International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Idiopathic pulmonary fibrosis (IPF) is part of a large group of diffuse parenchymal lung diseases, that are characterized by progressive parenchymal fibrosis, without any known cause and poor prognosis. Nogee et al conducted a genetic analysis of a mother (onset age, 1 year) with desquamative interstitial pneumonia (DIP) and a child (onset age, 6 weeks) with non-specific interstitial pneumonia (NSIP), and identified a heterozygous mutation of the surfactant protein C (SP-C) gene (deletion of exon 4, SP-CΔexon4) for the first time (1). SP-C is a component of the pulmonary surfactant, which is a heterogeneous complex of lipids and proteins that lowers lung-surface tension and contributes to the host defense system. The SP-C gene is located on the short arm of chromosome 8, and comprises 6 exons and 5 introns (2). The precursor of SP-C, proSP-C, consists of 197 amino acids and is transformed into mature SP-C (consisting of 24–58 amino acids) through intracellular cleavage and modification (3,4). ProSP-CΔexon4 has been found to induce endoplasmic reticulum (ER) stress (5,6).
Fibrosis is defined by the accumulation of excess extracellular matrix (ECM) components, such as collagen, in and around inflamed or damaged tissue (7,8). Fibrosis can develop in the majority of tissue types, and advanced fibrosis causes fibrotic diseases, such as pulmonary fibrosis, liver cirrhosis and renal fibrosis, resulting in organ dysfunction and eventually death. According to recent studies, synoviolin/HRD1 is involved in liver fibrosis (9) and collagen synthesis in the kidneys (10). Synoviolin, which we have previously cloned (11), is an ER-resident E3 ubiquitin ligase with a RING finger domain that activates the ER-associated degradation (ERAD) pathway (11). Synoviolin is ubiquitously expressed in all organs of the body, particularly in the liver, pancreas and skeletal muscle (12). Synoviolin is upregulated in response to ER stress and the overexpression of human inositol-requiring kinase 1 (IRE1) and activating transcription factor 6 (ATF6) (12,13). We have previously demonstrated that heterozygous synoviolin knockout mice are resistant to CCl4-induced liver fibrosis. In addition, we have demonstrated that collagen secretion is reduced by synoviolin deficiency in mouse embryonic fibroblasts, suggesting the involvement of synoviolin in collagen secretion (9). Li et al (10) demonstrated that synoviolin expression was increased in a mouse model of renal interstitial fibrosis caused by unilateral ureteral obstruction (UUO). In addition, they demonstrated that collagen secretion is reduced by synoviolin deletion in NRK-49F cells (normal rat kidney interstitial fibroblasts) (10). These data suggest that synoviolin expression is increased by ER stress and that synoviolin promotes collagen synthesis. Thus, we hypothesized that synoviolin is involved in lung fibrosis, and in particular, in ER stress-related lung fibrosis. In order to confirm our hypothesis, in the present study, we investigated the involvement of synoviolin and synoviolin inhibitor, LS-102, in collagen secretion in an in vitro model of IPF by transfecting A549 cells (a human lung adenocarcinoma epithelial cell line) with SP-C lacking exon 4.
To investigate our hypothesis that synoviolin is involved in lung fibrosis and that synoviolin inhibitors are candidate antifibrotic agents, we investigated the association between synoviolin and collagen secretion in an in vitro model, in which A549 cells were transfected with SP-CΔexon4, which has been reported to induce ER stress (5,6). In the present study, we did not use any chemical or physical method to induce fibrosis; instead, we focused on an SP-C mutation, SP-CΔexon4, which has been identified in parent-child cases of familial interstitial pneumonia (1).
The A549 human lung adenocarcinoma cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). The A549 cells were cultured in minimum essential medium (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 1% penicillin, 1% streptomycin and 10% (heat-inactivated) fetal bovine serum (FBS).
The wild-type proSP-C expression vector was constructed using pcDNA3-FLAG (Invitrogen, Carlsbad, CA, USA) by the insertion of wild-type proSP-C cDNA that was isolated from a human lung cDNA library (Takara Bio Co., Tokyo, Japan).
SP-CΔexon4 (deletion of exon 4) was constructed according to previously published techniques (14). All constructs were confirmed by DNA sequencing. The A549 cells were grown for 24 h and transfected with wild-type SP-C or mutant SP-C constructs using Lipofectamine 2000 (Invitrogen) as per the manufacturer’s instructions.
The sequences of the synoviolin siRNA and scrambled synoviolin siRNA were identical to those described in a previous study (15), and were chemically synthesized at Hokkaido System Science (Hokkaido, Japan). The A549 cells were seeded at 40–50% confluency in 6-well plates and cultured for 24 h. Subsequently, 50 nmol of annealed RNA duplex was transfected using Lipofectamine 2000 according to the manufacturer’s instructions.
The antibodies used in this study were as follows: anti-synoviolin/HRD1 monoclonal antibody as previously described (11), anti-FLAG antibody (anti-FLAG M2 monoclonal antibody, F3165; Sigma-Aldrich), anti-hemagglutinin-A (HA) 3F10 monoclonal antibody (1867423; Roche Applied Science) and anti-β-actin monoclonal antibody (A5441; Sigma-Aldrich).
Cell cultures were harvested and proteins were extracted using a cell extraction buffer containing 0.05 M Tris-HCl (pH 8.0), 0.15 M NaCl, 5.0 mM ethylenediaminetetraacetic acid (EDTA), 1% NP-40 and protease inhibitors (1 μg/ml leupeptin, 1 μg/ml dithiothreitol (DTT), 1 μg/ml pepstatin and 1.5 μg/ml aprotinin) at 4°C.
The A549 cells were plated on 24-well plates (5×104 cells/well). The synoviolin promoter (SyG-2055/+845 PGV-B2) was prepared as described in a previous study (16). For transient transfection into the A549 cells, 20 ng/well synoviolin promoter and 50 ng/well test plasmids (SP-C1–197 or SP-CΔexon4) were co-transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s recommendations. After 24 h, the cultures were aspirated and the cells were added to 100 μl of passive lysis buffer (Promega, Madison, WI, USA). The cell debris was pelleted and 5 μl of supernatant were collected and immediately analyzed for luciferase activity using the Promega Luciferase assay system (Promega) and a microplate luminometer (Centro XS3 LB 960; Berthold Technologies, Wildbad, Germany). The 5 μl supernatant samples were used to measure the protein concentration in each well using a multi-spectrophotometer (Viento XS; Dainippon Sumitomo Pharma, Tokyo, Japan). The assay was performed in triplicate and the mean values were calculated for each sample. The luciferase activity results were normalized to the protein concentration in each sample.
The A549 cells were seeded at 40–50% confluency in 100-mm plates and harvested 18 h following transfection. Tunicamycin-treated (10 μg/ml) A549 cells were prepared as a model of chemical induction of ER stress. Cellular protein extracts were resolved by 10% SDS-PAGE, transferred onto a nitrocellulose membrane and immunoblotted with anti-synoviolin/HRD1 monoclonal antibodies followed by horseradish peroxidase-conjugated secondary antibodies. The antigen-antibody complexes were visualized using an ECL detection system (Promega). β-actin expression was used as an internal control. Immunoblots were scanned and band densities were quantified using ImageJ software.
The A549 cells were grown in 100-mm culture plates. Forty-eight hours following transfection, total RNA from the A549 cells was isolated using Isogen II (Nippon Gene, Tokyo, Japan) and cDNA was synthesized using RiverTra Ace (Toyobo, Tokyo, Japan) according to the manufacturer’s instructions. Real-time PCR relative quantification analysis was performed to measure the mRNA expression levels of transforming growth factor-β (TGF-β), connective tissue growth factor (CTGF), prolyl 4-hydroxylase subunit alpha 1 (P4HA1), X-box binding protein 1 (XBP1) and synoviolin using the FastStart Universal Probe Master mix (ROX; Roche Applied Science, Indianapolis, IN, USA), primers from the Universal Probe Library Assay Design Center and probes from the universal probe library set (both from Roche Applied Science, Tokyo, Japan) with the Step One Plus Detection System and software (Applied Biosystems, Life Technologies Japan, Tokyo, Japan). The primers and probes used are as follows: TGF-β forward, GCAGCACGTGGAGCTGTA and reverse, CAGCCGGTTGC TGAGGTA (probe: Universal probe library probe #72); CTGF forward, AGCTGACCTGGAAGAGAACATT and reverse, GCTCGGTATGTCTTCATGCTG (probe: Universal probe library probe #71); P4HA1 forward, TCGTCAAAGACCTAG CAAAACC and reverse, CCGTCTCCAAGTCTCCTGTTA (probe: Universal probe library probe #30); XBP1 forward, GGAGTTAAGACAGCGCTTGG and reverse, CACTGG CCTCACTTCATTCC (probe: Universal probe library probe #37); synoviolin forward, TTCGTCAGCCACGCCTAT and reverse, GAGCACCATCGTCATCAGG (probe: Universal probe library probe #89). The protocol included 1 cycle at 95°C for 10 min, followed by 40 cycles at 95°C for 1 sec and 60°C for 20 sec, according to the manufacturer’s recommendations. The mRNA level was normalized relative to the amount of the transcript coding for 18S rRNA.
The A549 cells were seeded at 40–50% confluency in 6-well plates. Twelve hours following transfection, the medium was replaced with serum-free Opti-MEM (Gibco, Life Technologies Japan, Tokyo, Japan) to eliminate the effects of serum on collagen measurement. At 30 h following transfection, the total soluble collagen in the culture supernatants was measured using the Sircol collagen assay method (Biocolor, County Antrim, UK) according to the manufacturer’s instructions. The assay was performed in triplicate and the mean values of each sample were calculated.
The cells were plated on 100-mm tissue culture dishes and MG132 was added at a concentration of 20 μM 24 h following transfection. The cells were co-transfected with hemagglutinin (HA)-tagged ubiquitin (Ub) and an SP-C wild-type, SP-C mutant, or empty vector. Co-transfected with the synoviolin gene were also prepared. Twenty-seven hours following transfection, the cells were harvested and lysed with 200 μl of lysis buffer [50 mM HEPES-KOH (pH 7.9), 150 mM KCl, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride (PMSF), 10% glycerol, 2 μg/ml aprotinin, 2 μg/ml leupeptin, 2 μg/ml pepstatin A and 20 μM MG132 (a proteasome inhibitor)]. Following centrifugation at 5,000 rpm for 10 min, 150 μl of the clear supernatant was incubated with 5 μl of normal mouse IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), 30 μl of protein G-Sepharose (GE Healthcare, Tokyo, Japan) and 350 μl of lysis buffer at 4°C with rotation for 30 min. The supernatant was incubated with 2 μl of anti-FLAG M2 monoclonal antibody at 4°C with rotation for 2 h, after which 40 μl of protein G were added, followed by incubation at 4°C with rotation for 1 h. The immunoprecipitates were solubilized in SDS sample buffer [0.078 M Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 5% 2-mercaptoethanol and 0.003% bromophenol blue] and then subjected to 4–15% gradient SDS-PAGE (Bio-Rad, Hercules, CA, USA).
Synoviolin inhibitor, LS-102, was identified by screening approximately 4 million compounds for potential synoviolin enzyme inhibitors as described in a previous study (5). Dimethyl sulfoxide (DMSO) is used as solvent for LS-102; thus, we used DMSO as a control. Twelve hours following transfection, Opti-MEM (no serum added) was replaced, and LS-102 (5 μM) or DMSO (5 μM) was added to the medium to evaluate the effect of LS-102.
All data are expressed as the means ± standard deviation (SD). Differences between groups were examined using the Student’s t-test and considered statistically significant at P<0.05. All results were derived from at least 3 independent experiments.
Studies have found an association between mutations in the SP-C gene and familial pulmonary fibrosis (1,17,18). Therefore, in this study we focused on the SP-CΔexon4 mutation. To assess the association between the SP-CΔexon4 mutation and fibrosis in the current experimental system, we measured the mRNA expression levels of transforming growth factor-β (TGF-β), connective tissue growth factor (CTGF) and prolyl 4-hydroxylase subunit alpha 1 (P4HA1), which are responsible for enhancing the production of collagen protein, a typical ECM component involved in fibrosis (19–21). Transfection of the cells with the mutant SP-C gene increased the mRNA expression levels of TGF-β, CTGF and P4HA1 by approximately 2.3-, 1.5- and 2.9-fold, respectively, compared to the wild-type (Fig. 1A–C).
Fibrosis is attributed to the excess deposition of ECM components in and around inflamed or damaged tissue (8). Collagen is a major component of the ECM; therefore, we measured collagen secretion following transfection of the cells with mutant SP-C. To confirm that mutant SP-C promoted collagen secretion from mutant SP-C-expressing A549 cells, collagen secretion was measured following transfection with a wild-type or mutant SP-C gene. The A549 cells transfected with the mutant SP-C gene secreted approximately 1.3-fold more collagen into the medium than the cells transfected with wild-type SP-C (Fig. 1D).
To examine the hypothesis that synoviolin plays a role in fibrosis induced by SP-CΔexon4, we evaluated the level of synoviolin expression in SP-CΔexon4-expressing A549 cells. First, we constructed a plasmid carrying a luciferase gene with expression regulated by a synoviolin promoter, which was co-transfected together with the wild-type SP-C or mutant SP-C gene expression plasmid into the A549 cells. Twenty-four hours following transfection, a luciferase assay was conducted. The A549 cells expressing mutant SP-C showed 1.6-fold greater luciferase activity than the wild-type SP-C-expressing cells (Fig. 2A). These data suggest that the transcriptional activity of synoviolin was enhanced in the SP-CΔexon4 gene-transfected cells.
Subsequently, to confirm that ER stress is induced in this experimental system and that the mRNA expression of synoviolin is activated in the mutant SP-C-transfected cells, we examined the expression levels of X-box binding protein 1 (XBP1) and synoviolin in the A549 cells by real-time PCR. The mRNA expression levels of XBP1 and synoviolin were increased in the mutant SP-C-expressing A549 cells in comparison to the wild-type SP-C-expressing cells (Fig. 2B and C).
Finally, to assess the protein expression of synoviolin, we performed western blot analysis with an anti-synoviolin antibody. Transfection of the A549 cells with mutant SP-C increased the protein expression of synoviolin compared with the cells transfected with wild-type SP-C (Fig. 2D). Thus, the overexpression of SP-CΔexon4 in the A549 cells increased the transcriptional activity of synoviolin and the expression of synoviolin at the mRNA and protein levels.
To explore the role of synoviolin in collagen secretion in the A549 cells, we evaluated collagen production in A549 cells following transfection with siRNA targeting synoviolin. We found that the level of soluble secreted collagen in the supernatant of A549 cells after the knockdown of synoviolin was approximately 20% less than that produced by the scrambled siRNA-transfected A549 cells (Fig. 3A). Furthermore, we analyzed the effects of synoviolin siRNA on collagen secretion in SP-CΔexon4-expressing A549 cells. The A549 cells were co-transfected with SP-CΔexon4 and either synoviolin siRNA or scrambled siRNA. The amount of soluble secreted collagen in the supernatant of the synoviolin siRNA-transfected SP-CΔexon4-expressing A549 cells was approximately 30% less than that produced by scrambled siRNA-transfected SP-CΔexon4-expressing A549 cells (Fig. 3B).
To demonstrate the ubiquitination of proSP-CΔexon4, the A549 cells were co-transfected with hemagglutinin (HA)-tagged ubiquitin (Ub) and an SP-C wild-type, SP-C mutant, or empty vector. In addition, to determine whether synoviolin ubiquitinates proSP-CΔexon4 as a substrate, cells co-transfected with the synoviolin gene were also prepared. Following immunoprecipitation with an anti-FLAG antibody, western blot analysis was performed using an anti-HA antibody. The cells transfected with SP-CΔexon4 showed a ladder pattern, suggesting ubiquitination. The synoviolin-containing cells showed a more intense band (Fig. 4). These results suggested that the proSP-CΔexon4 protein was ubiquitinated in this experimental system and that synoviolin may participate in this ubiquitination.
To investigate the effects of synoviolin inhibition on collagen secretion in A549 cells, we performed experiments using the synoviolin inhibitor, LS-102, as described in a previous study of ours (22), in which we identified LS-102 by screening approximately 4 million compounds for potential synoviolin enzyme inhibitors. As a result, LS-101 and LS-102 were identified as compounds that inhibited the autoubiquitination activity of synoviolin. These compounds were administered in a mouse model of collagen-induced arthritis, in which they demonstrated protective effects against arthritis. LS-101 had more potent inhibitory effects on the synoviolin enzyme than LS-102. However, LS-102 was used in this study as it is more selective for synoviolin than LS-101. Twelve hours following transfection, Opti-MEM (no serum added) was replaced, and LS-102 or DMSO (5 μM; as a control) was added to the medium. The tunicamycin (10 μg/ml)-treated A549 cells were also prepared as a positive control for ER stress induction. LS-102 significantly decreased collagen secretion into the medium (Fig. 5).
In the present study, we demonstrated that the expression of synoviolin and collagen secretion were enhanced by the overexpression of SP-CΔexon4 in A549 cells and that collagen secretion was suppressed by the use of the synoviolin inhibitor, LS-102.
The pathogenic mechanisms of fibrosis have recently attracted the attention of researches, and studies have indicated that diverse factors, pathways and systems are involved in the progression of fibrosis. However, the detailed mechanisms involved are not yet fully understood. Wynn et al (8), Tanjore et al (23,24) and Zhong et al (25) reported that various pathways are involved in fibrosis, including the ER-stress pathway, and that ER stress leads to fibrosis. In the present study, we did not use any chemical or physical method to induce fibrosis, but instead we focused on a mutation in SP-C that was identified in mother-child cases of familial interstitial pneumonia, and which produced ER stress in A549 cells. Considering our results in the context of the dual role of synoviolin as an E3 ubiquitin ligase and collagen synthesis promoter, this study suggests the existence of a novel pathway: ER stress increases synoviolin synthesis, which promotes collagen synthesis, contributing to fibrosis. This result confirm the association between ER stress and fibrosis that has been previously reported (23,25). Further studies are required to fully determine the association between synoviolin and fibrosis.
Excessive fibrosis affects various organs and tissues, including the endocardium, the heart, the liver, the kidneys, the skin, the bone marrow, the retroperitoneum and the lungs. Advanced fibrosis is a serious disorder that causes organ dysfunction and death; accordingly, antifibrotic drugs are in development. Various factors [TGF-β, CTGF, tumor necrosis factor (TNF), endothelin, chemokines, chemokine receptors, and matrix metalloproteinases (MMPs)] and effector cells are involved in fibrosis (19,20,26–28). As a result, there are several potential therapeutic vectors which may be used in the treatment of fibrosis, and thus a wide range of candidate therapeutic agents is available (8).
In the present study, we demonstrate that synoviolin expression and collagen secretion are enhanced by transfecting A549 cells with SP-CΔexon4 and that collagen secretion is suppressed by transfection with synoviolin siRNA or the synoviolin inhibitor, LS-102. Based on these findings and the recent studies indicating that synoviolin is involved in liver fibrosis (9) and renal fibrosis (10), our data suggest that the synoviolin inhibitor, LS-102 represents a candidate antifibrotic agent for the treatment of interstitial pneumonia; however, further studies, including in vivo studies, are required in order to confirm this therapeutic potential.
We thank the staff at the Future Medical Science at the Institute of Medical Science and the Integrated Gene Editing Section of Tokyo Medical University for their assistance. This study was funded in part by grants from the Naito Foundation, Natural Science Scholarship Daiichi-Sankyo Foundation of Life Science, Mitsubishi Tanabe Pharma Corporation, Bureau of Social Welfare and Public Health, The Ministry of Health Labour and Welfare, The Ministry of Education, Culture, Sports, Science and Technology, Japan Society for the Promotion of Science, Health Labour Sciences Research Grant, Takeda Science Foundation, AstraZeneca R&D Grant 2013, Grant-in-Aid for Exploratory Research, Grant-in-Aid for Young Scientists (B).
|
Nogee LM, Dunbar AE III, Wert SE, Askin F, Hamvas A and Whitsett JA: A mutation in the surfactant protein C gene associated with familial interstitial lung disease. N Engl J Med. 344:573–579. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Beers MF and Mulugeta S: Surfactant protein C biosynthesis and its emerging role in conformational lung disease. Annu Rev Physiol. 67:663–696. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Mulugeta S and Beers MF: Surfactant protein C: its unique properties and emerging immunomodulatory role in the lung. Microbes Infect. 8:2317–2323. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Nogee LM: Genetics of the hydrophobic surfactant proteins. Biochim Biophys Acta. 1408:323–333. 1998. View Article : Google Scholar : PubMed/NCBI | |
|
Mulugeta S, Nguyen V, Russo SJ, Muniswamy M and Beers MF: A surfactant protein C precursor protein BRICHOS domain mutation causes endoplasmic reticulum stress, proteasome dysfunction, and caspase 3 activation. Am J Respir Cell Mol Biol. 32:521–530. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Maguire JA, Mulugeta S and Beers MF: Endoplasmic reticulum stress induced by surfactant protein C BRICHOS mutants promotes proinflammatory signaling by epithelial cells. Am J Respir Cell Mol Biol. 44:404–414. 2011. View Article : Google Scholar : | |
|
Wynn TA: Cellular and molecular mechanisms of fibrosis. J Pathol. 214:199–210. 2008. View Article : Google Scholar | |
|
Wynn TA and Ramalingam TR: Mechanisms of fibrosis: therapeutic translation for fibrotic disease. Nat Med. 18:1028–1040. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Hasegawa D, Fujii R, Yagishita N, et al: E3 ubiquitin ligase synoviolin is involved in liver fibrogenesis. PLoS One. 5:e135902010. View Article : Google Scholar : PubMed/NCBI | |
|
Li Shen LY, Ding Y, Liu Y, Su D and Liang X: Hrd1 participates in the regulation of collagen I synthesis in renal fibrosis. Mol Cell Biochem. 386:35–44. 2014. View Article : Google Scholar | |
|
Amano T, Yamasaki S, Yagishita N, et al: Synoviolin/Hrd1, an E3 ubiquitin ligase, as a novel pathogenic factor for arthropathy. Genes Dev. 17:2436–2449. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Kaneko M, Ishiguro M, Niinuma Y, Uesugi M and Nomura Y: Human HRD1 protects against ER stress-induced apoptosis through ER-associated degradation. FEBS Lett. 532:147–152. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Kaneko M and Nomura Y: ER signaling in unfolded protein response. Life Sci. 74:199–205. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Wang WJ, Mulugeta S, Russo SJ, et al: Deletion of exon 4 from human surfactant protein C results in aggresome formation and generation of a dominant negative. J Cell Sci. 116:683–692. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Yamasaki S, Yagishita N, Sasaki T, et al: Cytoplasmic destruction of p53 by the endoplasmic reticulum-resident ubiquitin ligase ‘Synoviolin’. EMBO J. 26:113–122. 2007. View Article : Google Scholar | |
|
Tsuchimochi K, Yagishita N, Yamasaki S, et al: Identification of a crucial site for synoviolin expression. Mol Cell Biol. 25:7344–7356. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Nogee LM, Dunbar AE III, Wert S, Askin F, Hamvas A and Whitsett JA: Mutations in the surfactant protein C gene associated with interstitial lung disease. Chest. 121:S20S–S21. 2002. View Article : Google Scholar | |
|
Thomas AQ, Lane K, Phillips J III, et al: Heterozygosity for a surfactant protein C gene mutation associated with usual interstitial pneumonitis and cellular nonspecific interstitial pneumonitis in one kindred. Am J Respir Crit Care Med. 165:1322–138. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Border WA and Noble NA: Transforming growth factor beta in tissue fibrosis. N Engl J Med. 331:1286–1292. 1994. View Article : Google Scholar : PubMed/NCBI | |
|
Bonniaud P, Margetts PJ, Kolb M, Haberberger T, Kelly M, Robertson J and Gauldie J: Adenoviral gene transfer of connective tissue growth factor in the lung induces transient fibrosis. Am J Respir Crit Care Med. 168:770–778. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Myllyharju J: Prolyl 4-hydroxylases, the key enzymes of collagen biosynthesis. Matrix Biol. 22:15–24. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Yagishita N, Aratani S, Leach C, et al: RING-finger type E3 ubiquitin ligase inhibitors as novel candidates for the treatment of rheumatoid arthritis. Int J Mol Med. 30:1281–1286. 2012.PubMed/NCBI | |
|
Tanjore H, Cheng DS, Degryse AL, Zoz DF, Abdolrasulnia R, Lawson WE and Blackwell TS: Alveolar epithelial cells undergo epithelial-to-mesenchymal transition in response to endoplasmic reticulum stress. J Biol Chem. 286:30972–30980. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Tanjore H, Lawson WE and Blackwell TS: Endoplasmic reticulum stress as a pro-fibrotic stimulus. Biochim Biophys Acta. 1832:940–947. 2013. View Article : Google Scholar : | |
|
Zhong Q, Zhou B, Ann DK, et al: Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. Am J Respir Cell Mol Biol. 45:498–509. 2011. View Article : Google Scholar : | |
|
Hogaboam CM, Steinhauser ML, Chensue SW and Kunkel SL: Novel roles for chemokines and fibroblasts in interstitial fibrosis. Kidney Int. 54:2152–2159. 1998. View Article : Google Scholar : PubMed/NCBI | |
|
Arai M, Ikawa Y, Chujo S, et al: Chemokine receptors CCR2 and CX3CR1 regulate skin fibrosis in the mouse model of cytokine-induced systemic sclerosis. J Dermatol Sci. 69:250–258. 2013. View Article : Google Scholar | |
|
Fernandez IE and Eickelberg O: New cellular and molecular mechanisms of lung injury and fibrosis in idiopathic pulmonary fibrosis. Lancet. 380:680–688. 2012. View Article : Google Scholar : PubMed/NCBI |