MicroRNA-153 suppresses the osteogenic differentiation of human mesenchymal stem cells by targeting bone morphogenetic protein receptor type II

  • Authors:
    • Yujing Cao
    • Qiuxia Lv
    • Cuitian Lv
  • View Affiliations

  • Published online on: July 7, 2015     https://doi.org/10.3892/ijmm.2015.2275
  • Pages: 760-766
Metrics: HTML 0 views | PDF 0 views     Cited By (CrossRef): 0 citations

Abstract

Elucidation of the molecular mechanisms governing the osteogenic differentiation of human mesenchymal stem cells (hMSCs) is of great importance for improving the treatment of bone-related diseases. MicroRNAs (miRNAs or miRs), a class of small non-coding RNAs, are critical in a number of biological processes, including the proliferation, differentiation and survival of cells and organisms. Emerging evidence indicates that miRNAs are essential in regulating osteoblastogenesis and bone formation. However, the role of miRNAs in osteoblast mechanotransduction remains to be defined. The present study aimed to examine the role of miR-153 in the osteogenesis of hMSCs and to investigate the impact of miR-153 on bone morphogenetic protein receptor type II (BMPR2) expression. The overexpression of miR-153 inhibited the osteogenic differentiation of hMSCs, whereas downregulation of miR-153 enhanced the process. Furthermore, bioinformatic analysis predicted that miR-153 is a potential regulator of BMPR2. The direct binding of miR-153 to the BMPR2 3'-untranslated region (3'-UTR) was demonstrated by a luciferase reporter assay using a construct containing the BMPR2 3'-UTR. In addition, knockdown of BMPR2 by RNA interference inhibited the osteogenic differentiation of hMSCs, with a similar effect to the upregulation of miR-153. In conclusion, the results suggest that miR-153 is a mechano-sensitive miRNA that regulates osteoblast differentiation by directly targeting BMPR2, and that therapeutic inhibition of miR-153 may be an efficient anabolic strategy for skeletal disorders caused by pathological mechanical loading.

Introduction

Fracture healing is a physiological process of repair that proceeds in stages, each characterized by a different predominant tissue in the fracture gap. Chondrogenesis as well as osteogenesis in fracture healing and is downregulated in the later phase of osteogenesis, as osteoblasts mature to osteocytes. In addition, neurotrophins and their receptors may be of importance to osteoblasts and endothelial cells during fracture healing. Cell viability, osteoblast differentiation, and gene expression are altered in human osteoblasts from hypertrophic fracture non-unions. For fracture non-unions that do not heal after appropriate surgical intervention, the question arises as to what extent systemic cellular dysfunction is a pathogenic factor.

Mesenchymal stem cells (MSCs) are multipotent stromal cells that can differentiate into a variety of unique mesenchymal cell types, such as osteoblasts, chondrocytes and adipocytes (1). Human MSCs (hMSCs) have been reported to be a population of self-renewing multipotent cells that may have clinical therapeutic potential (2,3). They can differentiate into several lineages, including osteoblasts, in response to stimulation by multiple environmental factors (4). Skeletal development and homeostasis are dependent on the activity of osteoblasts derived from MSCs. In addition, bone development is delicately regulated by homeostasis, which is maintained by the balance between osteoblasts and adipocytes (5). MSCs have emerged as key regulators of various biological and pathological processes, and disruption of this differentiation balance leads to various bone-related metabolic diseases.

MicroRNAs (miRNAs or miRs) are an abundant class of small (18–25 nucleotides) non-coding single-stranded RNAs found in diverse organisms. miRNAs have emerged as important post-transcriptional regulators of gene expression (68). They negatively regulate the translation of specific mRNAs by base pairing with partially or fully complementary sequences in target mRNAs (69). Although the biological functions of the majority of miRNAs are not yet fully understood, they may be essential in the regulation of various biological processes, including cell proliferation (10,11), apoptosis (12), cell differentiation (13) and tumor formation (14,15). An increasing number of miRNAs have been found to positively regulate osteoblast differentiation and bone formation by targeting negative regulators of osteogenesis or negatively by targeting important osteogenic factors (1619). The effect of miRNAs has also been investigated in the osteogenesis of hMSCs. A recent study demonstrated that miRNAs target the principal transcription factors and signaling molecules involved in osteoblast differentiation of MSCs and osteoblast functions (20). miRNAs may thus represent novel therapeutic targets for pharmacological control of bone cell functions and enhancing bone formation.

In the present study, it was investigated whether microRNA-153 (miR-153) was involved in the osteoblastic differentiation of hMSCs. The expression of miRNAs during osteogenic differentiation of hMSCs was assessed and miR-153 was found to be significantly downregulated. Furthermore, bioinformatics analysis was conducted using PicTar, TargetScan and microRNA.org to predict the miRNAs that bind to the bone morphogenetic protein receptor type II (BMPR2) 3′-untranslated region (3′-UTR). Among the candidates, miR-153 was selected for further investigation. The regulation of BMPR2 by miR-153 was verified by the construction of deletion mutants, a luciferase reporter assay, reverse transcription-quantitative polymerase chain reaction (RT-qPCR), and western blot analysis. The potential role of miR-153 in osteoblast differentiation was also investigated using alkaline phosphatase (ALP) staining and Alizarin Red staining (ARS).

Materials and methods

hMSC isolation and culture

Nine bone marrow samples from young subjects (<30 years old) and seven bone marrow samples from older subjects (>60 years old) with slight or severe osteoporosis were obtained, from which hMSCs were isolated and identified by cell surface markers, as previously described (21). hMSCs were cultured in α-Minimum Essential Medium (α-MEM; HyClone, Salt Lake City, UT, USA), supplemented with 10% fetal bovine serum (FBS; Gibco Invitrogen, Carlsbad, CA, USA) and 1% penicillin and streptomycin (Gibco Invitrogen). The cells were incubated at 37°C in a 95% humidity incubator with 5% CO2. The study was approved by the Ethics Committee of Henan Hospital of Traditional Chinese Medicine. Informed consent was signed by the participants.

Osteogenic differentiation

hMSCs were plated at a cell density of 1×105 cells in 12-well plates. At 80% confluence, medium was replaced with osteoblast-specific induction medium containing high-glucose Dulbecco's modified Eagle's medium (DMEM), 10% FBS, 5 mM β-glycerophosphate, 100 nM dexamethasone, and 50 µg/ml ascorbic acid (all purchased from Sigma-Aldrich, St. Louis, MO, USA) to induce differentiation. hMSCs were cultured in induction medium for 15 days. The induction medium was changed every 3 days.

RNA extraction RT-qPCR

Total RNA was isolated with TRIzol reagent according to the manufacturer's instructions (Invitrogen Life Technologies, Carlsbad, CA, USA). The purity and concentration of total RNA were determined in an Ultraviolet Spectrophotometer (Eppendorf, Hamburg, German). cDNA was synthesized from 1 µg total RNA using a Reverse Transcription kit (ReverTra Dash; Toyobo, Tokyo, Japan) according to the manufacturer's instructions. qPCR was conducted using an ABI 7500 Real-Time PCR system (Applied Biosystems, Carlsbad, CA, USA). The reaction (20 µl) contained the cDNA synthesized earlier, forward and reverse primers, and SYBR-Green PCR MasterMix (Applied Biosystems). The amplification conditions were 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 sec, and annealing and extension at 60°C for 1 min. Relative expression of mRNA or microRNA was evaluated using the 2−ΔΔCt method and normalized to the expression of β-actin or U6, respectively. The primers for the genes are listed in Table I.

Table I

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Table I

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

NameForward (5′-3′)Reverse (5′-3′)
ALP GACAAGAAGCCCTTCACTGC AGACTGCGCCTGGTAGTTGT
OC TGCTTGTGACGAGCTATCAG GAGGACAGGGAGGATCAAGT
COL1A1 GCAACAGTCGCTTCACCTACA CAATGTCCAAGGGAGCCACAT
BMPR2 CATTCGCTCAAGCAGTTTAGTGGAC GGTTCTGAAGCATTTCCTGGGC
U6 CGCTTCACGAATTTGCGTGTCAT GCTTCGGCAGCACATATACTAAAAT
β-actin AGATGTGGATCAGCAAGCAG GCGCAAGTTAGGTTTTGTCA

[i] ALP, alkaline phosphatase; OC, osteocalcin; COL1A1, collagen type I, BMPR2, bone morphogenetic protein receptor type II.

Western blot analysis

Cells were lysed in radioimmunoprecipitation assay buffer with protease inhibitors (Roche Diagnostics, Indianapolis, IN, USA). Protein concentrations were determined using a Pierce BCA Protein Assay kit (Thermo Fisher Scientific, Inc., Logan, UT, USA). Equal quantities of protein were loaded and separated on 10% SDS-PAGE, and then transferred to a polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA). Non-specific protein interactions were blocked by incubation with 3% fat-free milk in Tris-buffered saline buffer (containing 150 mM NaCl and 50 mM Tris-HCl, pH 7.6) at 4°C for 1 h. The membranes were incubated with the following primary antibodies: Anti-BMPR2 antibody (1:1,000; Cell Signaling Technology, Beverly, MA, USA), anti-ALP antibody (1:100) or anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:2,000) antibody (both from Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) at 4°C overnight. Unbound antibody was removed by washing in TBS with Tween-20 (TBST) three times (10 min/wash). The membranes were incubated with horseradish p eroxide-conjugated secondary antibodies (Zhongshan, Beijing, China) at 25°C for 1 h, and followed by washing with TBST buffer three times (10 min/wash). The blots were developed with chemiluminescent ECL reagent (Millipore). GAPDH was used as an internal control.

ALP staining

The osteoblast phenotype was evaluated by determining ALP activity. ALP staining was performed using an ALP staining kit (Institute of Hematology, Chinese Academy of Medical Sciences, Beijing, China) followed by the accessory procedure. Cells seeded in 24-well plates were transfected with miR-153 inhibitor or mimics and the respective negative control (GenePharma, Inc., Shanghai, China) using Lipofectamine™ 2000 (Invitrogen). Prior to staining, the transfected cells were fixed in 10% paraformaldehyde for 10 min at 25°C. After washing with phosphate-buffered saline (PBS), t he cells were stained usi ng 300 µg/ml BCIP/NBT solution (Thermo Fisher Scientific, Inc.) for 20 min at 25°C. ALP-positive cells were stained blue/purple.

ARS mineralization assay

ARS was performed to detect calcification during late induction. Cells seeded in 24-well plates were transfected with miR-153 inhibitor or mimics and the respective negative control using Lipofectamine™2000. After cells had been fixed in 5% paraformaldehyde for 10 min, samples were evaluated by ARS staining. Briefly, cells were stained with 2% Alizarin Red (pH 7.2) for 15 min and then washed twice with PBS. Orange and red bodies were identified as calcium nodules.

Dual luciferase reporter genes construct

A 94-bp fragment of the BMPR2 3′-UTR containing the predicted binding site for miR-153 was amplified by PCR from human genomic DNA. The sequence for the mutation of the miR-153 binding sites was introduced using the fast mutation kit (NEB, Ipswich, MB, Canada) according to the manufacturer's instructions. The constructed plasmids were termed BMPR2-WT (BMPR2-wild-type) and BMPR2-Mut (BMPR2-mutation), respectively. The fragment was purified and inserted into a pRL-TK vector (Promega Corporation, Madison, WI, USA) between XhoI and NotI cleavage sites.

Dual luciferase reporter assay

Luciferase assays were performed according to a previously published protocol. Cells were co-transfected with the wild-type BMPR2 3′-UTR (WT) or (Mut) and miR-153 mimic or the control mimic using Lipofectamine™2000 reagent according to the manufacturer's instructions. After transfection (48 h), cells were collected and luciferase activity was assayed for Renilla and Firefly luciferase activity using the Dual-Luciferase Reporter assay system (Promega Corportation), and each experiment was repeated in triplicate.

Statistical analysis

All data are presented as the mean ± standard deviation (n≥3). Differences between groups were analyzed via Student's t-test using SPSS 16.0 (SPSS Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

miR-153 decreases during osteogenic differentiation

Initially the changes in miR-153 expression during osteogenic differentiation were examined using RT-qPCR. hMSCs were used as a cell model and osteogenic differentiation was induced. Several osteogenic factors, such as ALP, osteocalcin (OC) and collagen type I (COL1A1), were used as phenotypic marker genes of osteogenic differentiation. There was a marked increase in ALP, OC and COL1A1 mRNA levels in the induced cells, suggesting successful induction of osteogenic differentiation (Fig. 1A). It was also identified that the miR-153 levels were significantly lower in the induced cells compared with the non-induced cells (Fig. 1B). These data suggest that miR-153 may negatively regulate osteogenic differentiation.

miR-153 suppresses osteogenic differentiation of hMSCs

To further investigate the role of miR-153 in osteogenic differentiation, hMSCs were transfected with miR-153 inhibitor or mimics and the respective negative control; and then the capacity for osteogenesis was examined. The effect of the miR-153 mimic/inhibitor was determined by RT-qPCR. The expression of miR-153 was decreased after transfection of miR-153 inhibitor, and increased after transfection of miR-153 mimics (Fig. 2A). In addition, all of the osteogenic differentiation markers examined were significantly increased following transfection of the miR-153 inhibitors (Fig. 2B). By contrast, hMSCs transfected with miR-153 mimics showed decreased expression of ALP, OC and COL1A1 compared with those transfected with the negative control (Fig. 2C). At 6 day of differentiation, ALP staining (Fig. 2D upper) was more intense in the cells transfected with the miR-153 inhibitor when compared with the cells transfected with control inhibitor. Furthermore, the staining of the cells transfected with miR-153 mimic was less intense than those transfected with the control mimic (Fig. 2E upper). ARS (Fig. 2D and E lower) on day 15 showed the same tendency at the matrix mineralization level. These results indicate that miR-153 could suppress osteogenic differentiation.

BMPR2 is a direct target of miR-153

It is well known that miRNAs act by suppressing the expression of their target genes. Among the predicted candidates, BMPR2 was identified, which is a kinase receptor of BMPs with an established role in osteogenesis (22,23). To understand the molecular mechanisms underlying the effects of BMPR2, bioinformatics analyses using miRNA target analysis tools PicTar (http://www.pictar.org/cgi-bin/PicTar_vertebrate.cgi), TargetScan (http://www.targetscan.org/), and microRNA.org (http://www.microrna.org/microrna/home.do) were performed to predict the putative miRNAs that bind to the BMPR2 3′-UTR. According to the analysis, the three programs all predicted that the binding sequence in the 3′-UTR of BMPR2 was a match for the miR-153 seed (Fig. 3A and B). The miR-153 target site in the 3′-UTR of BMPR2 is highly conserved among vertebrates (Fig. 3C). These data indicate that the translation of BMPR2 protein may be regulated by miR-153.

miR-153 inhibits BMPR2 expression

To confirm the targeting of BMPR2 by miR-153, a luciferase reporter assay was performed. The pRL-TK vector contains Renilla luciferase and firefly luciferase genes. Firefly luciferase was used as an internal control and Renilla luciferase was linked with 3′-UTR sequences as a reporter. The luciferase activity assay (Fig. 4A) showed that the luciferase activity in BMPR2-WT transfected cells was significantly decreased in miR-153 mimic co-transfected cells compared with that in control co-transfected cells. In addition, site-directed mutagenesis of the seed region abolished the inhibitory effect of miR-153 mimics and Mut luciferase activity did not change. These results indicate that miR-153 significantly suppressed the activity of WT but not Mut BMPR2 3′-UTR in hMSCs. Overexpression of miR-153 significantly suppressed the protein level of BMPR2, while inhibition of miR-153 elevated the protein level of BMPR2 in hMSCs (Fig. 4B and C). These results reveal that miR-153 could negatively regulate BMPR2 expression through a partially complementary binding site in the 3′-UTR of BMPR2.

miR-153 suppresses osteogenic differentiation by targeting BMPR2

Since miR-153 could suppress osteogenic differentiation and inhibit BMPR2 expression, it was further explored whether inhibition of BMPR2 by siRNA could also have a similar effect as miR-153 overexpression on osteogenic differentiation of cells. The effect of BMPR2 siRNA was confirmed by RT-qPCR (Fig. 5A) and western blot analysis (Fig. 5B and C). As expected, cells transfected with BMPR2 siRNA showed a similar effect to cells transfected with miR-153 mimic (Figs. 2B and 5D). Furthermore, co-transfection of miR-153 mimic with BMPR2 overexpression plasmid attenuated the effect of miR-153 on the osteogenic differentiation of cells (Fig. 5E). These results indicate that miR-153 regulates osteogenic differentiation of cells through BMPR2.

Discussion

Bone homeostasis involves a balance between bone formation and bone absorption by osteoblasts and osteoclasts respectively (24). A growing body of evidence has revealed that miRNAs are critical in normal biological processes and the pathogenesis of human diseases by post-transcriptionally regulating gene expression (25). A number of miRNAs have been emerging as important negative or positive regulators of post-transcriptional gene expression and are considered critical for osteogenesis (26). For example, miR-34 was reported to inhibit osteoblast differentiation by targeting Special AT-rich sequence-binding protein 2 (27). miR-100 suppressed osteoblast differentiation by inhibiting BMPR2 (28). miR-133 and miR-135 functionally inhibit osteoprogenitor differentiation by abolishing Runx2 and SMAD family member 5 (Smad5) pathways, which contributed to bone formation synergistically (29). Sp7 has recently been identified as a key regulator of osteoblast differentiation, and was reported to be regulated by miR-93, miR-125b, miR-214 and miR-637 (3033). miRNAs are endogenous small noncoding RNAs that regulate the activities of target mRNAs and cellular processes. Although no miRNA has been reported to be important in the regulation of fracture healing, several miRNAs control key elements in tissue repair processes, such as inflammation, hypoxia response, angiogenesis, stem cell differentiation, osteogenesis, and chondrogenesis. In this study, miR-153 was identified as a suppressive regulator of osteogenic differentiation. It was demonstrated that miR-153 was downregulated during the osteogenic differentiation of cells. Overexpression of miR-153 inhibited osteogenic differentiation, whereas inhibition of miR-153 enhanced the osteogenic potential.

It has been reported that miR-153 is important in a number of types of cancer (34,37). However, its effects do not appear to be consistent. miR-153 suppresses tumor growth in glioblastoma (34), epithelial cancer (35) and leukemia (36). Conversely, in prostate cancer, miR-153 promotes cell proliferation via downregulation of the PTEN tumor suppressor gene (37). However, the role of miR-153 in the regulation of osteoblastic differentiation remains poorly understood. In the present study, a novel role of miR-153 in the osteogenesis of cells was identified. To investigate the molecular mechanism by which miR-153 regulates the osteogenic differentiation of cells, potential target genes were analyzed that have an established function in promoting osteogenesis using the target prediction tools, PicTar, TargetScan and microRNA.org. The results revealed that BMPR2 may be a possible target with a 9-nt non-consecutive match site complementary to miR-153 in its 3′-UTR. It was demonstrated that overexpression of miR-153 resulted in the suppression of BMPR2 expression, whereas functional inhibition of miR-153 led to elevation of BMPR2, strongly suggesting that BMPR2 is regulated by miR-153. In addition, the dual luciferase reporter assay also identified BMPR2 as a direct target of miR-153. Supplementing BMPR2 could also partially reverse the suppressive effect of miR-153 on osteoblastic differentiation. These data suggest that miR-153 may negatively regulate osteogenic differentiation partially by targeting BMPR2.

BMP signaling has been reported to be important in the commitment of human adipose-derived mesenchymal stem cell (hASC) osteogenic differentiation (38) and BMPs have important clinical significance serving as strong osteoinductive factors for bone tissue repair and regeneration (39). BMP signaling is initiated by the binding of extracellular BMPR, resulting in BMPR2-mediated activation of the BMPR1, which, in turn, causes the phosphorylation and activation of intracellular Smad signaling molecules, and then activates osteoblast-essential genes (23). These studies indicated that BMPR2 may be a crucial factor in the pathway of osteogenic differentiation. BMP2 is key in skeletal development, repair and regeneration. In the present study, it was demonstrated that miR-153 negatively targets BMPR2 and suppresses osteogenic differentiation.

In conclusion, the data indicate that miR-153 is a novel regulator of BMPR2 and that it serves as a suppressor of osteogenic differentiation. Thus, BMPR2 and miR-153 may be potential therapeutic targets in the management of skeletal diseases.

References

1 

Bruder SP, Fink DJ and Caplan AI: Mesenchymal stem cells in bone development, bone repair, and skeletal regeneration therapy. J Cell Biochem. 56:283–294. 1994. View Article : Google Scholar : PubMed/NCBI

2 

Locke M, Feisst V and Dunbar PR: Concise review: human adipose-derived stem cells: separating promise from clinical need. Stem Cells. 29:404–411. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Wang S, Qu X and Zhao RC: Mesenchymal stem cells hold promise for regenerative medicine. Front Med. 5:372–378. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Gimble JM and Guilak F: Differentiation potential of adipose derived adult stem (ADAS) cells. Curr Top Dev Biol. 58:137–160. 2003. View Article : Google Scholar

5 

Mathieu PS and Loboa EG: Cytoskeletal and focal adhesion influences on mesenchymal stem cell shape, mechanical properties, and differentiation down osteogenic, adipogenic, and chondrogenic pathways. Tissue Eng Part B Rev. 18:436–444. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Eskildsen T, Taipaleenmäki H, Stenvang J, Abdallah BM, Ditzel N, Nossent AY, Bak M, Kauppinen S and Kassem M: MicroRNA-138 regulates osteogenic differentiation of human stromal (mesenchymal) stem cells in vivo. Proc Natl Acad Sci USA. 108:6139–6144. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Dong J, Cui X, Jiang Z and Sun J: MicroRNA-23a modulates tumor necrosis factor-alpha-induced osteoblasts apoptosis by directly targeting Fas. J Cell Biochem. 114:2738–2745. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Hu R, Li H, Liu W, Yang L, Tan YF and Luo XH: Targeting miRNAs in osteoblast differentiation and bone formation. Expert Opin Ther Targets. 14:1109–1120. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Inose H, Ochi H, Kimura A, et al: A microRNA regulatory mechanism of osteoblast differentiation. Proc Natl Acad Sci USA. 106:20794–20799. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Laneve P, Di Marcotullio L, Gioia U, Fiori ME, Ferretti E, Gulino A, Bozzoni I and Caffarelli E: The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells. Proc Natl Acad Sci USA. 104:7957–7962. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Wang X, Tang S, Le SY, Lu R, Rader JS, Meyers C and Zheng ZM: Aberrant expression of oncogenic and tumor-suppressive microRNAs in cervical cancer is required for cancer cell growth. PLoS One. 3:e25572008. View Article : Google Scholar : PubMed/NCBI

12 

Song G, Zhang Y and Wang L: MicroRNA-206 targets notch3, activates apoptosis, and inhibits tumor cell migration and focus formation. J Biol Chem. 284:31921–31927. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Kawasaki H and Taira K: Hesl is a target of microRNA-23 during retinoic-acid-induced neuronal differentiation of NT2 cells. Nature. 423:838–842. 2003. View Article : Google Scholar : PubMed/NCBI

14 

Sun T, Wang Q, Balk S, Brown M, Lee GS and Kantoff P: The role of microRNA-221 and microRNA-222 in androgen-independent prostate cancer cell lines. Cancer Res. 69:3356–3363. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Kumar MS, Lu J, Mercer KL, Golub TR and Jacks T: Impaired microRNA processing enhances cellular transformation and tumorigenesis. Nat Genet. 39:673–677. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Dong S, Yang B, Guo H and Kang F: MicroRNAs regulate osteogenesis and chondrogenesis. Biochem Biophys Res Commun. 418:587–591. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Li H, Xie H, Liu W, et al: A novel microRNA targeting HDAC5 regulates osteoblast differentiation in mice and contributes to primary osteoporosis in humans. J Clin Invest. 119:3666–3677. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Guo J, Ren F, Wang Y, et al: miR-764-5p promotes osteoblast differentiation through inhibition of CHIP/STUB1 expression. J Bone Miner Res. 27:1607–1618. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Gao J, Yang T, Han J, Yan K, Qiu X, Zhou Y, Fan Q and Ma B: MicroRNA expression during osteogenic differentiation of human multipotent mesenchymal stromal cells from bone marrow. J Cell Biochem. 112:1844–1856. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Taipaleenmäki H, Bjerre Hokland L, Chen L, Kauppinen S and Kassem M: Mechanisms in endocrinology: micro-RNAs: targets for enhancing osteoblast differentiation and bone formation. Eur J Endocrinol. 166:359–371. 2012. View Article : Google Scholar

21 

Zhang JF, Li G, Meng CL, Dong Q, Chan CY, He ML, Leung PC, Zhang YO and Kung HF: Total favonoids of Herba Epimedii improves osteogenesis and inhibits osteoclastogenesis of human mesenchymal stem cells. Phytomedicine. 16:521–529. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Balint E, Lapointe D, Drissi H, van der Meijden C, Young DW, van Wijnen AJ, Stein JL, Stein GS and Lian JB: Phenotype discovery by gene expression profiling: Mapping of biological processes linked to BMP-2-mediated osteoblast differentiation. J Cell Biochem. 89:401–426. 2003. View Article : Google Scholar : PubMed/NCBI

23 

Wang A, Ding X, Sheng S and Yao Z: Bone morphogenetic protein receptor in the osteogenic differentiation of rat bone marrow stromal cells. Yonsei Med J. 51:740–745. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Hu W, Ye Y, Zhang W, Wang J, Chen A and Guo F: miR-142-3p promotes osteoblast differentiation by modulating Wnt signaling. Mol Med Rep. 7:689–693. 2013.

25 

Lamouille S, Subramanyam D, Blelloch R and Derynck R: Regulation of epithelial-mesenchymal and mesenchymal-epithelial transitions by microRNAs. Curr Opin Cell Biol. 25:200–207. 2013. View Article : Google Scholar : PubMed/NCBI

26 

Lian JB, Stein GS, van Wijnen AJ, Stein JL, Hassan MQ, Gaur T and Zhang Y: MicroRNA control of bone formation and homeostasis. Nat Rev Endocrinol. 8:212–227. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Wei J, Shi Y, Zheng L, Zhou B, Inose H, Wang J, Guo XE, Grosschedl R and Karsenty G: miR-34s inhibit osteoblast proliferation and differentiation in the mouse by targeting SATB2. J Cell Biol. 197:509–521. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Zeng Y, Qu X, Li H, Huang S, Wang S, Xu Q, Lin R, Han Q, Li J and Zhao RC: MicroRNA-100 regulates osteogenic differentiation of human adipose-derived mesenchymal stem cells by targeting BMPR2. FEBS Lett. 586:2375–2381. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Li Z, Hassan MQ, Volinia S, van Wijnen AJ, Stein JL, Croce CM, Lian JB and Stein GS: A microRNA signature for a BMP2-induced osteoblast lineage commitment program. Proc Natl Acad Sci USA. 105:13906–13911. 2008. View Article : Google Scholar : PubMed/NCBI

30 

Yang L, Cheng P, Chen C, He HB, Xie GQ, Zhou HD, Xie H, Wu XP and Luo XH: miR-93/Sp7 function loop mediates osteoblast mineralization. J Bone Miner Res. 27:1598–1606. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Goettsch C, Rauner M, Pacyna N, Hempel U, Bornstein SR and Hofbauer LC: miR-125b regulates calcification of vascular smooth muscle cells. Am J Pathol. 179:1594–1600. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Shi K, Lu J, Zhao Y, Wang L, Li J, Qi B, Li H and Ma C: MicroRNA-214 suppresses osteogenic differentiation of C2C12 myoblast cells by targeting Osterix. Bone. 55:487–494. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Zhang JF, Fu WM, He ML, et al: MiR-637 maintains the balance between adipocytes and osteoblasts by directly targeting Osterix. Mol Biol Cell. 22:3955–3961. 2011. View Article : Google Scholar : PubMed/NCBI

34 

Zhao S, Deng Y, Liu Y, Chen X, Yang G, Mu Y, Zhang D, Kang J and Wu Z: MicroRNA-153 is tumor suppressive in glioblastoma stem cells. Mol Biol Rep. 40:2789–2798. 2013. View Article : Google Scholar : PubMed/NCBI

35 

Xu Q, Sun Q, Zhang J, Yu J, Chen W and Zhang Z: Downregulation of miR-153 contributes to epithelial-mesenchymal transition and tumor metastasis in human epithelial cancer. Carcinogenesis. 34:539–549. 2012. View Article : Google Scholar : PubMed/NCBI

36 

Liu L, Chen R, Huang S, Wu Y, Li G, Zhang B, Liu Q, Yin D and Liang Y: miR-153 sensitized the K562 cells to As2O3-induced apoptosis. Med Oncol. 29:243–247. 2012. View Article : Google Scholar

37 

Wu Z, He B, He J and Mao X: Upregulation of miR-153 promotes cell proliferation via downregulation of the PTEN tumor suppressor gene in human prostate cancer. Prostate. 73:596–604. 2013. View Article : Google Scholar

38 

Kang Q, Song WX, Luo Q, et al: A comprehensive analysis of the dual roles of BMPs in regulating adipogenic and osteogenic differentiation of mesenchymal progenitor cells. Stem Cells Dev. 18:545–559. 2009. View Article : Google Scholar

39 

Wang Q, Huang C, Xue M and Zhang X: Expression of endogenous BMP-2 in periosteal progenitor cells is essential for bone healing. Bone. 48:524–532. 2011. View Article : Google Scholar :

Related Articles

Journal Cover

September 2015
Volume 36 Issue 3

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Cao, Y., Lv, Q., & Lv, C. (2015). MicroRNA-153 suppresses the osteogenic differentiation of human mesenchymal stem cells by targeting bone morphogenetic protein receptor type II. International Journal of Molecular Medicine, 36, 760-766. https://doi.org/10.3892/ijmm.2015.2275
MLA
Cao, Y., Lv, Q., Lv, C."MicroRNA-153 suppresses the osteogenic differentiation of human mesenchymal stem cells by targeting bone morphogenetic protein receptor type II". International Journal of Molecular Medicine 36.3 (2015): 760-766.
Chicago
Cao, Y., Lv, Q., Lv, C."MicroRNA-153 suppresses the osteogenic differentiation of human mesenchymal stem cells by targeting bone morphogenetic protein receptor type II". International Journal of Molecular Medicine 36, no. 3 (2015): 760-766. https://doi.org/10.3892/ijmm.2015.2275