Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
November 2013 Volume 32 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November 2013 Volume 32 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Aquaporin-9 downregulation prevents steatosis in oleic acid-induced non-alcoholic fatty liver disease cell models

  • Authors:
    • Chuan Wang
    • Zi-Lan Lv
    • Yu-Jun Kang
    • Ting-Xiu Xiang
    • Pi-Long Wang
    • Zheng Jiang
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology, The First Affiliated Hospital, Chongqing Medical University, Chongqing 400016, P.R. China, Key Laboratory of Diagnostic Medicine Designated by the Chinese Ministry of Education, Chongqing Medical University, Chongqing 400016, P.R. China
  • Pages: 1159-1165
    |
    Published online on: September 19, 2013
       https://doi.org/10.3892/ijmm.2013.1502
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Aquaporin-9 (AQP9) is an aquaglyceroporin that acts as the adipose glycerol channel. However, the role of AQP9 in steatosis in non-alcoholic fatty liver disease (NAFLD) has not yet been fully elucidated. In the present study, the coding sequence of the AQP9 gene was obtained from LO2 cells by RT-PCR, and cloned into the pEGFP-N1 vector. Short hairpin RNA (shRNA) targeting the AQP9 gene was inserted into the pGenesil-1 vector. Recombinant plasmids were confirmed by enzyme digestion and sequence analysis, and transfected into cell models (derived from LO2 cells) of oleic acid-induced NAFLD. Our results demonstrated that AQP9 recombinant plasmids can be effectively expressed in cell models of NAFLD. Furthermore, in comparison with the control group, AQP9 overexpression significantly increased intracellular lipid content, triglyceride (TG), free fatty acid (FFA) and glycerol levels; however, the silencing of AQP9 exerted the opposite effects. Taken together, recombinant plasmids used to induce AQP9 overexpression and to silence AQP9 expression were successfully constructed. AQP9 overexpression aggravated the degree of steatosis; however, the silencing of AQP9 alleviated these effects. Based on these data, we suggest that AQP9 may serve as a novel molecular target for therapeutic intervention in NAFLD.

Introduction

Non-alcoholic fatty liver disease (NAFLD) encompasses a spectrum of liver diseases pertaining to fat accumulation in the liver without significant alcohol consumption. It has become the leading cause of chronic liver injury in the Western world (1). Currently, no effective treatments are available to treat NAFLD; thus, lifestyle modifications via diet and exercise are most commonly recommended (2). Therefore, there is an urgent need to develop novel treatment options for preventing NAFLD. NAFLD is a clinicohistopathological entity characterized by lipid accumulation in the liver (simple steatosis) (3). In hepatic steatosis, an excess amount of triglycerides (TGs) are acquired and accumulate in hepatocytes. The main sources of TGs are from fatty acids stored in adipose tissue and de novo lipogenesis of fatty acids within the liver (4). Therefore, the role of hepatic glycerol uptake in the development of NAFLD warrants investigation.

Aquaporins (AQPs) are a family of membrane-bound, homotetrameric water channel proteins that allow the movement of water through cell membranes (5). Thus far, 13 AQP subtypes have been identified in human (6). Among these, AQP3, 7, 9 and 10 are subcategorized as aquaglyceroporins which permeabilize glycerol, as well as water (7). AQP9 is expressed in a number of organs, but it is highly expressed in the liver (8). It is thought to be the sole aquaglyceroporin subfamily expressed glycerol channel in liver cells and is localized at the sinusoidal plasma membrane that faces the portal vein (9). However, the role of the AQP9 protein in the pathogenesis of NAFLD remains to be fully elucidated.

In this study, we constructed pEGFP-N1-AQP9 and pGenesil-1-AQP9-short hairpin RNA (shRNA) recombinant eukaryotic expression vectors, which were then transfected into cell models of oleic acid-induced NAFLD, then the expression of AQP9 was detected by RT-PCR and western blot analysis. We demonstrate that transfection with these plasmids can effectively increase and decrease AQP9 expression, respectively. We also demonstrate that high levels of AQP9 protein increase steatosis and that the silencing of AQP9 reverses this effect in cell models of oleic acid-induced NAFLD. Taken together, our results reveal that the downregulation of AQP9 represents a novel potential molecular target for therapeutic intervention in NAFLD.

Materials and methods

Construction of recombinant pEGFP-N1-AQP9 eukaryotic expression vector

Total RNA was extracted from the LO2 cells using RNAiso Plus (Takara, Dalian, China) and first-strand DNA was synthesized using the RT reagent kit (Takara) with random hexamer primers. The full length AQP9 cDNA was obtained by RT-PCR. The AQP9 nested PCR primer (forward, 5′-GATTTCGGGTTCTAAGTCGC-3′ and reverse primer, 5′-GAGAATCCCAAACTGACTGC-3′; nested forward, 5′-GGAAGATCTGATGCAGCCTGAGGGAG-3′ and reverse, 5′-CGGGGTACCCTGAGTTCATATTTCTC TGG-3′) and β-actin (forward, 5′-ACTGTGCCCATCTAC GAGG-3′ and reverse primer, 5′-GAAAGGGTGTAACG CAACTA-3′) were synthesized by Takara. The human full-length AQP9-cDNA was retrieved following the procedures of the E.Z.N.A. Gel Extraction kit (Omega Bio-Tek Inc., Norcross, GA, USA) and ligated to the multi-clony sites of pEGFP-N1 which was digested by BglII and KpnI at a ratio of 10:1 with T4 DNA ligase (Takara) and incubated at 16°C overnight. The ligated product was transformed into competent E. coli DH5α. The recombinant plasmid pEGFP-N1-AQP9 was extracted from a single positive clone which was selected with kanamycin, then identified using single digested with BglII and double digested with BglII and KpnI and the products were evaluated with 1% agarose gel electrophoresis. The sequence of pEGFP-N1-AQP9 was confirmed by Sangon Biotech Co., Ltd. (Shanghai, China).

Construction of recombinant pGenesil-1-AQP9-shRNA eukaryotic expression vector

According to the Homo sapien AQP9 gene sequence (GenBank Accession no. NM_182966) and the principles of shRNA design, a shRNA site targeting the AQP9 gene was selected. The oligonucleotide sequences encoding AQP9 shRNA (forward, 5′-GATCCGCTGTGTC TTTAGCAATGTGTTTCGACACATTGCTAAAGACACAG CTTTTTTA-3′ and reverse, 5′-AGCTTAAAAAAGCTGTGT CTTTAGCAATGTGTCGAAACACATTGCTAAAGACACA GCG-3′); and scrambled shRNA (forward, 5′-GATCCG AATCCGCACTACTCCTTACATTCGTGTAAGGAGTAGTG CGGATTCTTTTTTA-3′ and reverse, 5′-AGCTTAAAAA AGAATCCGCACTACTCCTTACACGAATGTAAGGAGTA GTGCGGATTCG-3′) were synthesized by Invitrogen (Carlsbad, CA, USA); these two pairs of oligonucleotides were annealed into double-stranded DNA, then cloned into the pGenesil-1 vector which was double digested with BamHI and HindIII. These recombinant plasmids were double digested with EcoRI and HindIII for enzyme digestion analysis and sequenced by Sangon Biotech Co., Ltd.

Establishment of oleic acid-induced NAFLD cell models

The 3rd passage LO2 cells (1×104 cells/well) were inoculated into a 96-well plate and cultured in RPMI-1640 supplemented with 10% fetal bovine serum in 5% CO2 at 37°C. The following day, cells were treated with 0, 10, 20, 30, 40 or 50 μg/ml of oleic acid (Sigma-Aldrich Corp., St. Louis, MO, USA) for 72 h, then the culture medium was discarded and the cells were washed three times in phosphate buffer solution, and 20 μl of MTT labeling reagent (0.5 mg/ml) (Sigma-Aldrich Corp.) were added to each well. The plates were then incubated for 4 h and 150 μl of dimethylsulfoxide was added. Optical density values were detected at the 490 nm wavelength. A cell model of NAFLD was induced by oleic acid. Each assay was performed in octuplicate.

Transfection of the recombinant pEGFP-N1-AQP9 and pGenesil-1-AQP9-shRNA eukaryotic expression vector into cell models of NAFLD

Endotoxin-free plasmid was extracted using the E.Z.N.A. Endo-Free Plasmid Mini kit I (Omega Bio-Tek Inc.). Cell models of Oleic acid-induced NAFLD were cultured in RPMI-1640 containing 10% fetal bovine serum at 37°C in a humidified atmosphere of 5% CO2. Cells were passaged and transfected with endotoxin-free plasmid at 80–90% confluence using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions. Cells were divided into eight groups: untreated, oleic acid, pEGFP-N1-AQP9, pEGFP-N1, pGenesil-1-AQP9-shRNA, pGenesil-1-scrambled-shRNA, pGenesil-1 and double-distilled water (ddH2O) group. Seventy-two hours after transfection, the expression of GFP was observed under an inverted fluorescence microscope and the cells were collected to conduct subsequent experiments.

RT-PCR analysis

Total RNA was isolated from each group by RNAiso Plus according to the manufacturer’s instructions (Takara). cDNA was prepared using the RT reagent kit and RT-PCR was performed using AQP9 primer (forward, 5′-CTTTGGACGGATGAAATGGTT-3′ and reverse, 5′-GAG TCAGGCTCTGGATGGTG-3′) and β-actin was detected as an internal reference. Each assay was performed in duplicate.

Western blot analysis

Total protein was isolated from each group and the protein concentration was detected using the BCA protein assay kit (Beyotime Institute of Biotechnology, Hangzhou, China). Western blot analysis was performed using rabbit anti-human AQP9 polyclonal antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) and rabbit anti-human β-actin polyclonal antibody (Biosynthesis Biotechnology Co., Ltd., Beijing, China), followed by incubation with HRP-conjugated goat anti-rabbit IgG (Biosynthesis Biotechnology Co., Ltd.). The proteins of interest were detected using BeyoECL plus reagent (Beyotime Institute of Biotechnology) following the manufacturer’s instructions. Each assay was performed in duplicate.

Oil red O staining

Briefly, the culture medium was discarded and the cells were washed were washed three times in phosphate buffer solution, then fixed with 4% paraformaldehyde for 30 min and stained with 5% oil red O solution for 30 min. They were then washed with 60% isopropanol for 30 sec and then rinsed with ddH2O for 30 sec, counterstained with hematoxylin for 3 min, rinsed with ddH2O for 5 min, fixed with neutral balata, and then observed under an upright microscope. Each assay was performed in triplicate.

Determination of TG, free fatty acid (FFA) and glycerol levels

Briefly, the cells were washed with phosphate buffer solution three times and lysed by repeated freezing and thawing. Intracellular lipid content was determined using the TG assay kit (Beihua Kangtai, Beijing, China), FFA assay kit (Jiancheng Bioengineering Institute, Nanjing, China) and glycerol GPO-POD assay kit (Applygen, Beijing, China) according to the manufacturer’s instructions. Each assay was performed in quintuplicate.

Statistical analysis

Statistical analyses were conducted using SPSS 17.0 software. Data are presented as the means ± standard deviation. One-way ANOVA was conducted to assess differences among groups. A P-value ≤0.05 was considered to indicate a statistically significant difference.

Results

Evaluation of RT-PCR product and recombinant pEGFP-N1-AQP9 eukaryotic expression vector

The RT-PCR products were loaded on 1.5% agarose gels, and the band for full-length AQP9 cDNA was located at 888 bp (Fig. 1A). After the AQP9 cDNA fragment was inserted into the pEGFP-N1 plasmid (5428 bp), pEGFP-N1-AQP9 recombinant plasmids were digested by restriction enzymes and separated on a 1% agarose gel. The positive plasmid was confirmed by DNA sequencing. Our data demonstrated that after both pEGFP-N1-AQP9 and pEGFP-N1 were single and double digested, separately, the AQP9 band was detected in the double digested pEGFP-N1-AQP9, but not in pEGFP-N1, and the band of single digested pEGFP-N1-AQP9 was higher than that of pEGFP-N1 (Fig. 1B). From sequencing analysis, there was a nonsense mutation at site 45: A→G. The sequencing map was as shown in Fig. 2.

Figure 1

Evaluation of RT-PCR product and recombinant pEGFP-N1-aquaporin-9 (AQP9) eukaryotic expression vector. (A) The full-length AQP9 gene was obtained from LO2 cells by RT-PCR and separated on a 1.5% agarose gel. M, DL 2,000 DNA marker; lane 1, AQP9 products. (B) The recombinant pEGFP-N1-AQP9 vector was single digested with BglII and double digested with BglII and KpnI and the products were evaluated by 1% agarose gel electrophoresis. M, DL 10,000 DNA marker; lane 1, pEGFP-N1-AQP9 was double digested with BglII and KpnI; lane 2, pEGFP-N1 was double digested with BglII and KpnI; lane 3, pEGFP-N1-AQP9 was single digested with BglII; lane 4, pEGFP-N1 was single digested with BglII.

Figure 2

Sequence of full-length 888 bp aquaporin-9 (AQP9) gene.

Evaluation of recombinant pGenesil-1-AQP9-shRNA eukaryotic expression vector

pGenesil-1-AQP9-shRNA recombinant plasmids were digested by restriction enzymes and evaluated with 1% agarose gel electrophoresis. The positive plasmid was confirmed by DNA sequencing. The band of double digested and pGenesil-1-scrambled shRNA was higher than that of pGenesil-1 (Fig. 3). Sequencing analysis confirmed that the inserted sequence was consistent with the expected sequence (Fig. 4).

Figure 3

Evaluation of recombinant pGenesil-1-AQP9-shRNA eukaryotic expression vector. Enzyme digestion analysis of pGenesil-1-AQP9-shRNA and pGenesil-1-scrambled shRNA. M, DL 10,000 DNA marker; lane 1, pGenesil-1-AQP9-shRNA was double digested with EcoRI and HindIII; lane 2, pGenesil-1-scrambled shRNA was double digested with EcoRI and HindIII; lane 3, pGenesil-1 was double digested with EcoRI and HindIII. AQP9, aquaporin-9; shRNA, short hairpin RNA.

Figure 4

Sequencing map of pGenesil-1-AQP9-shRNA and pGenesil-1-scrambled shRNA. (A) pGenesil-1-AQP9-shRNA; (B) pGenesil-1-scrambled shRNA. AQP9, aquaporin-9; shRNA, short hairpin RNA.

Optimizing the concentration of oleic acid by MTT assay

To determine the optimal concentration of oleic acid for the induction of steatosis, the cell viability of the cell models of oleic acid-induced NAFLD was determined by MTT assay following treatment with oleic acid (0, 10, 20, 30, 40 or 50 μg/ml) for 72 h. The cell viability of the cells treated with >20 μg/ml of oleic acid decreased and significantly decreased when the cells were treated with 50 μg/ml of oleic acid (Fig. 5). Therefore, according to our results, 20 μg/ml of oleic acid was the optimal concentration for inducing steatosis; thus, we selected this dose for the following experiments.

Figure 5

Detecting the optimal concentration of oleic acid by assessing cell viability using MTT Assay. Cell viability was determined by MTT assay after the LO2 cells were treated with 0, 10, 20, 30, 40 or 50 μg/ml of oleic acid (*P<0.05 vs. 0 μg/ml oleic acid group, n=8).

mRNA and protein expression of AQP9 in cell models of oleic acid-induced NAFLD

After the cell models of NAFLD were transfected with recombinant plasmids for 72 h, GFP protein expression was observed under an inverted fluorescence microscope. GFP was observed in the pEGFP-N1-AQP9, pEGFP-N1, pGenesil-1-AQP9-shRNA, pGenesil-1-scrambled shRNA and pGenesil-1 group, but not in the ddH2O, oleic acid or untreated group (data not shown). To determine the AQP9 mRNA and protein levels in the cell models of oleic acid-induced NAFLD, RT-PCR and western blot analysis were performed. RT-PCR revealed that the delivery of pEGFP-N1-AQP9 and pGenesil-1-AQP9-shRNA resulted in an approximately 70% overexpression and a 45% knockdown of mRNA levels compared with the empty vector group, respectively (Fig. 6A). Western blot analysis revealed a corresponding change in AQP9 protein expression (Fig. 6B). These results indicated that the recombinant plasmids were successfully transfected into the cell models of NAFLD and that the vectors, pEGFP-N1-AQP9 and pGenesil-1-AQP9-shRNA, were effective in increasing and suppressing endogenous AQP9 expression, respectively.

Figure 6

mRNA and protein expression of aquaporin-9 (AQP9) in cell models of oleic acid-induced non-alcoholic fatty liver disease (NAFLD). (A) The expression of AQP9 mRNA was detected by RT-PCR after transfection with pEGFP-N1-AQP9 and pGenesil-1-AQP9-shRNA eukaryotic expression vectors using Lipofectamine 2000 for 72 h. (B) The protein expression of AQP9 was analyzed by western blot analysis following transfection with pEGFP-N1-AQP9 and pGenesil-1-AQP9-shRNA eukaryotic expression vectors using Lipofectamine 2000 for 72 h (*P<0.05 vs. oleic acid group; #P<0.01 vs. oleic acid group, n=3).

Intracellular lipid accumulation is dependent on AQP9 expression in cell models of NAFLD

To detect intracellular lipid accumulation, oil red O staining was performed. A large number of lipid droplets appeared jacinth with oil red O staining accompanied by lipid droplet fusion in the pEGFP-N1-AQP9 group; a small number of lipid droplets appeared jacinth and lipid droplet fusion was not as evident in the pGenesil-1-AQP9-shRNA group; in the oleic acid group, we also observed lipid droplet fusion, but no lipid droplets were observed in the untreated group (Fig. 7A). These results indicate that oleic acid induces intracellular lipid accumulation in LO2 cells. AQP9 overexpression significantly aggravates intracellular lipid accumulation; however, the silencing of AQP9 alleviates this effect.

Figure 7

Intracellular lipid accumulation is dependent on aquaporin-9 (AQP9) expression in cell models of oleic acid-induced non-alcoholic fatty liver disease (NAFLD). (A) Oil red O staining. (B) Triglyceride (TG), free fatty acid (FFA) and glycerol content was determined according to the manufacturer’s instructions following transfection with oleic pEGFP-N1-AQP9 and pGenesil-1-AQP9-shRNA eukaryotic expression vectors using Lipofectamine 2000 for 72 h (*P<0.05 vs. oleic acid group; #P<0.01 vs. oleic acid group, n=5).

Content of TG, FFA and glycerol is depenentd on AQP9 expression in cell models of NAFLD

The content of TG, FFA and glycerol was significantly increased in the oleic acid group, compared with the untreated group (Fig. 7B). Our data also demonstrated that the content of TG, FFA and glycerol was significant increased in the pEGFP-N1-AQP9 group compared with the oleic acid group, while it was significantly decreased in the pGenesil-1-AQP9-shRNA group compared with the oleic acid group. These results suggested that oleic acid increased the content of TG, FFA and glycerol. AQP9 overexpression induced a significant increase in TG, FFA and glycerol content; however, the silencing of AQP9 significantly reversed this effect. Taken together, these results suggest that AQP9 plays an important role in the progression of hepatic steatosis.

Discussion

NAFLD consists of a spectrum of pathological states ranging from the hepatic accumulation of lipids known as steatosis to non-alcoholic steatohepatitis, cirrhosis and ultimately, liver failure (10). It occurs in children and adults of all age groups and both genders (11). Its key feature is steatosis in the absence of pathologies, such as viral hepatitis or alcohol abuse (12). By current estimations, NAFLD is perhaps the most common liver disease as it has a prevalence of 6–35% with a median of 20% according to a study on populations in several countries (13). NAFLD is particularly associated with obesity, since the prevalence of steatosis is 57.5–74% in obese subjects from Japan and Italy (14).

Concerning the pathogenesis of NAFLD, the most accepted theory is the ‘two hit’ hypothesis, in which the first hit involves the accumulation of hepatic TG, which in turn triggers the second hit, inflammation and oxidative stress (15). An extended hypothesis proposed a decrease capacity of hepatic regeneration and the adverse effects of FFA lipotoxicity as the third hit (16,17). These data suggest that alleviating hepatocyte lipid accumulation is an effective therapeutic strategy to prevent NAFLD.

AQP belongs to the major intrinsic protein (MIP) family which can be classified as two types. One type is aquaporin which accounts for the majority of MIPs, including AQP1, AQP2, AQP4, AQP5, AQP6, AQP8, AQP10, AQP11 and AQP12, only permeable to water. The other type is aquaglyceroporin, including AQP3, AQP7, AQP9 and AQP10, permeable to not only water, but also urea, glycerol and even some inorganic ions (18), which play an important role in regulating glycerol transportation and lipid metabolism. AQP9 is a protein channel highly expressed in the liver and is localized at the sinusoidal membrane (19). It is thought to be the sole aquaglyceroporin subfamily expressed glycerol channel in liver cells (7,9).

In this study, we used gain- and loss-of-function approaches to determine the role of AQP9 in steatosis in cell models of oleic acid-induced NAFLD. Our results revealed that AQP9 overexpression significantly increased intracellular lipid content; however, the silencing of AQP9 had the opposite effect. These results are consistent with those from previous studies, showing that an abnormal increase in AQP9 expression leads to a large amount of glycerol entering hepatocytes and increased fat synthesis and accumulation, resulting in the formation of fatty liver (20,21). Glycerol uptake is significantly decreased in cultured astrocytes following transfection with AQP9-small interfering RNA (22). The decreased expression of AQP9 in hepatocytes can effectively block the entry of glycerol into hepatocytes; therefore, targeting AQP9 may be used to prevent and treat NAFLD, which may provide a promising therapeutic strategy for NAFLD. Furthermore, AQP9 acts as an absorption channel for certain drugs. AQP9 has been shown to aid the transfer of the chemotherapeutic drug, arsenic trioxide (23,24). The enforced expression of AQP9 in the tumor cell membrane can effectively enhance the chemotherapeutic efficacy, reducing drug dosage and toxic effects; thus it may provide a novel treatment strategy for tumors (25,26). It has been reported that insulin suppresses AQP9 expression in H4IIE hepatocytes (27). The treatment of rats with streptozotocin (STZ) has been shown to result in a 20-fold increase in AQP9 expression in the liver, which was blocked by the administration of insulin (28). Moreover, insulin resistance is the key factor in the pathogenesis and potential evolution of hepatic steatosis, which is associated with increased peripheral lipolysis with the release of FFA from visceral fat, the hepatic uptake of FFA and hepatocellular TG synthesis and accumulation (29,30). Thus, the knockout of AQP9 may play an important role against insulin resistance.

In conclusion, in this study, we successfully constructed the pEGFP-N1-AQP9 and pGenesil-1-AQP9-shRNA recombinant eukaryotic expression vectors, which were then transfected into cell models (derived from LO2 cells) of oleic acid-induced NAFLD. Thus, AQP9 expression was effectively increased and suppressed, respectively. In addition, the overexpression of AQP9 significantly increased intracellular lipid content. By contrast, the knockdown of AQP9 exerted the opposite effect. Our findings provide evidence of the potential therapeutic effectiveness of AQP9 in NAFLD. Further studies are required to clarity the molecular mechanisms of action of AQP9 in lipid accumulation in NAFLD.

Acknowledgements

This study was supported by grants (81070318) from the National Natural Science Foundation of China (NSFC81070318) and the Medical Research Project from Chongqing Board of Health (YuWeiKeJiao 2010-2-100).

References

1 

Browning JD, Szczepaniak LS, Dobbins R, et al: Prevalence of hepatic steatosis in an urban population in the United States: Impact of ethnicity. Hepatology. 40:1387–1395. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Rodriguez B, Torres DM and Harrison SA: Physical activity: an essential component of lifestyle modification in NAFLD. Nat Rev Gastroenterol Hepatol. 9:726–731. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Fabbrini E, Sullivan S and Klein S: Obesity and nonalcoholic fatty liver disease: biochemical, metabolic, and clinical implications. Hepatology. 51:679–689. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Krawczyk M, Bonfrate L and Portincasa P: Nonalcoholic fatty liver disease. Best Pract Res Clin Gastroenterol. 24:695–708. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Huang HF, He RH, Sun CC, Zhang Y, Meng QX and Ma YY: Function of aquaporins in female and male reproductive systems. Hum Reprod Update. 12:785–795. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Liu H, Zheng Z and Wintour EM: Aquaporins and fetal fluid balance. Placenta. 29:840–847. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Maeda N: Implications of aquaglyceroporins 7 and 9 in glycerol metabolism and metabolic syndrome. Mol Aspects Med. 33:665–675. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Elkjaer M, Vajda Z, Nejsum LN, et al: Immunolocalization of AQP9 in liver, epididymis, testis, spleen, and brain. Biochem Biophys Res Commun. 276:1118–1128. 2000. View Article : Google Scholar : PubMed/NCBI

9 

Maeda N, Funahashi T and Shimomura I: Metabolic impact of adipose and hepatic glycerol channels aquaporin 7 and aquaporin 9. Nat Clin Pract Endocrinol Metab. 4:627–634. 2008.PubMed/NCBI

10 

Chalasani N, Younossi Z, Lavine JE, et al: The diagnosis and management of non-alcoholic fatty liver disease: practice Guideline by the American Association for the Study of Liver Diseases, American College of Gastroenterology, and the American Gastroenterological Association. Hepatology. 55:2005–2023. 2012. View Article : Google Scholar

11 

Roberts EA: Pediatric nonalcoholic fatty liver disease (NAFLD): A ‘growing’ problem? J Hepatol. 46:1133–1142. 2007.

12 

Angulo P and Lindor KD: Non-alcoholic fatty liver disease. J Gastroenterol Hepatol. 17(Suppl): S186–S190. 2002. View Article : Google Scholar : PubMed/NCBI

13 

Vernon G, Baranova A and Younossi ZM: Systematic review: the epidemiology and natural history of non-alcoholic fatty liver disease and non-alcoholic steatohepatitis in adults. Aliment Pharmacol Ther. 34:274–285. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Tailleux A, Wouters K and Staels B: Roles of PPARs in NAFLD: potential therapeutic targets. Biochim Biophys Acta. 1821:809–818. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Day CP and James OF: Steatohepatitis: a tale of two ‘hits’? Gastroenterology. 114:842–845. 1998.

16 

Feldstein AE, Werneburg NW, Canbay A, et al: Free fatty acids promote hepatic lipotoxicity by stimulating TNF-alpha expression via a lysosomal pathway. Hepatology. 40:185–194. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Day CP: From fat to inflammation. Gastroenterology. 130:207–210. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Gomes D, Agasse A, Thiebaud P, Delrot S, Geros H and Chaumont F: Aquaporins are multifunctional water and solute transporters highly divergent in living organisms. Biochim Biophys Acta. 1788:1213–1228. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Carbrey JM, Gorelick-Feldman DA, Kozono D, Praetorius J, Nielsen S and Agre P: Aquaglyceroporin AQP9: solute permeation and metabolic control of expression in liver. Proc Natl Acad Sci USA. 100:2945–2950. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Hara-Chikuma M and Verkman AS: Physiological roles of glycerol-transporting aquaporins: the aquaglyceroporins. Cell Mol Life Sci. 63:1386–1392. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Maeda N, Hibuse T and Funahashi T: Role of aquaporin-7 and aquaporin-9 in glycerol metabolism; involvement in obesity. Handb Exp Pharmacol. 190:233–249. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Badaut J, Brunet JF, Guerin C, Regli L and Pellerin L: Alteration of glucose metabolism in cultured astrocytes after AQP9-small interference RNA application. Brain Res. 1473:19–24. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Hamdi M, Sanchez MA, Beene LC, et al: Arsenic transport by zebrafish aquaglyceroporins. BMC Mol Biol. 10:1042009. View Article : Google Scholar : PubMed/NCBI

24 

Drobna Z, Walton FS, Paul DS, Xing W, Thomas DJ and Styblo M: Metabolism of arsenic in human liver: the role of membrane transporters. Arch Toxicol. 84:3–16. 2010. View Article : Google Scholar : PubMed/NCBI

25 

Leung J, Pang A, Yuen WH, Kwong YL and Tse EWC: Relationship of expression of aquaglyceroporin 9 with arsenic uptake and sensitivity in leukemia cells. Blood. 109:740–746. 2007. View Article : Google Scholar : PubMed/NCBI

26 

Gao L, Gao Y, Li X, et al: Aquaporins mediate the chemoresistance of human melanoma cells to arsenite. Mol Oncol. 6:81–87. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Hibuse T, Maeda N, Nagasawa A and Funahashi T: Aquaporins and glycerol metabolism. Biochim Biophys Acta. 1758:1004–1011. 2006. View Article : Google Scholar

28 

King LS, Kozono D and Agre P: From structure to disease: the evolving tale of aquaporin biology. Nat Rev Mol Cell Biol. 5:687–698. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Parekh S and Anania FA: Abnormal lipid and glucose metabolism in obesity: implications for nonalcoholic fatty liver disease. Gastroenterology. 132:2191–2207. 2007. View Article : Google Scholar : PubMed/NCBI

30 

Shoelson SE, Herrero L and Naaz A: Obesity, inflammation, and insulin resistance. Gastroenterology. 132:2169–2180. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang C, Lv Z, Kang Y, Xiang T, Wang P and Jiang Z: Aquaporin-9 downregulation prevents steatosis in oleic acid-induced non-alcoholic fatty liver disease cell models. Int J Mol Med 32: 1159-1165, 2013.
APA
Wang, C., Lv, Z., Kang, Y., Xiang, T., Wang, P., & Jiang, Z. (2013). Aquaporin-9 downregulation prevents steatosis in oleic acid-induced non-alcoholic fatty liver disease cell models. International Journal of Molecular Medicine, 32, 1159-1165. https://doi.org/10.3892/ijmm.2013.1502
MLA
Wang, C., Lv, Z., Kang, Y., Xiang, T., Wang, P., Jiang, Z."Aquaporin-9 downregulation prevents steatosis in oleic acid-induced non-alcoholic fatty liver disease cell models". International Journal of Molecular Medicine 32.5 (2013): 1159-1165.
Chicago
Wang, C., Lv, Z., Kang, Y., Xiang, T., Wang, P., Jiang, Z."Aquaporin-9 downregulation prevents steatosis in oleic acid-induced non-alcoholic fatty liver disease cell models". International Journal of Molecular Medicine 32, no. 5 (2013): 1159-1165. https://doi.org/10.3892/ijmm.2013.1502
Copy and paste a formatted citation
x
Spandidos Publications style
Wang C, Lv Z, Kang Y, Xiang T, Wang P and Jiang Z: Aquaporin-9 downregulation prevents steatosis in oleic acid-induced non-alcoholic fatty liver disease cell models. Int J Mol Med 32: 1159-1165, 2013.
APA
Wang, C., Lv, Z., Kang, Y., Xiang, T., Wang, P., & Jiang, Z. (2013). Aquaporin-9 downregulation prevents steatosis in oleic acid-induced non-alcoholic fatty liver disease cell models. International Journal of Molecular Medicine, 32, 1159-1165. https://doi.org/10.3892/ijmm.2013.1502
MLA
Wang, C., Lv, Z., Kang, Y., Xiang, T., Wang, P., Jiang, Z."Aquaporin-9 downregulation prevents steatosis in oleic acid-induced non-alcoholic fatty liver disease cell models". International Journal of Molecular Medicine 32.5 (2013): 1159-1165.
Chicago
Wang, C., Lv, Z., Kang, Y., Xiang, T., Wang, P., Jiang, Z."Aquaporin-9 downregulation prevents steatosis in oleic acid-induced non-alcoholic fatty liver disease cell models". International Journal of Molecular Medicine 32, no. 5 (2013): 1159-1165. https://doi.org/10.3892/ijmm.2013.1502
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team