Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
September-2016 Volume 38 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2016 Volume 38 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Benzyl isothiocyanate inhibits inflammasome activation in E. coli LPS-stimulated BV2 cells

  • Authors:
    • Chang-Min Lee
    • Dae-Sung Lee
    • Won-Kyo Jung
    • Jong Su Yoo
    • Mi-Jin Yim
    • Yung Hyun Choi
    • Saegwang Park
    • Su-Kil Seo
    • Jung Sik Choi
    • Young-Min Lee
    • Won Sun Park
    • Il-Whan Choi
  • View Affiliations / Copyright

    Affiliations: Department of Molecular Microbiology and Immunology, Warren Alpert School of Medicine, Providence, RI 02912, USA, National Marine Biodiversity Institute of Korea, Seocheon, Republic of Korea, Department of Biomedical Engineering, and Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan, Republic of Korea, Department of Biochemistry, College of Oriental Medicine, Dongeui University, Busan, Republic of Korea , Department of Microbiology and Immunology, College of Medicine, Inje University, Busan, Republic of Korea, Department of Internal Medicine, Busan Paik Hospital, College of Medicine, Inje University, Busan, Republic of Korea, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, Republic of Korea
  • Pages: 912-918
    |
    Published online on: July 6, 2016
       https://doi.org/10.3892/ijmm.2016.2667
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Inflammasomes are multi-protein complexes that play a crucial role in innate immune responses. Benzyl isothiocyanate (BITC) is a naturally occurring compound found in cruciferous vegetables, and BITC exhibits potential as a chemopreventive agent. However, whether BITC exerts inflammasome-mediated regulatory effects on neuroinflammation is unknown. In this study, we examined the effects of BITC on inflammasome-mediated interleukin-1β (IL-1β) production in E. coli lipopolysaccharide (LPS)-stimulated BV2 microglial cells. IL-1β production is tightly regulated at the post-translational level through the inflammasoume. We measured the levels of IL-1β produced from the LPS-exposed BV2 microglial cells using enzyme-linked immunosorbent assays (ELISAs). The BITC regulatory mechanisms in inflammasome-mediated cellular signaling pathways were examined by RT-PCR, western blot analysis and electrophoretic mobility shift assays. BITC inhibited the secretion of IL-1β induced by LPS in the BV2 microglial cells. BITC inhibited inflammasome activation and NLR family, pyrin domain containing 3 (NLRP3)-mediated caspase-1 activation, and decreased the levels of inflammasome activation pro-inflammatory mediators, including mitochondrial reactive oxygen species (ROS) and adenosine triphosphate (ATP) secretion in the LPS-stimulated BV2 microglial cells. Furthermore, we demonstrated that nuclear factor-κB (NF-κB) activation induced by LPS was inhibited by BITC, which may contribute to the attenuated secretion of IL-1β. These BITC-mediated inhibitory effects on IL-1β expression may thus regulate neuroinflammation through the inflammasome-mediated signaling pathway.

Introduction

Interleukin-1β (IL-1β) is a pivotal pro-inflammatory cytokine that has been linked to the pathogenesis of a broad spectrum of acute and chronic inflammatory diseases (1). IL-1β is synthesized as a precursor in the cytosol in response to various stimuli. A low level of IL-1β in vivo can evoke various mediators, which induce an inflammatory response (2). IL-1β is considered an important pro-inflammatory cytokine in the brain and plays a critical role in the progression of neuroinflammation (3). Neuroinflammation is a well-known factor in the pathogenesis of neurodegenerative diseases, such as Alzheimer's disease (AD), Parkinson's disease (PD) and multiple sclerosis (MS) (4). IL-1β is produced by lipopolysaccharide (LPS)-stimulated BV2 microglia. LPS induces neuroinflammation by activating inflammatory cells, including astrocytes and microglial cells (5). In a previous study, it was shown that the systemic injection of LPS led to neuroinflammatory responses in the brain, which then led to amyloid-β accumulation (6).

As regards IL-1β biological activity, mature IL-1β is regulated through cytosolic multi-protein complexes referred to as inflammasomes, such as the NLR family, pyrin domain containing 3 (NLRP3) inflammasome, which contains a nucleotide binding domain leucine-rich repeat with a pyrin-domain containing 3 sensor, an apoptosis-associated speck-like protein containing a caspase-recruitment domain (ASC) adaptor and a caspase-1 enzyme (7,8). For the secretion of IL-1β, pro-IL-1β must be cleaved by activated caspase-1. Caspase-1 is activated by an inflammasome assembly with NLRP3, ASC and pro-caspase-1. LPS must induce IL-1β for caspase-1 activation in response to adenosine triphosphate (ATP), which is a well-characterized danger-associated molecular pattern (DAMP) (9,10). Extracellular ATP promotes NLRP3 inflammasome activation by stimulating purinergic receptor P2X ligand-gated ion channel 7 (P2X7) (11,12). Pro-caspase-1 association with NLRP3 binds the adaptor molecule ASC, leading to pro-caspase-1 activation, which, in turn, triggers pro-IL-1β processing to mature IL-1β, in LPS- and ATP-stimulated cells.

Isothiocyanates are found abundantly in cruciferous or 'cabbage family' vegetables, such as garden cress, broccoli, cabbage, kale, cauliflower and radish, and have been used as diet components with potent chemopreventive and/or anticancer properties (13,14). Certain isothiocyanates, such as sulforaphane (SFN), phenethyl isothiocyanate (PEITC), and benzyl isothiocyanate (BITC), are derived from glucosinolates in cruciferous vegetables (15). Among several isothiocyanates, BITC (C8H7NS) (Fig. 1A) is an effector molecule in many cruciferous vegetable defense systems with antioxidant, antitumor and anti-inflammatory activity (16–18). It has been indicated that BITC exhibits anti-inflammatory activities (18); however, to the best of our knowledge, no studies to date have examined the effects of BITC on neuroinflammation, and in particular, through inflammasome mediation. In the present study, we examined the inhibitory effects of BITC against IL-1β-induced expression in LPS-stimulated BV2 microglial cells, as well as its effects on intracellular signaling pathways, specifically inflammasome components.

Figure 1

Chemical structure of benzyl isothiocyanate (BITC) and the effect of BITC on BV2 microglial cell viability. (A) Chemical structure of BITC. (B) The cells were treated with various concentrations (1–30 µM) of BITC for 24 h. Cell viability was assessed using the cell counting kit-8 (CCK-8) assay, and the results are expressed as the percentage of surviving cells relative to the untreated cells. Each value indicates the mean ± SD and is representative of results obtained from 3 independent experiments. ***p<0.001 vs. untreated cells.

Materials and methods

Reagents

We purchased LPS, BITC, diphenyleneiodonium (DPI) and N-acetyl-L-cysteine (NAC) from Sigma Chemical Co. (St. Louis, MO, USA); YCG 063 was obtained from Millipore (Billerica, MA, USA). An antibody against nuclear factor-κB (NF-κB) (cat. no. 14-6731) was obtained from eBioscience (San Diego, CA, USA). The antibody against NLRP3 (cat. no. AG-20B-0014) was purchased from AdipoGen (San Diego, CA, USA). An antibody against IL-1β (cat. no. AF-401-NA) was purchased from R&D Systems (Minneapolis, MN, USA). An antibody against caspase-1 (cat. no. sc-514) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). The CellTiter-Glo® Luminescent assay was purchased from Promega (Madison, WI, USA).

Cell culture

The murine BV2 cell line, obtained from Professor Eun-Hye Joe (Ajou University School of Medicine, Suwon, Korea), was maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 µg/ml streptomycin at 37°C in a humidified incubator with 5% CO2. Confluent cultures were passed using trypsinization. For the experiments, the cells were washed twice with warm DMEM (without phenol red) and cultured in serum-free medium for 16 h prior to the treatments. In all the experiments, the cells were treated with various concentrations (1, 5 and 10 µM) of BITC for various periods of time prior to stimulation with LPS (1 µg/ml) for the indicated periods of time.

Determination of cell viability

Cell viability was assessed using the Cell Counting kit-8 (CCK-8; Dojindo Laboratories, Kumamoto, Japan). Briefly, wells containing 2×105 cells/ml were treated with BITC (0, 1, 5, 10, 20 and 30 µM). Following incubation for 24 h, the cells were washed twice with phosphate-buffered saline (PBS). CCK-8 was then added to each well followed by incubation at 37°C for 1 h followed by an analysis at 450 nm using a microplate reader (Model EL800; Bio-Tek Instruments, Winooski, VT, USA).

Reverse transcriptase-polymerase chain reaction (RT-PCR)

Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Total RNA (1.0 µg) which was obtained from the cells was reverse transcribed using M-MLV reverse transcriptase (Promega) to produce cDNA. The RT-generated cDNA encoding the IL-1β, NLRP3 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes was amplified using PCR and selective primers (Table I). Following amplification, portions of the PCR reactions were subjected to agarose gel electrophoresis.

Table I

Information on primers used in RT-PCR.

Table I

Information on primers used in RT-PCR.

GenesNCBI no.Primer sequences (5′–3′)Size
(bp)
IL-1βNM_008361F: CTCGTGCTGTCGGACCCATAT
R: TTGAAGACAAACCGC TTTTCCA
254
NLRP3NM_145827F: CTGTGTGTGGGACTGAAGCAC
R: GCAGCCCTGCTGTTTCAGCAC
543
GAPDHNM_001289726F: TTCACCACCATGGAGAAGGC
R: GGCATGGACTGTGGTCATGA
237

[i] IL-1β, interleukin-1β; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; F, forward; R, reverse.

Measurement of ATP levels

The total ATP content was measured using the CellTiter-Glo® Luminescence assay kit following the manufacturer's instructions. Briefly, the assay buffer and substrate were equilibrated to room temperature. The buffer was transferred and gently mixed with the substrate to obtain a homogeneous solution. Twenty microliters of the culture medium and 20 µl of the assay reagent were added to each well (384-well plate), and the content was gently mixed under light protection on an orbital shaker. After 10 min, the luminescence was measured using a Microplate Reader (SpectraMax L; Molecular Devices, Devon, UK) at 570 nm.

Enzyme-linked immunosorbent assay (ELISA)

The level of IL-1β expression was measured using an ELISA kit (R&D Systems). The cells were treated with various concentrations of NAC, DPI and YCG 063 for 1 h prior to LPS stimulation (1 µg/ml). Following incubation for 24 h, the culture supernatants were collected, and the IL-1β quantity was measured. The results of ELISA were quantified using an ELISA plate reader (Model EL800; Bio-Tek Instruments) at 450 nm, which was corrected for absorbance at 540 nm in accordance with the manufacturer's instructions.

Western blot analysis

The cells were washed 3 times with PBS and lysed with lysis buffer (Mammalian Cell-PE LB; G-Biosciences, St. Louis, MO, USA). Equal quantities of protein were separated on 10% sodium dodecyl sulfate (SDS)-polyacrylamide minigels and transferred onto nitrocellulose membranes. Following incubation with the appropriate primary antibody (IL-1β, NLRP3, caspase-1 and NF-κB), the membranes were incubated for 1 h at room temperature with a secondary antibody [goat anti-rabbit IgG (cat. no. 31460; Pierce, Rockford, IL, USA) goat anti-mouse IgG (cat. no. sc-2031; Santa Cruz Biotechnology, Inc.)] conjugated to horseradish peroxidase. Following 3 washes in Tris-buffered saline Tween-20 (TBST), the immunoreactive bands were visualized using the ECL detection system.

Electrophoretic mobility shift assay (EMSA)

Nuclear extract was prepared using the NE-PER nuclear extraction reagent (Pierce). An oligonucleotide containing the immunoglobulin κ-chain binding site (κB, 5′-GATCTCAGAGGGGACTTT CCGAGAGA-3′) was synthesized as a probe for the gel retardation assay. A non-radioactive method in which the 3′ end of the probe was labeled with biotin was used (Pierce). The binding reactions contained 5 µg of nuclear extract protein, buffer (10 mM Tris, pH 7.5, 50 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 0.05% Nonidet P-40, and 2.5% glycerol), 50 ng of poly(dI-dC) and 20 fM of the biotin-labeled DNA. The reactions were incubated for 20 min at room temperature in a final volume of 20 µl. The competition reactions were performed by the addition of a 100-fold excess of unlabeled κB to the reaction mixture. The mixture was then separated using electrophoresis on a 5% polyacrylamide gel in 0.5X Tris-borate buffer and transferred to nylon membranes. The biotin-labeled DNA was detected using a LightShift chemiluminescent EMSA kit (Pierce).

Statistical analysis

Data values represent the means ± standard deviation (SD). To analyze the data produced from the experiments with 2 independent variables, one-way analysis of variance (ANOVA) was performed using GraphPad Prism software (GraphPad Software, La Jolla, CA, USA). Values of p<0.05, p<0.01 and p<0.001 were considered to indicate statistically significant differences.

Results

Effects of BITC on BV2 microglial cell viability

Initially, we examined the viability of the BV2 microglial cells treated with BITC (1, 5, 10, 20 and 30 µM) by CCK-8 assay. Treatment of the BV2 microglial cells with up to 10 µM BITC did not produce any cytotoxic effects, whereas cell viability was significantly decreased by 80 and 82% following treatment with 20 and 30 µM BITC, respectively (Fig. 1B). Based on these results, BITC at concentrations of 1, 5 and 10 µM was used in the subsequent experiments.

Effects of BITC on IL-1β expression in LPS-stimulated BV2 microglial cells

The IL-1β expression levels increased considerably following the stimulation of BV2 microglial cells with LPS (Fig. 2). The inhibitory effects of BITC on IL-1β mRNA and protein expression were determined using RT-PCR and ELISA, respectively. The IL-1β mRNA levels were markedly upregulated after 3 h of LPS (1 µg/ml) stimulation, and BITC significantly decreased the IL-1β mRNA expression levels in the LPS-stimulated BV2 microglial cells in a concentration-dependent manner (Fig. 2A). To evaluate the effects of BITC on IL-1β protein expression in the LPS-stimulated BV2 microglial cells, the cells were treated with BITC (1, 5 and 10 µM) for 1 h prior to LPS stimulation for 48 h. Treatment with BITC suppressed the LPS-induced increase in IL-1β protein expression in a concentration-dependent manner (Fig. 2B). The results of ELISA revealed that the reduction in IL-1β protein levels correlated with a reduction i the corresponding mRNA levels.

Figure 2

Effect of benzyl isothiocyanate (BITC) on intereukin-1β (IL-1β) production by lipopolysaccharide (LPS)-stimulated BV2 microglial cells. The cells were seeded at 2×105 cells/ml and incubated with various concentrations (1, 5 and 10 µM) of BITC for 1 h prior to LPS stimulation (1 µg/ml) (A) Following stimulation with LPS for 3 h, the IL-1β mRNA expression level was determined by RT-PCR. GAPDH was used as an internal control for RT-PCR. (B) Following incubation for 48 h, the culture supernatant was collected, and the quantity of IL-1β was measured by ELISA. Each value indicates the mean ± SD and is representative of results obtained from 3 independent experiments. #p<0.05 vs. control group (no treatment); ***p<0.001 vs. LPS-stimulated group.

Effects of BITC on NLRP3 and caspase-1 activation in LPS-stimulated BV2 microglial cells

To determine whether BITC affects NLRP3 and caspase-1 activation, the BV2 microglial cells were stimulated with LPS in the presence or absence of BITC. LPS significantly increased NLRP3 mRNA expression (Fig. 3A). However, treatment with BITC attenuated the increase in NLRP3 mRNA expression. To evaluate the effects of BITC on NALP3 and caspase-1 protein expression in the LPS-stimulated BV2 microglial cells, we pre-treated the cells with BITC (1, 5 and 10 µM) prior to stimulation with LPS. Treatment with BITC suppressed the LPS-induced production of NLRP3 and caspase-1 (the subunit p10) activation in a concentration-dependent manner (Fig. 3B).

Figure 3

Effects of benzyl isothiocyanate (BITC) on NLRP3 and caspase-1 activation in lipopolysaccharide (LPS)-stimulated BV2 microglial cells. The cells were seeded at 2×105 cells/ml and incubated with various concentrations (1, 5, and 10 µM) of BITC for 1 h prior to LPS stimulation (1 µg/ml). (A) Following stimulation with LPS for 3 h, the NLRP3 mRNA expression levels were determined by RT-PCR. GAPDH was used as an internal control for RT-PCR. (B) Following stimulation with LPS for 24 h, the cell lysates were resolved on sodium dodecyl sulfate (SDS)-polyacrylamide gels, transferred onto nitrocellulose membranes, and probed using antibodies against NLRP3 and caspase-1. Actin was used as an internal control for western blot analysis. Pro Cas-1, procaspase-1; Act Cas-1, active caspase-1.

Effects of BITC on ATP levels in LPS-stimulated BV2 microglial cells

To quantify the total extracellular ATP levels, the BV2 microglial cells were stimulated with LPS in the presence or absence of BITC. LPS significantly increased the ATP levels (Fig. 4). To examine the effects of BITC on the ATP levels in LPS-stimulated BV2 microglial cells, we pre-treated the cells with BITC (1, 5 and 10 µM) prior to stimulation with LPS. Treatment with BITC prevented the LPS-induced increase in ATP levels.

Figure 4

Effects of benzyl isothiocyanate (BITC) on adenosine triphosphate (ATP) levels in lipopolysaccharide (LPS)-stimulated BV2 microglial cells. The cells were seeded at 2×105 cells/ml and incubated with various concentrations (1, 5 and 10 µM) of BITC for 1 h prior to LPS stimulation (1 µg/ml) for 5 min. The cell culture supernatant was analyzed for ATP secretion. ATP levels in the medium were detected using a luminescence-based assay in accordance with the manufacturer's instructions. Each value indicates the mean ± SD and is representative of results obtained from 3 independent experiments. #p<0.05 vs. control group (no treatment); ***p<0.001 vs. LPS-stimulated group.

Involvement of mitochondrial ROS in NLRP3 and caspase-1 activation

We examined whether the LPS-induced IL-1β production is associated with ROS generation (Fig. 5). First, the BV2 microglial cells were stimulated with LPS for 24 h in the presence or absence of ROS inhibitors, such as the ROS scavenger, NAC (2 or 5 mM), the NADPH oxidase inhibitor, DPI (0.1 or 0.2 µM), and the mitochondrial ROS inhibitor, YCG 063 (10 or 20 µM) (Fig. 5A). YCG 063 significantly inhibited the LPS-induced production of IL-1β. However, IL-1β expression was not altered in the cells pre-treated with NAC and DPI. To further determine the involvement of mitochondrial ROS in the inflammasome pathway, we analyzed inflammasome activation in the BV2 microglial cells. The immunoblot data showed that treatment with YCG 063 suppressed inflammasome activation, including NLRP3 and the active form of caspase-1 (Fig. 5B).

Figure 5

Involvement of mitochondrial reactive oxygen species (ROS) in the activation of NLRP3 and caspase-1. (A) Cells were seeded at 2×105 cells/ml and incubated with the indicated concentrations of N-Acetyl-l-cysteine (NAC), diphenyleneiodonium (DPI) and YCG 063 for 1 h prior to lipopolysaccharide (LPS) stimulation (1 µg/ml). Following incubation for 24 h, the culture thye supernatant was collected, and the IL-1β quantity was measured by ELISA. Each value indicates the mean ± SD and is representative of results obtained from 3 independent experiments. #p<0.05 vs. control group (no treatment); *p<0.05, **p<0.01 and ***p<0.001 vs. LPS-stimulated group. (B) Following stimulation with LPS for 24 h, the cell lysates were resolved on sodium dodecyl sulfate (SDS)-polyacrylamide gels, transferred onto nitrocellulose membranes, and probed using antibodies against NLRP3 and caspase-1. Actin was used as an internal control for western blot analysis. Pro Cas-1, procaspase-1; Act Cas-1, active caspase-1.

Effects of BITC on NF-κB activation in LPS-stimulated BV2 microglial cells

The production of IL-1β is regulated by the transcription factor, NF-κB. Furthermore, NF-κB plays a critical role in priming the NLRP3 inflammasome (19). Therefore, to elucidate the mechanisms through which BITC affects IL-1β expression, we examined the effects of BITC on NF-κB activation. We examined the effects of BITC on LPS-induced NF-κB p65 nuclear translocation as NF-κB translocation to the nucleus is required for NF-κB-dependent transcription following LPS stimulation. The nuclear localization of NF-κB p65 was examined by western blot analysis. The results revealed that stimulation of the BV2 microglial cells LPS strongly induced NF-κB p65 nuclear localization. The LPS-induced NF-κB p65 translocation was abolished by pre-treatment of the cells with BITC (Fig. 6A). We then examined the effects of BITC on the DNA-binding activity of NF-κB by EMSA (Fig. 6B); stimulation with LPS significantly increased the DNA-binding activity of NF-κB, whereas pre-treatment wiht BITC reduced the LPS-induced NF-κB DNA-binding activity.

Figure 6

Effect of benzyl isothiocyanate (BITC) on the nuclear factor-κB (NF-κB) translocation and binding to lipopolysaccharide (LPS)-stimulated BV2 microglial cell nuclei. The cells were treated with BITC (1, 5 and 10 µM) for 1 h and then stimulated with LPS for 2 h. (A) Nuclear extracts were prepared as described in the Materials and methods and NF-κB translocation was evaluated by western blot analysis. (B) Nuclear protein extracts were prepared and analyzed for NF-κB DNA binding activity using an electrophoretic mobility shift assay (EMSA). Cold-κB, unlabeled NF-κB probe.

Discussion

Neuroinflammation may be a common characteristic of various neurological and neurodegenerative disorders through release of proinflammatory cytokines and chemokines (20). A recent study demonstrated that inflammasome-mediated inflammation is involved in infectious diseases affecting the central nervous system (CNS) (21). In this respect, the regulation of inflammasome-mediated inflammatory pathways involved in infectious diseases affecting the CNS has gained attention. In this study, we investigated the inhibitory effects of BITC on IL-1β production in E. coli LPS-stimulated BV2 microglia. Additionally, we explored the several mechanisms involved in the inhibitory effects of BITC, specifically inflammasome-associated pathways.

Microglia are the resident marcrophage cells and are widely distributed in the brain. In response to brain neuroinflammatory stimuli, activated microglia can overproduce pro-inflammatory and/or neurotoxic factors, including pro-inflammatory cytokines [IL-1, IL-6 and tumor necrosis factor-α (TNF-α)], nitric oxide (NO), prostaglandin E2 (PGE2) and ROS (22). These factors are involved in pathological conditions of various neurodegenerative diseases, such as AD, PD, MS, trauma and cerebral ischemia (23,24). Thus, reducing pro-inflammatory mediators in microglia may attenuate the severity of neurodegenerative disorders (25,26). Activated microglia are major cellular sources of the pro-inflammatory and/or cytotoxic factors that lead to neuronal damage in the CNS. Among the pro-inflammatory cytokines involved in neuroinflammation, IL-1β results from the inflammasome activation pathway. In this study, we demonstrate the inhibitory effects of BITC on low levels of IL-1β production in ultrapure E. coli LPS-stimulated BV2 microglia without the addition of extracellular ATP.

LPS induces neuroinflammation by activating inflammatory cells, including astrocytes and microglial cells (27,28). In a previous study, systemically injecting LPS led to neuroinflammatory responses in the brain, leading to amyloid-β accumulation (Aβ), which is toxic to neurons (29). IL-1β is produced in LPS-stimulated BV2 microglia. The present study demonstrated that BITC inhibited IL-1β production in LPS-stimulated BV2 microglia (Fig. 2). The inflammasome is required for IL-1β maturation in LPS-stimulated BV2 microglia. In this regard, we investigated whether BITC inhibits IL-1β expression by suppressing inflammasome activation. The cells were stimulated with LPS followed by the assembly and activation of the inflammasome, which facilitated caspase-1 activation. Without extracellular ATP, the expression of NLRP3 and active caspase-1 markedly increased in response to LPS stimulation; however, treatment with BITC ameliorated this increase in a dose-dependent manner (Fig. 3). Therefore, the regulation of IL-1β production by BITC may be an effective means of inhibiting neuroinflammation through the attenuation of inflammasome activation.

Cell priming with LPS is necessary for ATP binding to surface-expressed P2X7 purinergic receptors (P2X7Rs), which are ATP-gated non-selective cation channels, to induce inflammasome activation, which results in IL-1β secretion (30). A recent study showed that P2X7Rs contribute to various CNS pathologies (31). ATP, a damage associated molecular pattern, is released by any type of cell injury. ATP binding to P2X7R facilitates K+ efflux, which then activates the NLRP3 inflammasome (32). To determine whether BITC inhibits IL-1β production by altering ATP secretion, we measured the levels of secreted ATP in LPS-stimulated BV2 microglia. BITC dereased ATP secretion in a concentration-dependent manner (Fig. 4).

Although certain scholars debate this point, the field generally accepts the in vitro macrophage studies indicating that the activation and release of IL-1β via an NLRP3-inflammasome-dependent response requires two distinct signals: i) first, a priming signal can be triggered by pathogen-associated molecular pattern (PAMP) molecules, such as LPS, that target toll-like receptors and NF-κB, which leads to pro-IL-1β synthesis; ii) second, a signal can be derived from P2X7R activation, which leads to caspase-1 activation and the release of IL-1β (33,34). Therefore, LPS, the first signal, combined with ATP, the second signal, are commonly used to induce IL-1β production in microphages in vitro. However, LPS stimulation alone upregulated IL-1β production in our in vitro study (Fig. 2). In addition, we found that stimulation with LPS alone induced NLRP3 and caspase-1 activation (Fig. 3). Therefore, we examined whether LPS stimulation alone can induce ATP secretion. Of note, in our in vitro study, LPS stimulation alone significantly upregulated ATP secretion (Fig. 4). ATP acted in an autocrine mode when LPS stimulation alone was used for stimulation. Furthermore, while P2X7R did not induce expression with LPS stimulation, at almost basal levels, the BV2 cells constitutively expressed P2X7R (data not shown). However, BITC decreased ATP secretion in a concentration-dependent manner in the LPS-stimulated BV2 microglia (Fig. 4).

NLRP3 inflammasome activation has been widely implicated in ROS and NF-κB signaling (19,35). Therefore, NF-κB signaling and ROS levels were examined in this study. It has been proposed that ROS are an actual trigger for NLRP3 inflammasome assembly (36). Furthermore, potassium efflux triggers ROS production in human granulocytes (37). To investigate whether ROS production was responsible for the enhanced IL-1β production, we stimulated the cells with LPS in the presence of a mitochondrial ROS inhibitor or total ROS scavenger. In the present study, YCG 063, a mitochondrial ROS inhibitor, inhibited IL-1β production. However, NAC or DPI did not attenuate ROS production. In previous studies, mitochondrial-derived ROS were shown to be associated with NLRP3 activation (38–40). These data suggest that BITC attenuates NLRP3 activation via mitochondria-generated ROS inhibition. Furthermore, a previous study reported that NF-κB is involved in IL-1β, NLRP3 and caspase-1 expression (41). In previous studies, LPS-induced neuroinflammation was associated with upregulated NF-κB expression (42,43). Consistent with these studies, we investigated whether the treatment of LPS-stimulated BV2 microglia with BITC inhibits NF-κB activation. We found that BITC inhibited NF-κB activation. Collectively, based on these previous observations and our results, BITC likely attenuates IL-1β production and NLRP3 inflammasome activation by inhibiting mitochondrial ROS generation and NF-κB activation. Our results are consistent with those of previous publications, showing that LPS or NF-κB prime NLRP3 complex formation and ROS activate the NLRP3 complex (19,30,44).

In conclusion, our data demonstrate that BITC decreases IL-1β production in activated BV2 microglia. Our data also show that the decreased IL-1β production and the inhibition of NLRP3 inflammasome activation is associated with the attenuation of mitochondrial ROS generation and NF-κB activation by treatment with BITC. Thus, treatment with BITC may be an effective novel therapeutic strategy with which to combat inflammation-associated pathological damage which occurs due to LPS by targeting inflammasome-mediated signaling pathways. Further studies are warranted however, to determine whether BITC suppresses LPS-induced inflammasome-related neuroinflammation in vivo.

Acknowledgments

This study was supported by the Basic Science Research program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (no. 2013R1A1A4A01011649).

References

1 

Dinarello CA: A clinical perspective of IL-1β as the gatekeeper of inflammation. Eur J Immunol. 41:1203–1217. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Li L, Fei Z, Ren J, Sun R, Liu Z, Sheng Z, Wang L, Sun X, Yu J, Wang Z, et al: Functional imaging of interleukin 1 beta expression in inflammatory process using bioluminescence imaging in transgenic mice. BMC Immunol. 9:492008. View Article : Google Scholar : PubMed/NCBI

3 

Allan SM, Tyrrell PJ and Rothwell NJ: Interleukin-1 and neuronal injury. Nat Rev Immunol. 5:629–640. 2005. View Article : Google Scholar : PubMed/NCBI

4 

Cappellano G, Carecchio M, Fleetwood T, Magistrelli L, Cantello R, Dianzani U and Comi C: Immunity and inflammation in neurodegenerative diseases. Am J Neurodegener Dis. 2:89–107. 2013.PubMed/NCBI

5 

Lu X, Ma L, Ruan L, Kong Y, Mou H, Zhang Z, Wang Z, Wang JM and Le Y: Resveratrol differentially modulates inflammatory responses of microglia and astrocytes. J Neuroinflammation. 7:462010. View Article : Google Scholar : PubMed/NCBI

6 

Sheng JG, Bora SH, Xu G, Borchelt DR, Price DL and Koliatsos VE: Lipopolysaccharide-induced-neuroinflammation increases intracellular accumulation of amyloid precursor protein and amyloid beta peptide in APPswe transgenic mice. Neurobiol Dis. 14:133–145. 2003. View Article : Google Scholar : PubMed/NCBI

7 

Cassel SL, Joly S and Sutterwala FS: The NLRP3 inflammasome: A sensor of immune danger signals. Semin Immunol. 21:194–198. 2009. View Article : Google Scholar : PubMed/NCBI

8 

De Nardo D and Latz E: NLRP3 inflammasomes link inflammation and metabolic disease. Trends Immunol. 32:373–379. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Englezou PC, Rothwell SW, Ainscough JS, Brough D, Landsiedel R, Verkhratsky A, Kimber I and Dearman RJ: P2X7R activation drives distinct IL-1 responses in dendritic cells compared to macrophages. Cytokine. 74:293–304. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Mariathasan S, Weiss DS, Newton K, McBride J, O'Rourke K, Roose-Girma M, Lee WP, Weinrauch Y, Monack DM and Dixit VM: Cryopyrin activates the inflammasome in response to toxins and ATP. Nature. 440:228–232. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Schroder K, Zhou R and Tschopp J: The NLRP3 inflammasome: A sensor for metabolic danger? Science. 327:296–300. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Ferrari D, Pizzirani C, Adinolfi E, Lemoli RM, Curti A, Idzko M, Panther E and Di Virgilio F: The P2X7 receptor: A key player in IL-1 processing and release. J Immunol. 176:3877–3883. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Lam TK, Gallicchio L, Lindsley K, Shiels M, Hammond E, Tao XG, Chen L, Robinson KA, Caulfield LE, Herman JG, et al: Cruciferous vegetable consumption and lung cancer risk: A systematic review. Cancer Epidemiol Biomarkers Prev. 18:184–195. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Tang L, Paonessa JD, Zhang Y, Ambrosone CB and McCann SE: Total isothiocyanate yield from raw cruciferous vegetables commonly consumed in the United States. J Funct Foods. 5:1996–2001. 2013. View Article : Google Scholar

15 

Wu X, Zhou QH and Xu K: Are isothiocyanates potential anticancer drugs? Acta Pharmacol Sin. 30:501–512. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Lee Y, Kim YJ, Choi YJ, Lee JW, Lee S and Chung HW: Enhancement of cisplatin cytotoxicity by benzyl isothiocyanate in HL-60 cells. Food Chem Toxicol. 50:2397–2406. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Lai KC, Huang AC, Hsu SC, Kuo CL, Yang JS, Wu SH and Chung JG: Benzyl isothiocyanate (BITC) inhibits migration and invasion of human colon cancer HT29 cells by inhibiting matrix metalloproteinase-2/-9 and urokinase plasminogen (uPA) through PKC and MAPK signaling pathway. J Agric Food Chem. 58:2935–2942. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Lee YM, Seon MR, Cho HJ, Kim JS and Park JH: Benzyl isothiocyanate exhibits anti-inflammatory effects in murine macrophages and in mouse skin. J Mol Med Berl. 87:1251–1261. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Bauernfeind FG, Horvath G, Stutz A, Alnemri ES, MacDonald K, Speert D, Fernandes-Alnemri T, Wu J, Monks BG, Fitzgerald KA, et al: Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression. J Immunol. 183:787–791. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Hagberg H, Mallard C, Ferriero DM, Vannucci SJ, Levison SW, Vexler ZS and Gressens P: The role of inflammation in perinatal brain injury. Nat Rev Neurol. 11:192–208. 2015. View Article : Google Scholar : PubMed/NCBI

21 

de Rivero Vaccari JP, Dietrich WD and Keane RW: Therapeutics targeting the inflammasome after central nervous system injury. Transl Res. 167:35–45. 2016. View Article : Google Scholar

22 

Jung WK, Lee DY, Park C, Choi YH, Choi I, Park SG, Seo SK, Lee SW, Yea SS, Ahn SC, et al: Cilostazol is anti-inflammatory in BV2 microglial cells by inactivating nuclear factor-kappaB and inhibiting mitogen-activated protein kinases. Br J Pharmacol. 159:1274–1285. 2010. View Article : Google Scholar : PubMed/NCBI

23 

McGeer PL and McGeer EG: The inflammatory response system of brain: Implications for therapy of Alzheimer and other neurodegenerative diseases. Brain Res Brain Res Rev. 21:195–218. 1995. View Article : Google Scholar : PubMed/NCBI

24 

González-Scarano F and Baltuch G: Microglia as mediators of inflammatory and degenerative diseases. Annu Rev Neurosci. 22:219–240. 1999. View Article : Google Scholar : PubMed/NCBI

25 

Liu B and Hong JS: Role of microglia in inflammation-mediated neurodegenerative diseases: Mechanisms and strategies for therapeutic intervention. J Pharmacol Exp Ther. 304:1–7. 2003. View Article : Google Scholar

26 

Eikelenboom P and van Gool WA: Neuroinflammatory perspectives on the two faces of Alzheimer's disease. J Neural Transm Vienna. 111:281–294. 2004. View Article : Google Scholar : PubMed/NCBI

27 

Pascual-Lucas M, Fernandez-Lizarbe S, Montesinos J and Guerri C: LPS or ethanol triggers clathrin- and rafts/caveolae-dependent endocytosis of TLR4 in cortical astrocytes. J Neurochem. 129:448–462. 2014. View Article : Google Scholar

28 

Min KJ, Choi K and Kwon TK: Withaferin A down-regulates lipopolysaccharide-induced cyclooxygenase-2 expression and PGE2 production through the inhibition of STAT1/3 activation in microglial cells. Int Immunopharmacol. 11:1137–1142. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Lull ME and Block ML: Microglial activation and chronic neurodegeneration. Neurotherapeutics. 7:354–365. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Franchi L, Eigenbrod T and Núñez G: Cutting edge: TNF-alpha mediates sensitization to ATP and silica via the NLRP3 inflammasome in the absence of microbial stimulation. J Immunol. 183:792–796. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Sperlágh B and Illes P: P2X7 receptor: An emerging target in central nervous system diseases. Trends Pharmacol Sci. 35:537–547. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Choi AJ and Ryter SW: Inflammasomes: Molecular regulation and implications for metabolic and cognitive diseases. Mol Cells. 37:441–448. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Mariathasan S and Monack DM: Inflammasome adaptors and sensors: Intracellular regulators of infection and inflammation. Nat Rev Immunol. 7:31–40. 2007. View Article : Google Scholar

34 

Guo H, Callaway JB and Ting JP: Inflammasomes: Mechanism of action, role in disease, and therapeutics. Nat Med. 21:677–687. 2015. View Article : Google Scholar : PubMed/NCBI

35 

Martinon F: Signaling by ROS drives inflammasome activation. Eur J Immunol. 40:616–619. 2010. View Article : Google Scholar : PubMed/NCBI

36 

Tschopp J and Schroder K: NLRP3 inflammasome activation: The convergence of multiple signalling pathways on ROS production? Nat Rev Immunol. 10:210–215. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Fay AJ, Qian X, Jan YN and Jan LY: SK channels mediate NADPH oxidase-independent reactive oxygen species production and apoptosis in granulocytes. Proc Natl Acad Sci USA. 103:17548–17553. 2006. View Article : Google Scholar : PubMed/NCBI

38 

Zhou R, Yazdi AS, Menu P and Tschopp J: A role for mitochondria in NLRP3 inflammasome activation. Nature. 469:221–225. 2011. View Article : Google Scholar

39 

Wen H, Gris D, Lei Y, Jha S, Zhang L, Huang MT, Brickey WJ and Ting JP: Fatty acid-induced NLRP3-ASC inflammasome activation interferes with insulin signaling. Nat Immunol. 12:408–415. 2011. View Article : Google Scholar : PubMed/NCBI

40 

Nakahira K, Haspel JA, Rathinam VA, Lee SJ, Dolinay T, Lam HC, Englert JA, Rabinovitch M, Cernadas M, Kim HP, et al: Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nat Immunol. 12:222–230. 2011. View Article : Google Scholar

41 

Budai MM, Varga A, Milesz S, Tőzsér J and Benkő S: Aloe vera downregulates LPS-induced inflammatory cytokine production and expression of NLRP3 inflammasome in human macrophages. Mol Immunol. 56:471–479. 2013. View Article : Google Scholar : PubMed/NCBI

42 

Zhang F, Qian L, Flood PM, Shi JS, Hong JS and Gao HM: Inhibition of IkappaB kinase-beta protects dopamine neurons against lipopolysaccharide-induced neurotoxicity. J Pharmacol Exp Ther. 333:822–833. 2010. View Article : Google Scholar : PubMed/NCBI

43 

Hang CH, Shi JX, Tian J, Li JS, Wu W and Yin HX: Effect of systemic LPS injection on cortical NF-kappaB activity and inflammatory response following traumatic brain injury in rats. Brain Res. 1026:23–32. 2004. View Article : Google Scholar : PubMed/NCBI

44 

Land WG: Transfusion-related acute lung injury: The work of DAMPs. Transfus Med Hemother. 40:3–13. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lee C, Lee D, Jung W, Yoo JS, Yim M, Choi YH, Park S, Seo S, Choi JS, Lee Y, Lee Y, et al: Benzyl isothiocyanate inhibits inflammasome activation in E. coli LPS-stimulated BV2 cells. Int J Mol Med 38: 912-918, 2016.
APA
Lee, C., Lee, D., Jung, W., Yoo, J.S., Yim, M., Choi, Y.H. ... Choi, I. (2016). Benzyl isothiocyanate inhibits inflammasome activation in E. coli LPS-stimulated BV2 cells. International Journal of Molecular Medicine, 38, 912-918. https://doi.org/10.3892/ijmm.2016.2667
MLA
Lee, C., Lee, D., Jung, W., Yoo, J. S., Yim, M., Choi, Y. H., Park, S., Seo, S., Choi, J. S., Lee, Y., Park, W. S., Choi, I."Benzyl isothiocyanate inhibits inflammasome activation in E. coli LPS-stimulated BV2 cells". International Journal of Molecular Medicine 38.3 (2016): 912-918.
Chicago
Lee, C., Lee, D., Jung, W., Yoo, J. S., Yim, M., Choi, Y. H., Park, S., Seo, S., Choi, J. S., Lee, Y., Park, W. S., Choi, I."Benzyl isothiocyanate inhibits inflammasome activation in E. coli LPS-stimulated BV2 cells". International Journal of Molecular Medicine 38, no. 3 (2016): 912-918. https://doi.org/10.3892/ijmm.2016.2667
Copy and paste a formatted citation
x
Spandidos Publications style
Lee C, Lee D, Jung W, Yoo JS, Yim M, Choi YH, Park S, Seo S, Choi JS, Lee Y, Lee Y, et al: Benzyl isothiocyanate inhibits inflammasome activation in E. coli LPS-stimulated BV2 cells. Int J Mol Med 38: 912-918, 2016.
APA
Lee, C., Lee, D., Jung, W., Yoo, J.S., Yim, M., Choi, Y.H. ... Choi, I. (2016). Benzyl isothiocyanate inhibits inflammasome activation in E. coli LPS-stimulated BV2 cells. International Journal of Molecular Medicine, 38, 912-918. https://doi.org/10.3892/ijmm.2016.2667
MLA
Lee, C., Lee, D., Jung, W., Yoo, J. S., Yim, M., Choi, Y. H., Park, S., Seo, S., Choi, J. S., Lee, Y., Park, W. S., Choi, I."Benzyl isothiocyanate inhibits inflammasome activation in E. coli LPS-stimulated BV2 cells". International Journal of Molecular Medicine 38.3 (2016): 912-918.
Chicago
Lee, C., Lee, D., Jung, W., Yoo, J. S., Yim, M., Choi, Y. H., Park, S., Seo, S., Choi, J. S., Lee, Y., Park, W. S., Choi, I."Benzyl isothiocyanate inhibits inflammasome activation in E. coli LPS-stimulated BV2 cells". International Journal of Molecular Medicine 38, no. 3 (2016): 912-918. https://doi.org/10.3892/ijmm.2016.2667
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team