar : PubMed/NCBI

28 

Lee JL, Wang MJ, Sudhir PR and Chen JY: CD44 engagement promotes matrix derived survival through the CD44-SRC-integrin axis in lipid rafts. Mol Cell Biol. 28:5710–5723. 2008. View Article : Google Scholar : PubMed/NCBI

29 

Jacobson K and Dietrich C: Looking at lipid rafts? Trends Cell Biol. 9:87–91. 1999. View Article : Google Scholar

30 

Bauer N, Fonseca AV, Florek M, Freund D, Jászai J, Bornhäuser M, Fargeas CA and Corbeil D: New insights into the cell biology of hematopoietic progenitors by studying Prominin-1 (CD133). Cells Tissues Organs. 188:127–138. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Kyo S, Maida Y and Inoue M: Stem cells in endometrium and endometrial cancer: accumulating evidence and unresolved questions. Cancer Lett. 308:123–133. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Kokcu A: Relationship between endometriosis and cancer from current perspective. Arch Gynecol Obstet. 284:1473–1479. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
D'Amico F, Skarmoutsou E, Quaderno G, Malaponte G, La Corte C, Scibilia G, D'Agate G, Scollo P, Fraggetta F, Spandidos DA, Spandidos DA, et al: Expression and localisation of osteopontin and prominin-1 (CD133) in patients with endometriosis. Int J Mol Med 31: 1011-1016, 2013.
APA
D'Amico, F., Skarmoutsou, E., Quaderno, G., Malaponte, G., La Corte, C., Scibilia, G. ... Mazzarino, M.C. (2013). Expression and localisation of osteopontin and prominin-1 (CD133) in patients with endometriosis. International Journal of Molecular Medicine, 31, 1011-1016. https://doi.org/10.3892/ijmm.2013.1325
MLA
D'Amico, F., Skarmoutsou, E., Quaderno, G., Malaponte, G., La Corte, C., Scibilia, G., D'Agate, G., Scollo, P., Fraggetta, F., Spandidos, D. A., Mazzarino, M. C."Expression and localisation of osteopontin and prominin-1 (CD133) in patients with endometriosis". International Journal of Molecular Medicine 31.5 (2013): 1011-1016.
Chicago
D'Amico, F., Skarmoutsou, E., Quaderno, G., Malaponte, G., La Corte, C., Scibilia, G., D'Agate, G., Scollo, P., Fraggetta, F., Spandidos, D. A., Mazzarino, M. C."Expression and localisation of osteopontin and prominin-1 (CD133) in patients with endometriosis". International Journal of Molecular Medicine 31, no. 5 (2013): 1011-1016. https://doi.org/10.3892/ijmm.2013.1325
Copy and paste a formatted citation
x
Spandidos Publications style
D'Amico F, Skarmoutsou E, Quaderno G, Malaponte G, La Corte C, Scibilia G, D'Agate G, Scollo P, Fraggetta F, Spandidos DA, Spandidos DA, et al: Expression and localisation of osteopontin and prominin-1 (CD133) in patients with endometriosis. Int J Mol Med 31: 1011-1016, 2013.
APA
D'Amico, F., Skarmoutsou, E., Quaderno, G., Malaponte, G., La Corte, C., Scibilia, G. ... Mazzarino, M.C. (2013). Expression and localisation of osteopontin and prominin-1 (CD133) in patients with endometriosis. International Journal of Molecular Medicine, 31, 1011-1016. https://doi.org/10.3892/ijmm.2013.1325
MLA
D'Amico, F., Skarmoutsou, E., Quaderno, G., Malaponte, G., La Corte, C., Scibilia, G., D'Agate, G., Scollo, P., Fraggetta, F., Spandidos, D. A., Mazzarino, M. C."Expression and localisation of osteopontin and prominin-1 (CD133) in patients with endometriosis". International Journal of Molecular Medicine 31.5 (2013): 1011-1016.
Chicago
D'Amico, F., Skarmoutsou, E., Quaderno, G., Malaponte, G., La Corte, C., Scibilia, G., D'Agate, G., Scollo, P., Fraggetta, F., Spandidos, D. A., Mazzarino, M. C."Expression and localisation of osteopontin and prominin-1 (CD133) in patients with endometriosis". International Journal of Molecular Medicine 31, no. 5 (2013): 1011-1016. https://doi.org/10.3892/ijmm.2013.1325
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team